ID: 900092014

View in Genome Browser
Species Human (GRCh38)
Location 1:924698-924720
Sequence GCTGGCCCTCGAGCGCTTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900092005_900092014 3 Left 900092005 1:924672-924694 CCGCACCTCCACCTGCCCAGGGA No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data
900092006_900092014 -2 Left 900092006 1:924677-924699 CCTCCACCTGCCCAGGGACCCGC No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data
900091997_900092014 29 Left 900091997 1:924646-924668 CCTACCTCAGCCTGCACGAGGCC No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data
900091999_900092014 19 Left 900091999 1:924656-924678 CCTGCACGAGGCCGCCCCGCACC No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data
900092003_900092014 4 Left 900092003 1:924671-924693 CCCGCACCTCCACCTGCCCAGGG No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data
900091998_900092014 25 Left 900091998 1:924650-924672 CCTCAGCCTGCACGAGGCCGCCC No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data
900092001_900092014 5 Left 900092001 1:924670-924692 CCCCGCACCTCCACCTGCCCAGG No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data
900092007_900092014 -5 Left 900092007 1:924680-924702 CCACCTGCCCAGGGACCCGCTGG No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data
900092000_900092014 8 Left 900092000 1:924667-924689 CCGCCCCGCACCTCCACCTGCCC No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data
900092009_900092014 -8 Left 900092009 1:924683-924705 CCTGCCCAGGGACCCGCTGGCCC No data
Right 900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900092014 Original CRISPR GCTGGCCCTCGAGCGCTTCT CGG Intergenic