ID: 900086777

View in Genome Browser
Species Human (GRCh38)
Location 1:902352-902374
Sequence CCCTCGTCTCAGAGGAAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900086772_900086777 -7 Left 900086772 1:902336-902358 CCGCTCATCTCCTGGGCCCTCGT No data
Right 900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG No data
900086770_900086777 -5 Left 900086770 1:902334-902356 CCCCGCTCATCTCCTGGGCCCTC No data
Right 900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG No data
900086769_900086777 -4 Left 900086769 1:902333-902355 CCCCCGCTCATCTCCTGGGCCCT No data
Right 900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG No data
900086765_900086777 16 Left 900086765 1:902313-902335 CCTGGAAGTGGACAGAGCACCCC No data
Right 900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG No data
900086763_900086777 23 Left 900086763 1:902306-902328 CCCAAAACCTGGAAGTGGACAGA No data
Right 900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG No data
900086768_900086777 -3 Left 900086768 1:902332-902354 CCCCCCGCTCATCTCCTGGGCCC No data
Right 900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG No data
900086764_900086777 22 Left 900086764 1:902307-902329 CCAAAACCTGGAAGTGGACAGAG No data
Right 900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG No data
900086771_900086777 -6 Left 900086771 1:902335-902357 CCCGCTCATCTCCTGGGCCCTCG No data
Right 900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900086777 Original CRISPR CCCTCGTCTCAGAGGAAGGA CGG Intergenic
No off target data available for this crispr