ID: 900090036

View in Genome Browser
Species Human (GRCh38)
Location 1:916235-916257
Sequence GTGCCGAGTCCCACCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900090027_900090036 13 Left 900090027 1:916199-916221 CCACTCCCTCATCTGAGCAGGTG 0: 1
1: 0
2: 1
3: 16
4: 244
Right 900090036 1:916235-916257 GTGCCGAGTCCCACCCAGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 96
900090028_900090036 8 Left 900090028 1:916204-916226 CCCTCATCTGAGCAGGTGCTCCC 0: 1
1: 0
2: 1
3: 25
4: 198
Right 900090036 1:916235-916257 GTGCCGAGTCCCACCCAGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 96
900090024_900090036 20 Left 900090024 1:916192-916214 CCTGCTCCCACTCCCTCATCTGA 0: 1
1: 0
2: 0
3: 46
4: 534
Right 900090036 1:916235-916257 GTGCCGAGTCCCACCCAGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 96
900090029_900090036 7 Left 900090029 1:916205-916227 CCTCATCTGAGCAGGTGCTCCCA 0: 1
1: 0
2: 1
3: 16
4: 204
Right 900090036 1:916235-916257 GTGCCGAGTCCCACCCAGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 96
900090026_900090036 14 Left 900090026 1:916198-916220 CCCACTCCCTCATCTGAGCAGGT 0: 1
1: 0
2: 1
3: 18
4: 174
Right 900090036 1:916235-916257 GTGCCGAGTCCCACCCAGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900090036 Original CRISPR GTGCCGAGTCCCACCCAGAG GGG Intergenic
900090036 1:916235-916257 GTGCCGAGTCCCACCCAGAGGGG + Intergenic
900480790 1:2898186-2898208 GAGGCAAGTCCAACCCAGAGAGG + Intergenic
900682605 1:3925103-3925125 GTGCTGAGGGCCACCCAGGGTGG - Intergenic
900691514 1:3983327-3983349 GGTCCGAGAGCCACCCAGAGCGG - Intergenic
901122729 1:6908233-6908255 GTGCCAAGGCACACGCAGAGGGG + Intronic
902285488 1:15405786-15405808 TTGCTGGGTCCCAACCAGAGCGG + Intergenic
903997789 1:27318631-27318653 GCGCTGACTCCCACCAAGAGAGG + Intergenic
905029275 1:34870643-34870665 GTCCCAACCCCCACCCAGAGAGG + Intronic
910054290 1:83012731-83012753 GTGCCATGTCCCACCCAAAGAGG + Intergenic
918237922 1:182598298-182598320 ATGCCGAGTCCCAGCCAGGTGGG + Intergenic
920699768 1:208209073-208209095 GTCCCTAGTCCCAGGCAGAGTGG + Intronic
923388471 1:233489648-233489670 GTGCTGAGTCCCCTTCAGAGTGG - Intergenic
924071168 1:240280850-240280872 GCGCCGAGTCGTACCCAGTGTGG + Intronic
1065862452 10:29883190-29883212 CTCCCGAGACCAACCCAGAGGGG - Intergenic
1065876286 10:30000176-30000198 GCTCCGTGTTCCACCCAGAGAGG - Intergenic
1070765900 10:79056250-79056272 ATGCCCAATCCCACACAGAGAGG - Intergenic
1076591762 10:131588414-131588436 GTGCCGGGTCCGGCCCAAAGAGG - Intergenic
1076840451 10:133042704-133042726 GGGCTGAGTTCTACCCAGAGCGG + Intergenic
1077225252 11:1436712-1436734 GCTCCGGGTCCCACCCACAGTGG + Intronic
1079603297 11:22337776-22337798 GTACCGAGACCCGCCCAGACGGG + Intergenic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084904630 11:72336066-72336088 GTGCTGAATCCCACCTAGGGAGG + Intronic
1089001521 11:115055856-115055878 GTGCAGAGTCCCATTCAAAGAGG - Intergenic
1091225653 11:133955548-133955570 CTGCTGACTCCCACCCACAGCGG + Intronic
1092704727 12:11269766-11269788 GTGGTGAGGCCCACCCAGTGTGG - Exonic
1092712841 12:11355650-11355672 GTGGTGAGGCCCACCCAGTGTGG - Intronic
1092716637 12:11395626-11395648 GTGGTGAGGCCCACCCAGTGTGG - Intronic
1104961781 12:132491544-132491566 GGGCCGAGACCCGCCCAGCGAGG + Intronic
1113408905 13:110066342-110066364 GTGCTGAGTCCCACCCAGTCTGG + Intergenic
1119601178 14:75978400-75978422 GTGCTGAGCCCACCCCAGAGAGG - Intronic
1125611823 15:40976549-40976571 TTGCCAAGTCAGACCCAGAGGGG + Intergenic
1125736278 15:41928723-41928745 GTGCCGAGCACCACCCTGAGGGG + Intronic
1126578594 15:50221408-50221430 TTGAGGAGTCCCACCCAGAGAGG - Intronic
1127457613 15:59169388-59169410 GTGCAGAATCGAACCCAGAGTGG - Intronic
1127831056 15:62751739-62751761 GTTCAGAATCCAACCCAGAGTGG - Intronic
1131222452 15:90596321-90596343 GTGCAAAGTCCTACCCAGAAGGG + Intronic
1133659839 16:7905537-7905559 GTGCCCAGTCACACCAAGATTGG + Intergenic
1141456497 16:84145565-84145587 GTGCCGACTGCCCCCCAGGGAGG + Intronic
1141749270 16:85947288-85947310 GGGCCAAGTCCAGCCCAGAGTGG - Intergenic
1142144610 16:88487674-88487696 GGGCCGCGGCCCACCCAGCGGGG - Intronic
1142685072 17:1572818-1572840 GTGCCCAGTCCCAGCCAAAGTGG - Intronic
1142687865 17:1588044-1588066 GTGCCCAGTCCCAGCCAAAGTGG - Intronic
1146527779 17:33581586-33581608 GGGCCGACTCCCACCCTGTGGGG - Intronic
1152002842 17:77657335-77657357 GTGCCGAGAGACACCCAGAGTGG + Intergenic
1152300303 17:79491546-79491568 GTGACCAGTCCCACCCACATGGG + Intronic
1152322075 17:79613273-79613295 GTGGCCAGTCCCAACCACAGAGG - Intergenic
1154360255 18:13654747-13654769 TTCCAGAGACCCACCCAGAGTGG + Intergenic
1160420915 18:78743303-78743325 GGGCCGAGTCCCACACAGCCAGG + Intergenic
1160678249 19:401698-401720 GTGTCCAGTCCCACCCAGGAAGG + Intergenic
1161355806 19:3819119-3819141 GGGCCGTGTCCCACGCAGAGCGG - Exonic
1162410372 19:10502196-10502218 GGGCCGAGTGGCACCCAGGGAGG - Intronic
1165143998 19:33719989-33720011 GTGCCGAAGCTCTCCCAGAGGGG - Intronic
1165811607 19:38615139-38615161 GTGGCTGGTCCCACTCAGAGTGG - Intronic
1168714776 19:58520256-58520278 TTCCCCAGTCCCACCCACAGCGG - Intronic
925901091 2:8509999-8510021 GTGCTGTGTCCCCCCCAAAGTGG + Intergenic
930420861 2:51151747-51151769 GTCCCGAGCCCCACCCCGCGGGG + Intergenic
934624642 2:95836074-95836096 GTGGGAGGTCCCACCCAGAGAGG + Intergenic
934808939 2:97265346-97265368 GTGGGAGGTCCCACCCAGAGAGG - Intergenic
934828566 2:97491823-97491845 GTGGGAGGTCCCACCCAGAGAGG + Intergenic
936543025 2:113367490-113367512 GTGCAGTGTCCCACTCTGAGTGG + Intergenic
937303399 2:120856898-120856920 GGGCCCAGTTCAACCCAGAGAGG - Intronic
938069550 2:128301146-128301168 GACCCCAGTCCCACACAGAGGGG - Intronic
938990569 2:136624098-136624120 CTGGTGAGTCCCACCGAGAGAGG - Intergenic
1171147578 20:22799089-22799111 GTTCCCAGTCCCCACCAGAGCGG - Intergenic
1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG + Intronic
1171573575 20:26276846-26276868 GAGCCGACTCCCACCAAGGGAGG - Intergenic
1173669971 20:44792039-44792061 GTGCTGAGTCCCACCTTGAAGGG - Intronic
1175971210 20:62687620-62687642 CTGGAGAGGCCCACCCAGAGCGG - Intergenic
1176086486 20:63297621-63297643 GAGTCCAGTCCCACCCAGGGAGG - Intronic
1179929092 21:44555506-44555528 TTACAGAGTCCCACCCAGTGGGG + Intronic
1181025818 22:20126851-20126873 GTGCCGTCACCCACCCACAGCGG - Intronic
1184644784 22:45889912-45889934 GTGCCGAGTCCCGCCGATGGAGG - Intergenic
1184720284 22:46308708-46308730 GAGCCGAGGCTCACCCACAGGGG - Exonic
952316718 3:32238533-32238555 GCGCCGCGTCGCACCCAGGGTGG - Intergenic
952766338 3:36957239-36957261 GTGTAGAGCGCCACCCAGAGGGG - Intergenic
953623946 3:44555248-44555270 GTGCCGAGTGCCACCGCGAGTGG + Exonic
955472008 3:59295706-59295728 GTGCCAAGTCCCATCCAGCAAGG - Intergenic
958548572 3:95588667-95588689 GTGCCGAGCCCTGCCCAAAGGGG + Intergenic
963598451 3:147357140-147357162 GTCCCGCTTCCAACCCAGAGAGG + Intergenic
965702124 3:171468597-171468619 GTGGAGAGACCCACCCGGAGAGG - Intergenic
972241152 4:37193904-37193926 GTGCCCAGTCAAACCCTGAGAGG + Intergenic
985731575 5:1552279-1552301 CTCCCGAGTCCCACCCAGCCTGG - Intergenic
988787695 5:34579670-34579692 GTGCTAAATTCCACCCAGAGTGG - Intergenic
997413601 5:133708350-133708372 GGGCAGAGACCCACCCACAGCGG - Intergenic
1007107259 6:39292289-39292311 GTCCTGAGTCCTACCCAAAGTGG - Intergenic
1012552179 6:100473655-100473677 GTCCTGTGTCCCATCCAGAGGGG + Intergenic
1017437989 6:154435755-154435777 GTGCTGAGTGCCACCCAGGCTGG - Intronic
1018023882 6:159789341-159789363 GGGCCGAGTCCCACCGCGACCGG - Intronic
1019412341 7:911832-911854 GAGCCGACACCCACCCAGAGAGG + Intronic
1019552592 7:1610585-1610607 GGGCTGAGGCCCACCCAGCGAGG + Intergenic
1021862547 7:24921484-24921506 GTGCCCAGGCCAGCCCAGAGAGG + Intronic
1025284136 7:57649001-57649023 GAGCCGACTCCCACCAAGGGAGG + Intergenic
1026108242 7:67437817-67437839 GTGCCGAGGACCACCGGGAGGGG - Intergenic
1034994576 7:155569993-155570015 GTGCCCAGTCCCTGCCACAGCGG + Intergenic
1035670644 8:1414556-1414578 GTGCAGAGTCCACACCAGAGTGG + Intergenic
1036705459 8:11043038-11043060 GGGCTGGGGCCCACCCAGAGGGG + Intronic
1038523331 8:28252357-28252379 GTGCCCTGTCCCATCCACAGGGG + Intergenic
1049268455 8:141681818-141681840 GTGCCCAGGCTCACCCGGAGAGG - Intergenic
1049599430 8:143500143-143500165 GTGCTGAGGCCCACCCAGGATGG - Intronic
1058868299 9:109181319-109181341 CTGCCCAGTGACACCCAGAGAGG + Intronic
1061886319 9:133592752-133592774 GTTCCAAGTCCCACCCAGGCCGG + Intergenic
1062653731 9:137591161-137591183 GTACCCAGTCCCTCCCTGAGCGG - Intergenic
1186391262 X:9161867-9161889 GTGCAGATTCTCACCCAGCGAGG + Intronic
1189221087 X:39372656-39372678 CTGCTGAGTCCTGCCCAGAGTGG + Intergenic
1197281592 X:124543127-124543149 ATGCCATGTCCCATCCAGAGGGG + Intronic
1197701745 X:129605011-129605033 TTGCTGAGTCCCACCAAGAATGG + Intergenic
1198832396 X:140764627-140764649 GAGACGAGTCCTCCCCAGAGAGG + Intergenic