ID: 900088651

View in Genome Browser
Species Human (GRCh38)
Location 1:909925-909947
Sequence CTCGGTCCTTCCTCCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900088651_900088673 19 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088673 1:909967-909989 GGGGTCCTGGGCAGGGGCGGCGG No data
900088651_900088662 -2 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088662 1:909946-909968 AGGGTGGGCCCGGCGCGGGTGGG No data
900088651_900088663 -1 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088663 1:909947-909969 GGGTGGGCCCGGCGCGGGTGGGG No data
900088651_900088668 7 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088668 1:909955-909977 CCGGCGCGGGTGGGGGTCCTGGG No data
900088651_900088675 24 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088675 1:909972-909994 CCTGGGCAGGGGCGGCGGCGCGG No data
900088651_900088670 12 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088670 1:909960-909982 GCGGGTGGGGGTCCTGGGCAGGG No data
900088651_900088666 6 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088666 1:909954-909976 CCCGGCGCGGGTGGGGGTCCTGG No data
900088651_900088658 -7 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088658 1:909941-909963 GACCGAGGGTGGGCCCGGCGCGG No data
900088651_900088659 -6 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088659 1:909942-909964 ACCGAGGGTGGGCCCGGCGCGGG No data
900088651_900088677 29 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088677 1:909977-909999 GCAGGGGCGGCGGCGCGGCCGGG No data
900088651_900088671 13 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088671 1:909961-909983 CGGGTGGGGGTCCTGGGCAGGGG No data
900088651_900088664 0 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088664 1:909948-909970 GGTGGGCCCGGCGCGGGTGGGGG No data
900088651_900088676 28 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088676 1:909976-909998 GGCAGGGGCGGCGGCGCGGCCGG No data
900088651_900088672 16 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088672 1:909964-909986 GTGGGGGTCCTGGGCAGGGGCGG No data
900088651_900088669 11 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088669 1:909959-909981 CGCGGGTGGGGGTCCTGGGCAGG No data
900088651_900088661 -3 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088661 1:909945-909967 GAGGGTGGGCCCGGCGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900088651 Original CRISPR CTCGGTCCTTCCTCCCGGCC TGG (reversed) Intergenic
No off target data available for this crispr