ID: 900074405

View in Genome Browser
Species Human (GRCh38)
Location 1:801415-801437
Sequence GAGTGACCCTGAGCCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900074405_900074406 9 Left 900074405 1:801415-801437 CCTGGGAGGGCTCAGGGTCACTC No data
Right 900074406 1:801447-801469 CTTTCCCATGCGCTGCTGTGAGG 0: 3
1: 0
2: 3
3: 8
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900074405 Original CRISPR GAGTGACCCTGAGCCCTCCC AGG (reversed) Intergenic
No off target data available for this crispr