ID: 900083158

View in Genome Browser
Species Human (GRCh38)
Location 1:874197-874219
Sequence CTCCATTGGTACACGGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 6, 2: 12, 3: 8, 4: 24}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900083158 Original CRISPR CTCCATTGGTACACGGGCGA GGG Intergenic
900083158 1:874197-874219 CTCCATTGGTACACGGGCGAGGG + Intergenic
902747149 1:18481772-18481794 CTCCATTCGGACGCGGGCTATGG - Exonic
907230702 1:52995873-52995895 CTCCACTGGTACACAGCTGAGGG + Intronic
908871164 1:68614624-68614646 CTCCATTTTTACACGGACTAAGG - Intergenic
922668686 1:227493126-227493148 CTGCACTGGTACACGGGCGAGGG - Intergenic
922670910 1:227508173-227508195 CTGCACTGGTACACGGGCGAGGG + Intergenic
924243340 1:242060132-242060154 CTCCACTGGTACACGGGTGAGGG + Intergenic
1062763897 10:47187-47209 CTCCACTGGTACACGGGCGAGGG - Exonic
1076244274 10:128933945-128933967 CTCCATAGGTACAGGGACCAAGG - Intergenic
1091621594 12:2093294-2093316 CTCCACTGGTACAGGGGAGTGGG - Intronic
1094813736 12:34164900-34164922 CTCCACTGGTAAACGGGTGAGGG - Intergenic
1095103188 12:38203629-38203651 CTCCACTGGTACAGGGGTGAGGG + Intergenic
1107540496 13:41384840-41384862 CTCCACTGGTACACAGGCGAGGG - Intergenic
1111353242 13:87061566-87061588 CTCAGTTGGTACACGGGCTTAGG + Intergenic
1121859540 14:97303695-97303717 CTCCATGTGTATACAGGCGATGG - Intergenic
1122613787 14:103002988-103003010 CTCCATTGGTTCACAGCAGATGG - Intronic
1128991008 15:72260463-72260485 CTCCTTTGGTACATGGGCTGGGG - Exonic
1140693086 16:77503448-77503470 CTCTATTGCTACACGAGGGAGGG - Intergenic
1142414825 16:89935634-89935656 CTGCACTGGTACACGGGCGAGGG + Exonic
1142440748 16:90096040-90096062 CTCCACTGGTACACAGGCGAGGG + Intergenic
1146500638 17:33361461-33361483 CTCCATTGGTACACAGAAGTAGG + Intronic
1148197198 17:45722452-45722474 CTCCACCGCTACACGGACGATGG - Intergenic
1152956805 18:47520-47542 CTCCACTGGTACACGGGCGAGGG - Exonic
1154204572 18:12325972-12325994 CTGCACTGGTTCACGGGTGAGGG + Exonic
1161815146 19:6495294-6495316 TTGCACTGGTACACGGGCGAGGG - Exonic
1162572640 19:11481878-11481900 CTCCTTTGGTGCGCGGGCGCCGG + Intronic
941963540 2:171277476-171277498 ATACATGGGTACACTGGCGAGGG - Intergenic
942733335 2:179082627-179082649 CCCCATTGGTACACTGCCTAGGG - Intergenic
944239865 2:197475936-197475958 CTACATTGGTACACTGGCCAGGG - Intergenic
948974391 2:241454978-241455000 CTCCAGTGGGACATGGGAGATGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
968357507 3:198120626-198120648 CTCTACTGGTACACGGGCGAGGG + Intergenic
969891940 4:10268042-10268064 CTGCACTGGTACACAGGTGAGGG - Intergenic
979502047 4:121451823-121451845 CTGCACTGGTACATGGGTGAGGG + Intergenic
985441032 4:189982626-189982648 CTCCACTGGTACACGGGCGAGGG - Intergenic
1003097426 6:3153996-3154018 CTGCACTGGTACACGGGCGAGGG - Exonic
1003106966 6:3224884-3224906 CTGCACTGGTACACGGGCGAGGG - Exonic
1005965589 6:30724245-30724267 CTCCACTGGTACACAGGCGAGGG + Exonic
1011628586 6:89302944-89302966 CTACACTGGTACATGGGCAAGGG + Intronic
1016377394 6:143436555-143436577 CTGCACTGGTACATGGGCGAGGG + Intronic
1025041150 7:55646799-55646821 CTCCACTGCTACACAGGCGAGGG + Intergenic
1038757287 8:30353190-30353212 CTCCACTGGTACACAGGCGAGGG + Intergenic
1050161060 9:2718793-2718815 CTCGAGTGCTTCACGGGCGAGGG + Exonic
1051878073 9:21811748-21811770 CTGTACTGGTACACGGGCGAGGG - Intronic
1056689237 9:88792525-88792547 CTCCATTCATACACGGGTGGAGG - Intergenic
1062584574 9:137243401-137243423 CTGCACTGGTACACGGGCGAGGG + Exonic
1062741359 9:138177112-138177134 CTCCACTGGTACACGGGCGAGGG + Intergenic
1197183599 X:123562823-123562845 CTGCACTGGTACACAGGCGAGGG + Intergenic
1201397934 Y:13569297-13569319 CTCCATTAAAACACGGGCAAAGG - Intergenic
1201758828 Y:17516963-17516985 CTCCACTGGTACACGGGCGAGGG - Intergenic
1201842727 Y:18389027-18389049 CTCCACTGGTACACGGGCGAGGG + Intergenic