ID: 900081279

View in Genome Browser
Species Human (GRCh38)
Location 1:860101-860123
Sequence CCTGCATGGAGCATTTTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900081279_900081285 10 Left 900081279 1:860101-860123 CCATACAAAATGCTCCATGCAGG No data
Right 900081285 1:860134-860156 AATCTAAAGAAACCTGAGGAAGG No data
900081279_900081284 6 Left 900081279 1:860101-860123 CCATACAAAATGCTCCATGCAGG No data
Right 900081284 1:860130-860152 CAGGAATCTAAAGAAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900081279 Original CRISPR CCTGCATGGAGCATTTTGTA TGG (reversed) Intergenic