ID: 900088658

View in Genome Browser
Species Human (GRCh38)
Location 1:909941-909963
Sequence GACCGAGGGTGGGCCCGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900088651_900088658 -7 Left 900088651 1:909925-909947 CCAGGCCGGGAGGAAGGACCGAG No data
Right 900088658 1:909941-909963 GACCGAGGGTGGGCCCGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900088658 Original CRISPR GACCGAGGGTGGGCCCGGCG CGG Intergenic
No off target data available for this crispr