ID: 900079511

View in Genome Browser
Species Human (GRCh38)
Location 1:845139-845161
Sequence TGGAAATCCCTGAAAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900079511_900079519 30 Left 900079511 1:845139-845161 CCATGTTTTTTCAGGGATTTCCA No data
Right 900079519 1:845192-845214 TCTCCTTTTGGATAGGTCCATGG No data
900079511_900079513 2 Left 900079511 1:845139-845161 CCATGTTTTTTCAGGGATTTCCA No data
Right 900079513 1:845164-845186 ACAGATTTTCCTGAGTACCCTGG No data
900079511_900079515 18 Left 900079511 1:845139-845161 CCATGTTTTTTCAGGGATTTCCA No data
Right 900079515 1:845180-845202 ACCCTGGATTAATCTCCTTTTGG No data
900079511_900079518 23 Left 900079511 1:845139-845161 CCATGTTTTTTCAGGGATTTCCA No data
Right 900079518 1:845185-845207 GGATTAATCTCCTTTTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900079511 Original CRISPR TGGAAATCCCTGAAAAAACA TGG (reversed) Intergenic
No off target data available for this crispr