ID: 900091786

View in Genome Browser
Species Human (GRCh38)
Location 1:923983-924005
Sequence ACTGACGCGGCCCGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900091773_900091786 17 Left 900091773 1:923943-923965 CCCCGCCGGGCGGGCGCGCGCCA 0: 1
1: 0
2: 3
3: 20
4: 172
Right 900091786 1:923983-924005 ACTGACGCGGCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 127
900091774_900091786 16 Left 900091774 1:923944-923966 CCCGCCGGGCGGGCGCGCGCCAG 0: 1
1: 0
2: 1
3: 29
4: 214
Right 900091786 1:923983-924005 ACTGACGCGGCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 127
900091772_900091786 23 Left 900091772 1:923937-923959 CCAAGTCCCCGCCGGGCGGGCGC 0: 1
1: 0
2: 3
3: 19
4: 150
Right 900091786 1:923983-924005 ACTGACGCGGCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 127
900091777_900091786 12 Left 900091777 1:923948-923970 CCGGGCGGGCGCGCGCCAGTGGA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 900091786 1:923983-924005 ACTGACGCGGCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 127
900091771_900091786 24 Left 900091771 1:923936-923958 CCCAAGTCCCCGCCGGGCGGGCG 0: 1
1: 0
2: 2
3: 8
4: 76
Right 900091786 1:923983-924005 ACTGACGCGGCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 127
900091775_900091786 15 Left 900091775 1:923945-923967 CCGCCGGGCGGGCGCGCGCCAGT 0: 1
1: 0
2: 0
3: 9
4: 78
Right 900091786 1:923983-924005 ACTGACGCGGCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 127
900091780_900091786 -3 Left 900091780 1:923963-923985 CCAGTGGACGCGGGTGCACGACT 0: 1
1: 0
2: 0
3: 2
4: 20
Right 900091786 1:923983-924005 ACTGACGCGGCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900091786 Original CRISPR ACTGACGCGGCCCGGGCGGC GGG Intergenic
900091786 1:923983-924005 ACTGACGCGGCCCGGGCGGCGGG + Intergenic
900105267 1:978394-978416 ACAGACGCGTCCAGGGCGGGCGG - Intronic
900589442 1:3453255-3453277 ACCGACGAGGCCCGGCCTGCCGG - Intergenic
900663216 1:3796380-3796402 GCTGACGGGGCCCGGGCTGGAGG - Exonic
901428586 1:9198907-9198929 GCTGACTTGGCCCGGGCGGCGGG + Intergenic
901642896 1:10701975-10701997 ACAGACGCCGCCCAGGCAGCGGG - Intronic
916130206 1:161606049-161606071 GCTGACTCAGCCCGGGCGGGCGG + Intronic
920069245 1:203290567-203290589 AGTGACGCGGCGCGGGAGGGAGG - Intergenic
922958638 1:229626058-229626080 ACTGACACGGAGCGGGCCGCGGG + Intergenic
924188280 1:241519473-241519495 TCTGGCGCGGCCCGGACGCCCGG + Intronic
1065124423 10:22560336-22560358 AGTGAGGTGGCCAGGGCGGCGGG - Intronic
1073150845 10:101310533-101310555 CCTGACGCGGGTCGGGCAGCGGG - Intergenic
1073199774 10:101725973-101725995 ACTGACCAGGTCCGGGCTGCTGG + Intergenic
1074088399 10:110226037-110226059 GCTGGCGCGGCTGGGGCGGCAGG + Intronic
1076423738 10:130352408-130352430 GCTGAGGCGGCCCAGGCGTCAGG + Intergenic
1083033502 11:59615522-59615544 CCTGACGCGGCCCCGGAGCCTGG + Exonic
1083173487 11:60936075-60936097 ACGGTGGCGGCCCCGGCGGCAGG - Exonic
1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG + Exonic
1083681546 11:64354037-64354059 GCTGATGCGGCCCCGGCGGGAGG + Exonic
1085127752 11:74013367-74013389 ACTGACGCAGCCTGAGGGGCTGG - Exonic
1088470443 11:110183748-110183770 ACTGAAGGGGCCAGGGCAGCAGG + Intronic
1089178445 11:116564657-116564679 AGGAACGCGGCCCGGGAGGCAGG - Intergenic
1090042394 11:123302256-123302278 ACTGTCACGGCCCGGGCTTCTGG + Intergenic
1091280320 11:134378057-134378079 ACTGACGGGGCGGGGGCTGCTGG - Intronic
1091381792 12:66740-66762 AGTGACGCGGCGCCGGCGGGGGG + Intergenic
1091594348 12:1865694-1865716 CCAGATGCAGCCCGGGCGGCAGG + Intronic
1091712738 12:2753242-2753264 GGTGACGCGGCGCTGGCGGCGGG - Intergenic
1101716959 12:107319889-107319911 ACTGCGGCGGCCGCGGCGGCCGG - Exonic
1104376241 12:128267291-128267313 ACTCCCGCAGCCCGGTCGGCCGG - Intergenic
1105388909 13:19958301-19958323 GCTGCCGCGGCCTGGGCGCCCGG + Intergenic
1110705915 13:78602132-78602154 GCGGCGGCGGCCCGGGCGGCGGG - Exonic
1113799037 13:113077141-113077163 GCAGACGCGGCCCGTGCAGCCGG + Exonic
1114270666 14:21098306-21098328 ACTCACGAGCCCCGGGCGGGCGG + Exonic
1119701981 14:76761800-76761822 GGTGGCGCGGCCCGGGCGGGCGG - Intergenic
1120788092 14:88554958-88554980 ACCGACGCGGGACGCGCGGCCGG + Intergenic
1122387751 14:101360646-101360668 ACTGAGGCGGCCCGTGCTGGGGG + Intergenic
1131060093 15:89399402-89399424 TCAAACGCGGCCCGGGCTGCTGG - Intergenic
1131517517 15:93089048-93089070 GCTGAGCCGGCCGGGGCGGCGGG - Intronic
1131892185 15:96984387-96984409 ACTGCCACGGGCCGGGCGGGCGG + Intergenic
1132398217 15:101489526-101489548 AGGGACGCGGCGCGAGCGGCCGG + Exonic
1132606155 16:794579-794601 ACTCCCGCGGGCAGGGCGGCAGG - Intronic
1132728378 16:1348628-1348650 ACAGACACGGCCAGGGCGGTAGG - Exonic
1132764053 16:1525508-1525530 ACTGTGGGGGCCCGGGAGGCGGG + Intronic
1132889241 16:2196080-2196102 ACGCCCGCGGCCCGGGAGGCGGG + Intronic
1136392356 16:29973760-29973782 ACTGCCGCGGCCTGGGAGACCGG - Exonic
1142683361 17:1562719-1562741 GGCGACGAGGCCCGGGCGGCAGG - Exonic
1143015401 17:3888830-3888852 ACACACGCGGCCGGGGCGCCAGG - Intronic
1144725353 17:17499126-17499148 GCTGACAGGGCCCAGGCGGCGGG - Intergenic
1149491971 17:57091555-57091577 ACTGAGGCAGCCCGGGGAGCTGG + Intronic
1149651496 17:58279066-58279088 ACGAAGGAGGCCCGGGCGGCCGG + Exonic
1150285512 17:63951674-63951696 GCTGACGGGGCCGGGGAGGCTGG - Exonic
1152345509 17:79748403-79748425 ACTCAGGCGCTCCGGGCGGCGGG - Intergenic
1152357326 17:79813497-79813519 ACAGAGGCGGCGGGGGCGGCGGG + Intergenic
1152728971 17:81960773-81960795 ACCGAGGCGGCGCCGGCGGCCGG - Exonic
1152906675 17:82974258-82974280 ACTGAGGCCGCCCGGGTGGCCGG + Intronic
1157529519 18:48409456-48409478 ACAGCCGCGGCGCGGGAGGCGGG - Intronic
1160025063 18:75209650-75209672 CCGAGCGCGGCCCGGGCGGCGGG + Intergenic
1161153566 19:2721378-2721400 ACTGCGGCGGCTCGGGCGGGCGG - Exonic
1161461512 19:4400388-4400410 GCTGGCGCGGTCCGGGCGGGAGG - Exonic
1161980840 19:7629488-7629510 ACTCTCGCGGCCCGAGCGGCCGG - Exonic
1164639238 19:29812313-29812335 ACTGAGGCAGCCCGGGCCCCGGG + Intronic
1164853145 19:31501062-31501084 AGTGCTGCGGCCAGGGCGGCCGG - Intergenic
1166882926 19:45940167-45940189 GCAGCCGCGGCCGGGGCGGCCGG - Exonic
1167050039 19:47072485-47072507 TCTGAGGGGGCCCGGGCGGTGGG + Exonic
1167265421 19:48480672-48480694 ACCGCCGCGGCCCCGGGGGCTGG + Intronic
1167424602 19:49423510-49423532 AGTGACGCAGGCCGGGGGGCCGG + Intergenic
1167613370 19:50517818-50517840 ACGGACACGGCCGAGGCGGCGGG + Exonic
925401363 2:3575550-3575572 CGTTACGCGGCCCGGGCTGCAGG - Intronic
926091911 2:10056682-10056704 ACAGACTCGGGCCGGGCTGCAGG + Intergenic
931515663 2:63049549-63049571 ACTCGCGCTGCCCGGGCTGCGGG - Intergenic
933886146 2:86720533-86720555 GCTGAGGCGGCCGAGGCGGCGGG - Exonic
933924035 2:87076173-87076195 GCTGAGGCGGCCGAGGCGGCGGG + Intergenic
942748750 2:179264747-179264769 GCGGACGCGGCTCGGGCCGCGGG - Exonic
944933698 2:204545746-204545768 GCTGCCGCGTCCCGGGCCGCCGG + Intergenic
1168750743 20:279402-279424 TCTGGCGGGGCCGGGGCGGCGGG - Intronic
1172083181 20:32358545-32358567 ACTGACGCAGCGCGGGCGCGTGG + Exonic
1172367845 20:34363523-34363545 ACTGGCCCGGGCCGGGCGGTGGG + Intronic
1172793610 20:37522702-37522724 GGTGTCGCGGACCGGGCGGCAGG + Exonic
1175198790 20:57264602-57264624 GCTGACGCCGCGGGGGCGGCTGG - Intronic
1175424319 20:58854406-58854428 GCTGAGGCTGCCCCGGCGGCAGG - Exonic
1176283412 20:64328093-64328115 AGTGACGCGGCGCCGGCGGGGGG - Intergenic
1176952595 21:15064715-15064737 ACGGCCGCGGCCAGGGCGCCAGG - Intronic
1178513874 21:33230060-33230082 ACAAAAGCGGCCCGTGCGGCCGG - Exonic
1179775536 21:43659564-43659586 GCAGTCGCGGCCCGGGCGGACGG + Exonic
1180077839 21:45472184-45472206 ACTGGGGCAGCCCGGGCGGGGGG - Intronic
1182524280 22:30906008-30906030 CCTGTCGCGGCGCCGGCGGCTGG + Exonic
1184663421 22:45976001-45976023 CCTGGCGCGGCCCGGCGGGCGGG - Intronic
1184796946 22:46738219-46738241 CCTGCAGTGGCCCGGGCGGCGGG + Exonic
950345460 3:12288236-12288258 ACTGACGGGTCGCGGGCGGGCGG + Intronic
951074361 3:18371081-18371103 ACTGAGGCGGCCGAGGAGGCTGG + Intronic
959566754 3:107840106-107840128 ACTGAATCGGCCCGTGCTGCAGG - Intergenic
960281416 3:115784717-115784739 AGTGACGCTCCCCGGGCTGCAGG - Intergenic
960896818 3:122514603-122514625 ACGGACGCGGCGCGAGCGTCCGG + Intronic
962804188 3:138915531-138915553 ACAGCCGCGCCCCCGGCGGCAGG + Intergenic
964819709 3:160756054-160756076 AGGGAGGCGGCGCGGGCGGCAGG + Intronic
968775381 4:2536820-2536842 GCTGAGGCGGCCGCGGCGGCGGG - Intronic
969413379 4:7043541-7043563 GCTGCGGCGGGCCGGGCGGCGGG + Exonic
970456346 4:16226983-16227005 GCTGGCGCGGCCGCGGCGGCGGG + Intronic
971457866 4:26861035-26861057 TCTGAGGCGGCGGGGGCGGCCGG + Exonic
983557122 4:169068636-169068658 AGTGACGGGGCCTGGCCGGCAGG + Intergenic
985451639 4:190066420-190066442 GCTGCAGGGGCCCGGGCGGCGGG - Intergenic
986220966 5:5768179-5768201 ACTGAGGTGGCCAGGGAGGCAGG + Intergenic
1002512791 5:179733489-179733511 TCTGACGCGGATCGGGCCGCTGG + Intronic
1002600664 5:180352696-180352718 ACTGACGCAGCGGGGGCGACCGG + Intronic
1002897886 6:1389826-1389848 ACGGCTGCAGCCCGGGCGGCGGG + Exonic
1007785382 6:44276618-44276640 ACTGAGGCCGCGCGGGGGGCAGG + Exonic
1013459041 6:110358080-110358102 GCTGGCCCGGCGCGGGCGGCAGG + Exonic
1018682551 6:166275833-166275855 GCGGAAGCGGCGCGGGCGGCGGG - Intergenic
1019480153 7:1262681-1262703 CCTGACGCGGCCCCTGCTGCTGG - Intergenic
1021313352 7:19117833-19117855 AACGACCTGGCCCGGGCGGCCGG + Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1024965370 7:55019083-55019105 CCCGACGCGGCCGAGGCGGCCGG + Exonic
1027211218 7:76150355-76150377 ACTGGCGCAGCCACGGCGGCGGG - Intergenic
1027421185 7:78019589-78019611 GCGGACGCGGCGCGGGCGGGCGG - Exonic
1029276568 7:99408638-99408660 ACTGAAGCGGCGGCGGCGGCTGG - Exonic
1032201592 7:129826048-129826070 ACTGAAGCTGCCCGGGCTCCAGG - Intergenic
1036258560 8:7223180-7223202 ACTGAGGAGGCCGGGGCGGAAGG + Intergenic
1036310615 8:7681776-7681798 ACTGAGGAGGCCGGGGCGGAAGG + Intergenic
1037903831 8:22703774-22703796 CCGCCCGCGGCCCGGGCGGCGGG - Intergenic
1038304042 8:26383294-26383316 ACCGGCGCGGCGCGGGAGGCGGG + Intronic
1038328398 8:26589388-26589410 AGTGAGGCTGCCCAGGCGGCAGG - Intronic
1045047533 8:98293947-98293969 GGGGACGCGGCCAGGGCGGCTGG - Intronic
1049109792 8:140635639-140635661 CCCGACGCGGCCGGGGCGGCGGG + Intergenic
1049762702 8:144338243-144338265 GCTGCCGGGGCCGGGGCGGCTGG - Intergenic
1050132577 9:2427847-2427869 ACTGACGCATCACGGGGGGCGGG - Intergenic
1051513611 9:17906458-17906480 GCTGTCGCTGCCGGGGCGGCTGG + Intergenic
1057432241 9:95004968-95004990 TCAGGCGCGGCGCGGGCGGCGGG - Intronic
1057600153 9:96450521-96450543 ACAGAGCCGGCGCGGGCGGCCGG + Exonic
1061753827 9:132799013-132799035 ACTGACTCCTCCCGGGCTGCAGG + Intronic
1062537772 9:137028375-137028397 CCGGGCGCGGCGCGGGCGGCGGG - Intronic
1062589573 9:137267330-137267352 ACTTACCCAGCCCGGGCAGCAGG - Exonic
1189534509 X:41923170-41923192 ACCGCCCCGGCGCGGGCGGCGGG + Intronic