ID: 900092438

View in Genome Browser
Species Human (GRCh38)
Location 1:926225-926247
Sequence CCTCCCCGGTGGAGACAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900092424_900092438 13 Left 900092424 1:926189-926211 CCTGGACGGGGGAGGAGTCCTCG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG 0: 1
1: 0
2: 0
3: 18
4: 202
900092418_900092438 25 Left 900092418 1:926177-926199 CCAGCCCTTCTACCTGGACGGGG 0: 1
1: 0
2: 3
3: 15
4: 186
Right 900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG 0: 1
1: 0
2: 0
3: 18
4: 202
900092416_900092438 26 Left 900092416 1:926176-926198 CCCAGCCCTTCTACCTGGACGGG 0: 1
1: 0
2: 2
3: 13
4: 134
Right 900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG 0: 1
1: 0
2: 0
3: 18
4: 202
900092423_900092438 20 Left 900092423 1:926182-926204 CCTTCTACCTGGACGGGGGAGGA 0: 1
1: 0
2: 1
3: 9
4: 128
Right 900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG 0: 1
1: 0
2: 0
3: 18
4: 202
900092427_900092438 -5 Left 900092427 1:926207-926229 CCTCGGGCACCCGAGCGCCCTCC 0: 1
1: 0
2: 0
3: 10
4: 201
Right 900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG 0: 1
1: 0
2: 0
3: 18
4: 202
900092421_900092438 21 Left 900092421 1:926181-926203 CCCTTCTACCTGGACGGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 212
Right 900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG 0: 1
1: 0
2: 0
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900092438 Original CRISPR CCTCCCCGGTGGAGACAGGG GGG Intronic
900092373 1:926003-926025 CCTCCCCGGTGGTGAGATGCGGG + Exonic
900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG + Intronic
900115954 1:1027998-1028020 CCTCCCCTGGGGAGAGAAGGGGG - Intronic
900180222 1:1307954-1307976 GCTCCCCGGCGGTGACAGGCGGG - Exonic
900206434 1:1433760-1433782 CCTCCGGGGTGGAGACAGCGGGG + Intergenic
900400176 1:2469782-2469804 CCTCCCGTGTGGGGGCAGGGTGG + Intronic
900601080 1:3502885-3502907 CCTCGCTGGGGGAGGCAGGGAGG - Intronic
901608182 1:10475365-10475387 CCTCCCCGGAGGGGACAGCCGGG - Intronic
902413643 1:16226548-16226570 CCTCTCCGTTGGAGACAGGCAGG + Intergenic
904078382 1:27856761-27856783 CCTCCCCGGGGGGGAGACGGTGG + Intergenic
904866175 1:33580676-33580698 GCTCCTCTGTGGAGACCGGGCGG - Intronic
907272311 1:53298235-53298257 TCTTCCCTGTGGTGACAGGGAGG - Intronic
908131476 1:61080012-61080034 CCTCCCCCGCGGAGGGAGGGGGG - Intronic
909235185 1:73143883-73143905 CTTCCACATTGGAGACAGGGAGG + Intergenic
911063796 1:93769987-93770009 CCTCCCCAGGGAAGACAGAGGGG - Intronic
914753508 1:150550685-150550707 CCTCCCCCGTTCAGTCAGGGTGG + Intronic
915585261 1:156840827-156840849 CCTCCCATGGGGAGACAGGAAGG - Exonic
916029564 1:160863991-160864013 CCTGCCCAGTTCAGACAGGGTGG - Intergenic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
921985339 1:221306162-221306184 CCTCCCAGGCAGGGACAGGGTGG + Intergenic
922762624 1:228142129-228142151 CACCACCGCTGGAGACAGGGCGG - Intronic
1063451655 10:6154189-6154211 CCTCTCAGCTGGAGACAGGAAGG + Intronic
1063883158 10:10551500-10551522 CTTCTCCAGTGGAGACTGGGGGG - Intergenic
1063963821 10:11329112-11329134 CCTTCCCTGTTGAGACAGGCTGG - Intronic
1067948353 10:50706168-50706190 CCTCCCTGTGGGAGACAGGGTGG - Intergenic
1069914158 10:71776907-71776929 CTTCCCAGGTGGAGAAAGGCAGG + Intronic
1070883672 10:79871163-79871185 CCTCCCTGTGGGTGACAGGGTGG - Intergenic
1071423608 10:85526437-85526459 CATCCCAGGTGGGGACAAGGGGG + Intergenic
1071650231 10:87387473-87387495 CCTCCCTGTGGGTGACAGGGTGG - Intergenic
1074274065 10:111984268-111984290 GCTCCCAGTTGGAGACTGGGAGG - Intergenic
1076608395 10:131704164-131704186 CCATCCCGGTGGGGACAGAGTGG - Intergenic
1076822424 10:132946139-132946161 CCTCCCCTGTGGAGGCACAGGGG + Intergenic
1076852884 10:133101699-133101721 GCAGCCTGGTGGAGACAGGGAGG - Intronic
1076915137 10:133419654-133419676 CATCCCTGGAGGAGGCAGGGAGG + Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1081224037 11:40499127-40499149 CCTCCCTGCTGGAGAGAGGATGG + Intronic
1081520085 11:43873178-43873200 CCTCGCTGGAGGAGACATGGTGG + Intergenic
1083815109 11:65128280-65128302 ACTCCCTGGTGCAGACAGAGAGG + Exonic
1085532600 11:77200917-77200939 CCTCCCCACTGAGGACAGGGTGG - Intronic
1085835774 11:79955109-79955131 CCTGCCTGCTGGAGACACGGAGG - Intergenic
1086218310 11:84409844-84409866 CCTTCCCGGTGAAGGGAGGGAGG - Intronic
1087209387 11:95431116-95431138 CATCTCCAGTGCAGACAGGGTGG + Intergenic
1088004824 11:104927358-104927380 TCCCCCCGCTGGAGCCAGGGAGG + Intergenic
1089344488 11:117782053-117782075 CCTTCCTGGTGGAGAGAGAGTGG - Intronic
1097054281 12:56240521-56240543 CCTCCCCCATGAAGACTGGGGGG + Exonic
1098833401 12:75391004-75391026 CCTCCCGGAAGGAGAAAGGGAGG - Intergenic
1103596831 12:122029357-122029379 CAACCCCCGTGGTGACAGGGTGG + Intronic
1104393370 12:128409794-128409816 CCCACCCAGTGGAGAGAGGGTGG + Intronic
1104978229 12:132561561-132561583 CCTCCCAGGTGGGCAGAGGGAGG - Intronic
1106690282 13:32107756-32107778 CCTGCCCTGAGGAGCCAGGGAGG + Intronic
1107691191 13:42955260-42955282 CCTCCAGGGTGGGGACTGGGGGG + Intronic
1108001577 13:45909855-45909877 CCTCCCTGTTGCAGACAGGCTGG - Intergenic
1108336193 13:49444292-49444314 CATCCCCGGTAGAGGCAGGGCGG + Intergenic
1110567163 13:76968132-76968154 TCTCCCCGCTGAAGCCAGGGAGG - Intergenic
1112467905 13:99659997-99660019 CCTTGCCTGTGGAGACAGAGAGG + Intronic
1113432319 13:110261714-110261736 CTGCCCAGGTGGAGACAGTGAGG + Intronic
1119702280 14:76763073-76763095 CCACCCCGATGGAGAGAAGGTGG + Exonic
1122096139 14:99374564-99374586 TCCTCACGGTGGAGACAGGGAGG - Intergenic
1122211763 14:100178282-100178304 CCTCCCAGGTGGGGACAGATGGG - Intergenic
1122887618 14:104717362-104717384 CCTGCCCGGGGGGGACTGGGAGG - Intronic
1124106270 15:26740627-26740649 CCTCAGCTGTGGAGACAGGGAGG - Intronic
1124971707 15:34495510-34495532 CCGCCTCGGTGGAGACAGCAGGG + Intergenic
1128543550 15:68552841-68552863 CCTCCCAGGAGCAGACAGGAAGG + Intergenic
1128768739 15:70266532-70266554 CTGCTGCGGTGGAGACAGGGAGG - Intergenic
1129832830 15:78681841-78681863 CATCCCCGGTGCACCCAGGGAGG - Intronic
1129834912 15:78696262-78696284 CCTCCCCGGGGCAGTCAGGAAGG - Intronic
1130401584 15:83560121-83560143 CCACCCCAGAGGAGAGAGGGAGG + Intronic
1132544332 16:526401-526423 CCCCCTCTGTGGAGACAGGCAGG - Intergenic
1132586101 16:706245-706267 CCGGCCCAGAGGAGACAGGGTGG + Intronic
1133235775 16:4386761-4386783 CCTCCCTGGGTGTGACAGGGTGG + Intronic
1135394082 16:22117664-22117686 CCTCCCTTGTGAACACAGGGTGG - Intronic
1135724771 16:24845971-24845993 CCTCCACGCTGGGGACAGGCAGG - Exonic
1136230379 16:28882434-28882456 CCGCTCCTGAGGAGACAGGGTGG - Exonic
1136591960 16:31223019-31223041 CCTCCCCAGTTGGGACTGGGAGG - Intronic
1137009543 16:35309295-35309317 CGTCCCCGATGGGGAAAGGGTGG + Intergenic
1137585813 16:49663699-49663721 CCTCCCCACGGGAGACAGAGGGG + Intronic
1137669382 16:50270640-50270662 CCTCCCTGGGGGAGCCTGGGTGG + Intronic
1141673781 16:85506892-85506914 CCTCCCCTGTTGAGCCAGGGAGG + Intergenic
1142412080 16:89921980-89922002 CTTCCCTCGTGGAGACAGGGAGG + Intronic
1142509157 17:383899-383921 GGTCCCCGGTGCAGCCAGGGAGG + Intronic
1142509170 17:383940-383962 GGTCCCCGGTGCAGCCAGGGAGG + Intronic
1142603437 17:1068722-1068744 CCTCCCGGGTAGAGAGAAGGAGG + Intronic
1142854214 17:2721082-2721104 CCCCCCTGGTGGAGAGAGGAAGG - Intergenic
1143478366 17:7215654-7215676 TCGCCCTGGTGGAGAGAGGGTGG + Intronic
1143503618 17:7352296-7352318 GCTCCCCGGCGGATACAAGGGGG + Exonic
1144672045 17:17138336-17138358 CCTTCCAGGTGGAGAGAAGGCGG + Intronic
1146275187 17:31511938-31511960 ACTCCCTGCTGGGGACAGGGTGG + Intronic
1146679357 17:34796039-34796061 CCTCCCCGGTCTAGGCAGTGGGG - Intergenic
1147600712 17:41743669-41743691 CCTCCACTGTGGAGAGAAGGGGG - Intergenic
1148203529 17:45765605-45765627 CCAACCTGGTGGGGACAGGGTGG + Intergenic
1148790949 17:50172315-50172337 CCTCCCCGGAGGAAACAATGGGG - Intronic
1151124123 17:71826735-71826757 CCCCACCTGTGGAGAGAGGGAGG - Intergenic
1151499527 17:74480092-74480114 TGTCCCAGGTGGGGACAGGGAGG + Intronic
1151587521 17:75019241-75019263 CCTCCTAGGGGGAGACAGGCAGG + Intronic
1151763583 17:76121353-76121375 CCTCCCCTGTCGAGCCAGGAGGG - Intronic
1152275257 17:79352836-79352858 CATTCCCAGTGCAGACAGGGTGG - Intronic
1152420918 17:80192708-80192730 TCTTCCCTGTGGGGACAGGGTGG - Intronic
1153815274 18:8785435-8785457 CCTCCCCAGCGGCGGCAGGGCGG - Intronic
1158626676 18:59077662-59077684 CCTCCCGGGGAGATACAGGGAGG - Intergenic
1160706534 19:532545-532567 CCTCCCCGGAGGAGACAAAGAGG + Intronic
1160828178 19:1090292-1090314 CCCCGCCTGTGGAGCCAGGGTGG - Intronic
1161320090 19:3637124-3637146 CCTCCCCTGTGCAGCCAGCGGGG + Intronic
1161958299 19:7508189-7508211 CTTGCACTGTGGAGACAGGGTGG - Exonic
1162479934 19:10922106-10922128 CCTTCCCACTGGAGACAGGCAGG - Exonic
1162555530 19:11383635-11383657 CCGGCCCGGTGGAGGGAGGGAGG - Intronic
1163318134 19:16555450-16555472 CCTGCCAGGTGGATACAGGGAGG - Intronic
1163451334 19:17379138-17379160 CCCACCCTGTGGAGTCAGGGTGG + Intergenic
1164178856 19:22802243-22802265 CTTCCCTGTTGGAGTCAGGGAGG - Intergenic
1164574326 19:29396882-29396904 ACTCCCCTGTGCAGACAGGCGGG - Intergenic
1165311791 19:35032887-35032909 CCTCCTCGGTAAAGACGGGGTGG + Intronic
1165937473 19:39398013-39398035 CCTCCCAGCTGGAGACAGTCAGG - Exonic
1166133707 19:40762884-40762906 CATGCCCTGTGGAGAGAGGGAGG - Exonic
1166431065 19:42728595-42728617 CCACCCAGGTGGAGTCAGGCAGG + Intronic
1167004222 19:46765133-46765155 CCTTCCCAGTGGGGACAGGCAGG + Intronic
1168679062 19:58300558-58300580 CCTCTGTGGTGGAGACAGGTGGG + Exonic
926358738 2:12065402-12065424 CCTCCCTGGAGAAGGCAGGGAGG + Intergenic
928114763 2:28538840-28538862 CCTCCCCTGTGGACACTGGTGGG + Intronic
928300878 2:30122590-30122612 CCTCCCTAGTGGGGACAGGGAGG - Intergenic
932073791 2:68644802-68644824 CTGCCCTGGTGGGGACAGGGAGG - Intronic
932466410 2:71927071-71927093 CCTCCTGGGTACAGACAGGGTGG - Intergenic
935103802 2:100020872-100020894 CCTCCCCCGTCAAGCCAGGGTGG + Intronic
937307393 2:120880917-120880939 GCTCCCTGGTGGGGGCAGGGGGG - Intronic
938337418 2:130511884-130511906 GCTCTCTGGTGGAGCCAGGGAGG - Intergenic
938352420 2:130608851-130608873 GCTCTCTGGTGGAGCCAGGGAGG + Intergenic
947593320 2:231396718-231396740 CCTCCCCAGTGGAGACCTGGGGG - Intronic
948061417 2:235045457-235045479 CCTCCCTGGAGCGGACAGGGAGG - Intronic
948464270 2:238144770-238144792 CCTCACTGGTGGGGAAAGGGAGG - Intronic
948907303 2:240986023-240986045 CCTCCCTGATGGGGACATGGTGG + Intronic
1169326213 20:4678950-4678972 CCTCCACGGTGGTGACTGTGGGG - Intergenic
1169808065 20:9579993-9580015 CCTCACAAGTGGAGATAGGGTGG + Intronic
1174767231 20:53265600-53265622 CTTCCCCGAGGGAGCCAGGGAGG - Intronic
1174852509 20:54008373-54008395 CCACCCCAGTGGGGAGAGGGAGG - Intronic
1175905258 20:62376502-62376524 CATTCCTGGTGGAGATAGGGAGG - Intergenic
1176549048 21:8213654-8213676 CCTCCGCGGGGGAGACGGGTCGG + Intergenic
1176556942 21:8257874-8257896 CCTCCGCGGGGGAGACGGGTCGG + Intergenic
1176567980 21:8396692-8396714 CCTCCGCGGGGGAGACGGGTCGG + Intergenic
1176575884 21:8440911-8440933 CCTCCGCGGGGGAGACGGGTCGG + Intergenic
1180073324 21:45449534-45449556 CCCCCACGGTGGGGGCAGGGTGG - Intronic
1180246120 21:46548411-46548433 CTTCCCTAGTGGGGACAGGGAGG - Intronic
1183991623 22:41600807-41600829 CCTCCACACTGGAGAAAGGGAGG - Exonic
1184451332 22:44584428-44584450 CCTCCACGGTTGGGGCAGGGGGG + Intergenic
1185069348 22:48647682-48647704 CCTCCCTGGGGCAGACATGGGGG + Intronic
1185229460 22:49671858-49671880 CAGCCCCGCTGGAGCCAGGGCGG + Intergenic
1203253935 22_KI270733v1_random:129969-129991 CCTCCGCGGGGGAGACGGGTCGG + Intergenic
1203261991 22_KI270733v1_random:175048-175070 CCTCCGCGGGGGAGACGGGTCGG + Intergenic
949187205 3:1206446-1206468 ACACCCTGGTGGTGACAGGGAGG - Intronic
953033228 3:39191299-39191321 CCACCCTGGTGGTGACAGGATGG - Intronic
954412565 3:50377412-50377434 CCTCCCATGTGGACACAGGCAGG - Intronic
954461410 3:50629101-50629123 CCTCCAGGGTGGAGAGAGGGTGG - Intronic
954634830 3:52065730-52065752 CCTCCAAGGTGGGGACAGGATGG + Intergenic
954781266 3:53063091-53063113 CCACCCTGGTGGAGGCGGGGCGG + Intronic
955687890 3:61563399-61563421 CCTCCCCAGGGGAGAGAGGAGGG - Intronic
959268260 3:104171424-104171446 CCTGCCCAGTGGAGAGAGAGAGG + Intergenic
960775114 3:121241591-121241613 CCTCCCCTGTGGTGTCAGTGGGG + Intronic
961678609 3:128583753-128583775 ATTCCAGGGTGGAGACAGGGTGG + Intergenic
962269360 3:133966856-133966878 CATCCCCAAGGGAGACAGGGAGG - Intronic
963956182 3:151256468-151256490 CACTCCCTGTGGAGACAGGGTGG - Intronic
967233927 3:187366809-187366831 ACACCCAGGTGGAGACAGGGAGG - Intergenic
968451753 4:679219-679241 CATCCCAGGGTGAGACAGGGTGG + Intronic
968594077 4:1473405-1473427 CCCGCCCAGAGGAGACAGGGAGG - Intergenic
968609609 4:1551082-1551104 CCTTCCCCCTGGAGACGGGGTGG - Intergenic
968689063 4:1980783-1980805 ACTCGCCGGTTAAGACAGGGTGG + Exonic
968726358 4:2249684-2249706 CCTCTCCTGTGCAGACAGGCAGG + Exonic
968737181 4:2303615-2303637 CCCCCACTCTGGAGACAGGGAGG - Intronic
968811391 4:2801096-2801118 CCTCCGCGGTCAAGACAGGCAGG - Intronic
968870535 4:3239776-3239798 ACTCCCAGGTGAGGACAGGGAGG + Intronic
968971814 4:3799649-3799671 CCTTCCAGGTGCAGACAGTGAGG + Intergenic
968985031 4:3870321-3870343 CCTCCCCATTGGGGAAAGGGAGG + Intergenic
985101353 4:186461545-186461567 CCTTCCCGGTAGAGAGGGGGAGG + Intronic
985536002 5:466073-466095 CATCCCGGGTGGGGACAGTGGGG + Intronic
985702909 5:1384245-1384267 CCTCCGTGGTGGTGACAGGTGGG + Intergenic
986289721 5:6390169-6390191 CATCCCTGGTGTAGACAGCGGGG - Intergenic
986928847 5:12794356-12794378 CCTCCCAGGTGGAGAGGGTGAGG + Intergenic
988238423 5:28575945-28575967 CCTACCCTGTGGAGAAAGGGAGG - Intergenic
995400064 5:111730966-111730988 GCTGCCCAGTGGAGTCAGGGAGG + Exonic
996843271 5:127871826-127871848 CCTACCGGGTGGAAAGAGGGAGG - Intergenic
997345788 5:133191031-133191053 CCTCCCCATTGCATACAGGGTGG + Intergenic
998011237 5:138697102-138697124 CCCCCCCGTAGGAGACAGGGAGG + Intronic
999185026 5:149700859-149700881 CCACACCAGTGGGGACAGGGAGG - Intergenic
1001311351 5:170613107-170613129 TATGCCAGGTGGAGACAGGGTGG - Intronic
1003715159 6:8638186-8638208 CCTGCCAGGTAGAGTCAGGGTGG + Intergenic
1004215063 6:13694733-13694755 ATTCCCAGGTGGGGACAGGGCGG - Intronic
1007170794 6:39861868-39861890 CCTCCTGGGAGGAGACAGGAAGG + Intronic
1007733780 6:43967873-43967895 CTTCCCCGGGGGAGGCAGGCTGG - Intergenic
1008923146 6:56863638-56863660 AATCCCCGGTTGAGAAAGGGAGG - Intronic
1013685416 6:112575642-112575664 CCTCACCTGTGGACCCAGGGAGG - Intergenic
1015872914 6:137795078-137795100 TCTCCCCAGTGGGGGCAGGGAGG - Intergenic
1016586261 6:145690022-145690044 GCTCCCTGGCTGAGACAGGGAGG - Intronic
1018942749 6:168319918-168319940 CCTCCCCGCTGAAGTCACGGAGG - Intergenic
1019315166 7:380792-380814 TCTCCCCGGGAGAGCCAGGGAGG + Intergenic
1019480502 7:1264586-1264608 CCTCCAGGGTGCACACAGGGTGG - Intergenic
1020105873 7:5422096-5422118 CCCCCCGGGGGGAGAAAGGGGGG - Intronic
1022247596 7:28575571-28575593 CCTTCCTGCTGGAGACAGCGGGG + Intronic
1022363479 7:29685452-29685474 CCTTCCTGCTGGAGACAGCGAGG - Intergenic
1022950260 7:35331919-35331941 CTTCCCAGGTGGGGGCAGGGCGG + Intergenic
1023294694 7:38702562-38702584 CTTCCCCGGTGGGGAGAGTGGGG - Intergenic
1028487244 7:91373491-91373513 CCTCCCAGTTGGAGAAAGAGTGG + Intergenic
1034627368 7:152503703-152503725 CCTGCCAGGGGGAGGCAGGGAGG + Intergenic
1035414708 7:158673295-158673317 ACTCAGCAGTGGAGACAGGGTGG + Intronic
1035686078 8:1524315-1524337 CCTCACCGGTGCTGACTGGGAGG + Intronic
1035819034 8:2571865-2571887 CCTCCCCGATGGAGGCGGCGCGG - Intergenic
1036162896 8:6406151-6406173 GCTCCCCGGAGCAGGCAGGGCGG + Intergenic
1038496600 8:28007736-28007758 CCTCCACTTTGGAGATAGGGAGG + Intergenic
1038516040 8:28188460-28188482 CCTCCCCGGAGGAGGGAGGGTGG - Intronic
1040016765 8:42706499-42706521 TGGCCCCGGTGGAGACAGTGGGG + Intronic
1047493262 8:125391051-125391073 CCTCCCTGGAGGAGTGAGGGTGG + Intergenic
1047865226 8:129016376-129016398 CCTCCCTGGTGGGGACCTGGTGG - Intergenic
1049215248 8:141404824-141404846 CCCCCACAGTGGAGACAGGTAGG - Intronic
1049408971 8:142464087-142464109 CCGGCCCGGTGGGGGCAGGGAGG - Exonic
1049512727 8:143037905-143037927 CCTCCTAGGTGGAGTCAGGGTGG - Intergenic
1056574677 9:87846530-87846552 CCTCCCTGTGGGTGACAGGGTGG + Intergenic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1060298136 9:122356818-122356840 CTCCCCTGGTGGAGAAAGGGTGG + Intergenic
1061207872 9:129174928-129174950 CCTCCCCAGTGGATGGAGGGAGG - Intergenic
1062555635 9:137112435-137112457 CCTGCCCCGTGGAGAGCGGGGGG - Intronic
1203776956 EBV:78449-78471 CATCCGCGGTGGATACAGTGGGG + Intergenic
1203470335 Un_GL000220v1:113113-113135 CCTCCGCGGGGGAGACGGGTCGG + Intergenic
1203478156 Un_GL000220v1:157085-157107 CCTCCGCGGGGGAGACGGGTCGG + Intergenic
1191135761 X:57063333-57063355 CTTCCCTGGAGGAGACAGAGAGG + Intergenic
1197403936 X:126027571-126027593 TTTCCCTGGTGGAGCCAGGGAGG - Intergenic
1200218218 X:154378234-154378256 CCTCCCGGGTGGAGCGAGGGAGG + Intergenic