ID: 900083106

View in Genome Browser
Species Human (GRCh38)
Location 1:873862-873884
Sequence GGTGAGCTCAGCCACAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900083106_900083110 30 Left 900083106 1:873862-873884 CCTTGACTGTGGCTGAGCTCACC No data
Right 900083110 1:873915-873937 GCTGCCCGTGACCCCCGTCACGG No data
900083106_900083109 8 Left 900083106 1:873862-873884 CCTTGACTGTGGCTGAGCTCACC No data
Right 900083109 1:873893-873915 GTTTGATGCTAAGAACATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900083106 Original CRISPR GGTGAGCTCAGCCACAGTCA AGG (reversed) Intergenic
No off target data available for this crispr