ID: 900093900

View in Genome Browser
Species Human (GRCh38)
Location 1:932630-932652
Sequence CTGCAGAGGCAGAAGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 457}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900093900_900093904 1 Left 900093900 1:932630-932652 CCTGGGTCCTTCTGCCTCTGCAG 0: 1
1: 0
2: 7
3: 50
4: 457
Right 900093904 1:932654-932676 CTCCCACAGAACACACTGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900093900 Original CRISPR CTGCAGAGGCAGAAGGACCC AGG (reversed) Intronic
900093900 1:932630-932652 CTGCAGAGGCAGAAGGACCCAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901491027 1:9596297-9596319 ATGCAGAGCCAGAAAGACCTGGG - Intronic
901756430 1:11444224-11444246 CTGCAGAGCCAGGAGGATGCTGG - Intergenic
902225841 1:14996060-14996082 CTCCAGAGGCAGAAGGGGCTGGG - Intronic
902839959 1:19068319-19068341 CTGCAGATGCTGAAGGTCACTGG + Intergenic
903013641 1:20348077-20348099 CTTTAGAGTCAGAAAGACCCAGG - Intronic
903689732 1:25164250-25164272 CTCCAGGAGCAGAAGGAGCCTGG - Intergenic
903775003 1:25787390-25787412 CTGCAGAGCCTCAAGGCCCCGGG + Intergenic
904208511 1:28870746-28870768 CTGGAAAGGAAGAAGGTCCCGGG + Intergenic
904465338 1:30704376-30704398 TTGGAGAGGCAGCAGGACCGGGG + Intergenic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905893397 1:41530756-41530778 CAGCTGGGGCAGATGGACCCTGG - Intronic
906085480 1:43129695-43129717 CTTCCGAGGCAGAGGGACCCAGG - Intergenic
906656261 1:47550441-47550463 CTGAGGAGGGAGAAGGATCCTGG - Intergenic
906788895 1:48641511-48641533 CTTCAAAGGCAGAAGGACTTGGG + Intronic
907012625 1:50977895-50977917 CTGGAGCGGCAGAAGGGCCGCGG + Intergenic
907454334 1:54565468-54565490 CTCTGGAGTCAGAAGGACCCAGG + Intronic
907841164 1:58158785-58158807 CTGCAGAGCCAGAAAGATGCAGG + Intronic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
910460302 1:87441927-87441949 CTGGAGAGGAAGAAGGATCAAGG + Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
915677727 1:157547264-157547286 CTGCATAGCCTGAAGGACCTGGG + Intronic
915686882 1:157642819-157642841 ATGCATAGGCTGAAGGACCTGGG + Intergenic
918052959 1:180990664-180990686 CTGGAAAGCCTGAAGGACCCTGG - Intronic
919781645 1:201225066-201225088 CTCCTGAGGCAGAAGGACAATGG - Intronic
920398224 1:205661494-205661516 CTGCTGAGGCTGAATGGCCCAGG + Intronic
920440832 1:205979428-205979450 CTGGAGAAGCAAAAGGGCCCGGG - Intronic
920865851 1:209752843-209752865 CTCCAGAGGCTGAGGCACCCGGG + Intergenic
922699079 1:227747686-227747708 CTTCAGAGGCAGAAGAGGCCTGG + Exonic
922702826 1:227771745-227771767 CTGCAGAGGACCCAGGACCCTGG + Intronic
922915687 1:229255692-229255714 CTTCAGAGTCAGAAGAATCCGGG + Intergenic
923073040 1:230583286-230583308 GTGCAGAGCCAGATGGATCCTGG - Intergenic
923191075 1:231621375-231621397 CTGGAAAGCCAGAAGGACCCTGG - Intronic
923394227 1:233544666-233544688 CGGCACAGGGAGAAGGAACCAGG - Intergenic
924818645 1:247465991-247466013 CTGCAGAGGCAGCAACACACGGG - Intergenic
1062964750 10:1598678-1598700 CAGAAGATGCAGAAGGCCCCAGG + Intronic
1063408748 10:5820393-5820415 CTTCAGAGACAGAAGGACTCTGG - Intronic
1065311292 10:24418046-24418068 AGGCTGAGGCAGGAGGACCCGGG - Intronic
1065598862 10:27348004-27348026 TTGCAGATGCAGAACGGCCCAGG + Intergenic
1065858825 10:29853269-29853291 CTGCAAAGGCTGCATGACCCAGG - Intergenic
1066200088 10:33136255-33136277 GTGCAGAGGCGGCAGTACCCAGG + Intergenic
1066369865 10:34811425-34811447 CTGCAGGGGCAGATGGGCTCTGG - Intronic
1067061503 10:43080268-43080290 CTGCAGAGGGGGAAGGTCTCAGG - Intronic
1067755241 10:49000141-49000163 CTGCAGTGGCAGAGGGGCCATGG + Intergenic
1067854122 10:49777054-49777076 CTGCAGTGGCAGAAGCTGCCAGG - Intergenic
1069543664 10:69314117-69314139 CTGCAGAGCCACTAAGACCCTGG + Intronic
1069578113 10:69545014-69545036 CTCCTGAGGCACAAGGACCTGGG + Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1069897421 10:71688324-71688346 CTGCAGTGGCTGAAGGAGACAGG + Intronic
1069906926 10:71737564-71737586 GTGCAGAGTCAGCAGGACCTGGG + Intronic
1070504839 10:77103993-77104015 ATGGAGAGGCAGCAGGACGCAGG + Intronic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1070827977 10:79402127-79402149 CAGAGGAGGCAGAAGGTCCCTGG + Intronic
1070832794 10:79430593-79430615 ATGCTGGGGCAGAAGGTCCCTGG - Intronic
1071052831 10:81472902-81472924 CTGCAGGGGAGGCAGGACCCGGG + Intergenic
1071218548 10:83435545-83435567 GTGCACAGGCAGAATGAACCTGG + Intergenic
1073070522 10:100790601-100790623 CTGCAGAGGAAGAGGCGCCCAGG - Intronic
1073095172 10:100975093-100975115 CTGGGGAGGCAGATGGAACCAGG + Intronic
1073830555 10:107378432-107378454 TTGCTGAGGTAGAAGGCCCCTGG + Intergenic
1075082566 10:119393619-119393641 GTCCAGGGGCAGCAGGACCCTGG + Intronic
1075671793 10:124268063-124268085 CTGCACAGGAGGAAGGAGCCTGG + Intergenic
1075746330 10:124730434-124730456 CTGCTGTGGCAGAGGGAACCTGG - Intronic
1076596409 10:131625335-131625357 CTGCAGAGGCTGAGGCACTCGGG - Intergenic
1077199046 11:1296456-1296478 CTGCAGCGGCCGAAGGGGCCTGG + Intronic
1077417703 11:2432554-2432576 CAGCAGAGGCCCGAGGACCCCGG - Intergenic
1077453155 11:2662950-2662972 CTGCAAAGGCAGGAGGCCCAGGG - Intronic
1077917653 11:6621832-6621854 GTGCTGAGGCTGAGGGACCCTGG + Exonic
1078080591 11:8201925-8201947 CTGCCAAGTCAGAAGGCCCCAGG - Intergenic
1079106738 11:17576845-17576867 CTGCAGAGAGAGACGGGCCCTGG - Intronic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1079325323 11:19486270-19486292 CTTCAGAGGCACAGGGTCCCAGG - Intronic
1080461516 11:32458883-32458905 CTGCAGAGCCATAATGAGCCTGG - Intergenic
1082569981 11:54727116-54727138 ATGGATAGGAAGAAGGACCCAGG - Intergenic
1083266063 11:61547373-61547395 CTGCGGGGGCAGAAGGGACCAGG + Intronic
1083408459 11:62474921-62474943 CTGGTGAGGAAGAGGGACCCAGG + Intronic
1083751982 11:64766004-64766026 CGGCAGAGGCGGCTGGACCCCGG + Intronic
1084446287 11:69205467-69205489 CTGCGCAGGGAGAAGGACCCCGG + Intergenic
1084486774 11:69452852-69452874 GTGGAGAGGTAGAAGGAACCTGG + Intergenic
1084794839 11:71498148-71498170 CATCAGAGGCAGGGGGACCCCGG + Intronic
1084905441 11:72342674-72342696 CTGCAGAGGCCTGAGGACCCTGG - Intronic
1085028982 11:73258323-73258345 CTGCATACCCAGGAGGACCCAGG + Intergenic
1088141621 11:106623745-106623767 CTTCAGAGTCAGATGGACACAGG + Intergenic
1088576207 11:111274107-111274129 GTGCACATGCTGAAGGACCCTGG + Intronic
1088830543 11:113532805-113532827 CTGCAGTGTCAGAAAAACCCGGG - Intergenic
1089011958 11:115138717-115138739 CCGCAGAGGCTGAAGGCACCTGG - Intergenic
1089163118 11:116454835-116454857 CTGCAGAGGTAGAAGTCCCTGGG - Intergenic
1089196645 11:116697324-116697346 CTTCGGAGTCAGACGGACCCAGG - Intergenic
1090234000 11:125133081-125133103 CTGAAGAGGGTGAAGGACTCTGG + Intergenic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1091692677 12:2607627-2607649 CTGCAGAGGAAGTGGGGCCCGGG - Intronic
1091704759 12:2686195-2686217 CTGAAGCGACAGAAGGACCGAGG + Exonic
1091711327 12:2742534-2742556 CTGAAGTGACAGAAGGACCGAGG + Intergenic
1092885497 12:12921183-12921205 CTGCAGACACTGAAGCACCCAGG + Intergenic
1094329555 12:29276035-29276057 CTTCAGAGGCAGACAGACCTGGG + Intronic
1095338438 12:41059330-41059352 ATGCAGAGACAGAACTACCCTGG - Intronic
1096072151 12:48781444-48781466 CAGCAGCGCCTGAAGGACCCTGG + Intronic
1096220446 12:49825720-49825742 CTTCATAGGCAGCAGGGCCCAGG + Intronic
1096414925 12:51404738-51404760 CTTCAGATACAGCAGGACCCAGG - Intronic
1096528695 12:52230078-52230100 GTGGAGAGGAAGCAGGACCCAGG + Intergenic
1096602769 12:52742197-52742219 CTGCAGAGGAGGCAGGAGCCAGG + Intergenic
1096650971 12:53061823-53061845 CTGCTGAAGGACAAGGACCCTGG + Exonic
1097977719 12:65706527-65706549 AGGCTGAGGCAGAAGAACCCAGG - Intergenic
1098317282 12:69206096-69206118 CAGCAGAGGGAGATGAACCCAGG - Intergenic
1098448353 12:70590807-70590829 GCCCAGAGGCAGAAGGGCCCAGG - Intronic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1101838760 12:108312974-108312996 CAGCCTAGGCAGGAGGACCCTGG - Intronic
1102492565 12:113297934-113297956 CTGGGGAGGAAGAAGGGCCCAGG - Exonic
1102558900 12:113748290-113748312 CTGAAGAGGGAGAAGAAACCTGG - Intergenic
1102717780 12:114989114-114989136 CTGCCCAGGCACAAGCACCCAGG + Intergenic
1102900608 12:116633633-116633655 CTGCACTCTCAGAAGGACCCTGG - Intergenic
1103267573 12:119643890-119643912 CTTCAGAGGCAGCTGGATCCTGG + Intergenic
1104502858 12:129302963-129302985 CTCCAAAGGCAGAAGAACCAAGG + Intronic
1104915833 12:132263999-132264021 CTGAAGAGGCTGGAGGCCCCCGG - Intronic
1105241138 13:18610335-18610357 ATGCAGAGGCAGGAGGACAGAGG - Intergenic
1105969124 13:25412218-25412240 CTTCAGAGGCAGAAGTACCAGGG + Intronic
1107669386 13:42728511-42728533 CTGCTGAGGCAAAAGGAGCAAGG - Intergenic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108454370 13:50598194-50598216 CTGCAGGGGCAGAAGGGCAAGGG - Intronic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1112107635 13:96259204-96259226 GTGCACAGGCTGGAGGACCCGGG + Intronic
1113460586 13:110479452-110479474 CAGCAGAGGCAGAATTGCCCAGG + Intronic
1113556830 13:111242716-111242738 GTGCAGTGGCAGGAGGACCTGGG + Intronic
1113794925 13:113051294-113051316 CTTCAGAGACAGAAAGGCCCAGG - Intronic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1116866446 14:50035638-50035660 AGGCTGAGGCAGAAGAACCCGGG - Intergenic
1117187171 14:53251975-53251997 GTCCACAGGCAGAAAGACCCTGG - Intergenic
1117963971 14:61188526-61188548 TCCCAGAGGCAGCAGGACCCCGG - Intronic
1117963999 14:61188656-61188678 TCCCAGAGGCAGCAGGACCCCGG - Intronic
1118536092 14:66766328-66766350 CTGCCAAGGCAGAAGGGCCTTGG + Intronic
1118885993 14:69866237-69866259 CTGGAGAGGAAGAAGGACCCTGG - Intronic
1118904246 14:70011953-70011975 CTGAAGAGGCAGATGACCCCTGG + Intronic
1120646599 14:87081894-87081916 CTGCACAGGGAGAAAGAGCCTGG + Intergenic
1121562864 14:94887489-94887511 CTGTGGAGGGAGAATGACCCAGG + Intergenic
1122034702 14:98938875-98938897 CTGCAGAGTCACAAAGACCGGGG - Intergenic
1122116073 14:99527884-99527906 CTGCAGAGGCGGGAGGACCCCGG + Intronic
1122151746 14:99729584-99729606 CTCCAGAGGCTGAGGAACCCAGG - Intergenic
1122232480 14:100313672-100313694 CTCCAGAGGCAGAAGGCCAGAGG + Intergenic
1122248920 14:100424588-100424610 CTGGACAGGCAGCAGGGCCCTGG - Intronic
1122299938 14:100725752-100725774 CTGCAGAGGAAGAGGGTCTCTGG + Intronic
1122524822 14:102373977-102373999 AGGCTGAGGCAGAAGAACCCAGG + Intronic
1122542547 14:102506244-102506266 CTGCAGTGGCAGCAGGCCCCTGG - Exonic
1123453759 15:20396294-20396316 CTGCATAGGCAGAAATATCCAGG - Intergenic
1123490216 15:20774812-20774834 ATGCAGAGGCAGGAGGACAGAGG + Intergenic
1123546717 15:21343899-21343921 ATGCAGAGGCAGGAGGACAGAGG + Intergenic
1124256413 15:28146328-28146350 CTTCAGGTGCAGAAGGACTCAGG - Exonic
1124567821 15:30832785-30832807 CTCCAGGTGCAGAAGGACTCAGG + Intergenic
1124589397 15:31040125-31040147 CTGCGGATGCGGAAGAACCCCGG - Exonic
1124609845 15:31200952-31200974 CTGCTGGGGAAGAAGGAGCCTGG + Intergenic
1125103789 15:35947163-35947185 TTTTAGAGCCAGAAGGACCCTGG - Intergenic
1125592912 15:40865937-40865959 ATGCAGAGGCAGTAGTGCCCAGG + Intergenic
1125679216 15:41520475-41520497 CTGCAGGGGCAGGAGGACCAGGG + Exonic
1125691850 15:41602065-41602087 TTGCAGAGGCAAAAGAAACCTGG - Intergenic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1127612529 15:60650972-60650994 CATTAGAGGCAAAAGGACCCGGG - Intronic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1128153505 15:65377714-65377736 CAGCAGCGGCAGCAGGAGCCGGG + Exonic
1128885121 15:71279613-71279635 CTGCAGAGGCCCAAGAAGCCAGG - Intronic
1129393396 15:75231775-75231797 CAGCAGAGGCACAGGGACACCGG - Intergenic
1129614177 15:77084735-77084757 CAGATGAGGCAGTAGGACCCTGG + Intergenic
1131578799 15:93619824-93619846 CTGCAAATGCGGAAGGTCCCTGG + Intergenic
1202955048 15_KI270727v1_random:71114-71136 ATGCAGAGGCAGGAGGACAGAGG + Intergenic
1132759701 16:1502661-1502683 CTCCAGATGCAGAAGCACCTTGG - Exonic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1133234336 16:4380885-4380907 CGGCAGCAGCAGAGGGACCCTGG - Exonic
1133398953 16:5470745-5470767 CTGCAGAGGCGGACAGACCAGGG - Intergenic
1133788407 16:8990582-8990604 CCGCAGAGGTAGGAGGACCGAGG - Intergenic
1134063434 16:11212352-11212374 CTGGAGAGGCAGAAGCTCCCAGG + Intergenic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135566746 16:23516962-23516984 GTGGAGAGAGAGAAGGACCCTGG + Intronic
1135956254 16:26958903-26958925 CTGCAGAGTCAGAAGGGTCCGGG + Intergenic
1135985158 16:27178741-27178763 CTGGGGAGGAAGCAGGACCCTGG - Intergenic
1136078860 16:27838563-27838585 CAGCAGGGGCAGAGGGACACAGG + Intronic
1136178880 16:28537603-28537625 CTGCGGAGGAAGGAGGACCCAGG - Exonic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1136873218 16:33827021-33827043 CTGAAGAGAGAGCAGGACCCAGG - Intergenic
1138552155 16:57753922-57753944 CTGCAGAGGAAAGAGGCCCCTGG - Intronic
1138938270 16:61757818-61757840 CTGCAGAGACAAACTGACCCTGG + Intronic
1139224748 16:65223444-65223466 CACCAGAGACAGAAAGACCCCGG + Intergenic
1139348511 16:66320551-66320573 CTGCAGAGCCACAAGGACCACGG + Intergenic
1139369652 16:66458911-66458933 CAGCAGAGGCCCATGGACCCAGG + Intronic
1139517595 16:67460890-67460912 CTTCAGAGCCACAAGGACCTGGG + Intronic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1139839709 16:69868424-69868446 CTGCAGAGGGACAGGGAACCCGG + Intronic
1141953382 16:87353620-87353642 CTTCGGAGGCAGCAGGGCCCCGG + Intronic
1203098954 16_KI270728v1_random:1289034-1289056 CTGAAGAGAGAGCAGGACCCAGG + Intergenic
1142540551 17:655401-655423 CTGCTGAGGCAGAAGCAGCAGGG + Intronic
1142766573 17:2067759-2067781 CTGCAGAGGCTGCAGAACCCTGG - Intronic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143149914 17:4801432-4801454 CTGGAGGGGCAGCAGGACTCAGG + Intergenic
1143377366 17:6474605-6474627 CTGCGGAGGGAGGAGGACGCAGG + Intronic
1144710775 17:17400082-17400104 CTGCAAAGGCTGTAGCACCCAGG + Intergenic
1144863027 17:18317641-18317663 CGCCACAGGCAGAAGGACCAGGG + Exonic
1145213380 17:21033146-21033168 CTGCAGAGGCAGGATTCCCCAGG + Intronic
1145979772 17:29004761-29004783 CTGCAGCGGGAGAAGGACGTGGG + Intronic
1146464033 17:33072157-33072179 CTGCACAGGGAGGGGGACCCAGG - Intronic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1147135501 17:38431785-38431807 CTGCCGAGGCTGAGGGACCTTGG - Intronic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147447656 17:40484579-40484601 CTGCTGAGGAAGGAGGAGCCAGG - Exonic
1147570280 17:41566278-41566300 ATCCTGAGGTAGAAGGACCCTGG + Intronic
1148444386 17:47728641-47728663 CTGCAGAGGCAGAGAGGCCTGGG - Intergenic
1148793644 17:50187104-50187126 CAGCAGAGCCAGGGGGACCCTGG + Exonic
1148799212 17:50212593-50212615 CTGTAGAGTCAGAAGGGCCGAGG + Intergenic
1149557206 17:57582025-57582047 CTGCTCAGTCAGGAGGACCCAGG + Intronic
1149652090 17:58281825-58281847 CTTCACAGGAAGGAGGACCCTGG + Intergenic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151576711 17:74956065-74956087 CTGCAGAGCCAGGACGACCAAGG + Intronic
1151615168 17:75205412-75205434 CGGGAGGGGCAGGAGGACCCCGG - Intergenic
1151883948 17:76912319-76912341 AGGGAGAGGCAGAAGCACCCAGG + Intronic
1152254217 17:79228014-79228036 CTGCAGGGTCAGAAGGACCCAGG + Intronic
1152275557 17:79354654-79354676 CACCAGAGGCAGCAGGAACCTGG - Intronic
1152287272 17:79420486-79420508 CTGTGGAGGGAGAAGGTCCCAGG - Intronic
1152354287 17:79799218-79799240 CGGGACAGGCAGAGGGACCCGGG - Intronic
1152612616 17:81323102-81323124 GTGCAGGGGCTGAAGGAACCCGG - Intronic
1156272648 18:35551217-35551239 CTGGAGAGTCTGAAGGGCCCAGG - Intergenic
1160013827 18:75125915-75125937 CTGCAGAGGGAGGAGGAACAGGG - Intergenic
1160597002 18:79982651-79982673 CTGCAGGGGCTGAAGGACTGAGG + Intronic
1160870888 19:1277345-1277367 CTGGAGACTCAGCAGGACCCTGG + Intronic
1161302225 19:3548201-3548223 CTGCAGGTGCAGCAGGAGCCAGG + Exonic
1161390145 19:4016453-4016475 CTTCAGAGGCTGAAGGGCACAGG - Intronic
1162116143 19:8430652-8430674 CTGCAGTGGCTGAAGGACCCGGG + Exonic
1162524901 19:11201477-11201499 CTCCAGACCCAGGAGGACCCAGG - Intronic
1163953666 19:20614077-20614099 CTGCAGAAGCAGGAGAACTCAGG + Intronic
1164534688 19:29076374-29076396 CTGCTGAGGCAGCAGGGCTCAGG - Intergenic
1164857502 19:31536354-31536376 CTGCAGGTGCAGCAGTACCCAGG + Intergenic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165149074 19:33750468-33750490 ATGCAGAGGCAGAGTGGCCCAGG - Intronic
1166062592 19:40336006-40336028 CAGCAGAGGCAGGCCGACCCAGG - Intronic
1166382389 19:42361866-42361888 CTGCATGGGCAGGAGGACCTGGG + Intronic
1168078294 19:53992186-53992208 CAAGAGAGGCAGTAGGACCCCGG - Intergenic
1168102617 19:54149090-54149112 CTGCAGAGGAATAAGGACTTCGG - Intronic
1168132390 19:54329856-54329878 CTGCAGAGCCAGGAGGACAAGGG - Intergenic
1168249661 19:55134573-55134595 AGGCTGAGGCAGAAGGAACCTGG + Intronic
925084781 2:1099527-1099549 CTGAAGAGGCTGGAGGTCCCAGG + Intronic
925211862 2:2056257-2056279 CTGGAGAGCCTGAGGGACCCAGG - Intronic
925523850 2:4777949-4777971 CTGCAGAGCTAAAAGGACCGAGG - Intergenic
926647989 2:15310738-15310760 GTTTAGAGGCAGAAGGAGCCAGG - Intronic
927997055 2:27494118-27494140 CTGCAGCGGCAGAATGGCCCCGG - Exonic
928284248 2:29975181-29975203 CTCCAGAGGCAGAAGGATGATGG + Intergenic
929074790 2:38071832-38071854 CTACAAAGGCAAAAGCACCCAGG + Intronic
931082713 2:58793324-58793346 CTGCAGAGTCACATGGACCTGGG - Intergenic
934110260 2:88735663-88735685 CTGCAGAGGCTGCCTGACCCAGG + Exonic
936040256 2:109144666-109144688 GTGCAGTGGCATAAGGACTCGGG - Intronic
936151966 2:110026988-110027010 CTCCCAAGGCAGAAGGAGCCTGG + Intergenic
936192712 2:110344425-110344447 CTCCCAAGGCAGAAGGAGCCTGG - Intergenic
937268043 2:120629686-120629708 CAGGAGAGGGAGCAGGACCCAGG - Intergenic
937559888 2:123209382-123209404 CGGCAGAGGCAGATGGACTGTGG - Intergenic
940711723 2:157170088-157170110 CTCCAGAGGCAGAAGCATTCTGG + Intergenic
940848723 2:158668138-158668160 CTGGAGAGGCAGAAGGCCAGTGG - Intronic
942448980 2:176097588-176097610 CAGCGGAGCCAGAGGGACCCAGG - Intergenic
943334767 2:186600238-186600260 AGGCAGAGGTAGAAAGACCCTGG - Intronic
944427937 2:199603389-199603411 CTGCAGGGGCAGAAGGGAGCTGG + Intergenic
945104162 2:206293106-206293128 CTGCAGAGTTAGAAAGACCATGG + Intronic
945395250 2:209307889-209307911 CTGCAGAGCCAGCAGGAGCTGGG - Intergenic
945552552 2:211238136-211238158 CTGCAGAGCCAGAAGCACAGAGG + Intergenic
946576618 2:221082536-221082558 CTGGTGAGGCAGAAAGGCCCTGG - Intergenic
947820026 2:233063098-233063120 CGGCAGAGGCAGACAGTCCCAGG + Intronic
948606620 2:239139797-239139819 CTGCGGAGGCAGAAATACCCTGG + Intronic
1168827321 20:822722-822744 CTGCAGGGGAAGAAGAACCAGGG + Intergenic
1169218674 20:3807985-3808007 CTGCTGAGGAAGCAGGAGCCTGG + Intergenic
1169759438 20:9075407-9075429 CTGCAGAAACAGAAGTACCTAGG - Intronic
1169829637 20:9810090-9810112 CTGCACAGGTGGAAGGAGCCTGG - Intronic
1171053358 20:21882787-21882809 CTGCAGAGGGGCAAGCACCCTGG - Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172767067 20:37356547-37356569 ATGGACAGGCAGAAGGACCCAGG - Intronic
1174384408 20:50178563-50178585 CTCCAGAGGGAGCAGGACCCTGG + Intergenic
1174392485 20:50226556-50226578 GGCCAGTGGCAGAAGGACCCAGG - Intergenic
1174420391 20:50395601-50395623 CTGGAGAAGCAGAACCACCCTGG - Intergenic
1175214891 20:57386920-57386942 CTGCAAAGACAGAAAGACACTGG - Intergenic
1175771162 20:61625205-61625227 CTCCAGAGGCACCCGGACCCAGG + Intronic
1176008577 20:62880058-62880080 CTGCTGAGGCTGAATGCCCCTGG + Exonic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176074664 20:63242969-63242991 CTGCACAGGCTGGAGGACCCGGG - Intronic
1176448387 21:6841099-6841121 ATGCAGAGGCAGGAGGACAGAGG - Intergenic
1176826557 21:13706121-13706143 ATGCAGAGGCAGGAGGACAGAGG - Intergenic
1179053102 21:37906280-37906302 CTGCAGAGGCAGATTTAACCTGG - Intronic
1179974882 21:44859063-44859085 CAGCAGCACCAGAAGGACCCAGG + Intronic
1180005071 21:45016882-45016904 CAGCAGAGACAGGATGACCCAGG + Intergenic
1180099126 21:45576171-45576193 CTGCAGATGCAGGAGGACCCTGG + Intergenic
1180197897 21:46208393-46208415 CTGGAGAGGCAGAACGTGCCTGG + Intronic
1180694581 22:17743693-17743715 CTGCAGAGGCAGAGTGATCCCGG + Intronic
1180757236 22:18170505-18170527 CTGCACAGGTACCAGGACCCAGG - Intronic
1180867579 22:19128221-19128243 TTGCAGAGGCAGAACTGCCCGGG - Intergenic
1180962941 22:19770504-19770526 GTGCAGAGGCAGGAGCACGCGGG + Intronic
1181074542 22:20366960-20366982 CTGCACAGGTACCAGGACCCAGG + Intronic
1181118639 22:20650397-20650419 CTGCAGAGACAGGAGGACTCAGG + Intergenic
1181479605 22:23190089-23190111 GTGCAGAGGCAGCAAGACCATGG - Intronic
1181732781 22:24859693-24859715 CTGCAGAGAGAGGAGGACTCAGG - Intronic
1181937307 22:26448175-26448197 CAGCACAGGGAGAAGGACCTGGG - Intronic
1182049233 22:27300337-27300359 CTGCAGGGGCAGCAGAAACCAGG + Intergenic
1182147500 22:28005689-28005711 CTGCAGAGGCAGGAGGCCTTGGG - Intronic
1182498428 22:30727602-30727624 CAGCAGAGGCAGCAGTGCCCAGG - Intronic
1182676821 22:32045536-32045558 CTGCACAGGCAGAATGGTCCAGG + Intronic
1183079893 22:35449609-35449631 CAGCAGGGGCAGAAAGACCACGG - Intergenic
1183130315 22:35828355-35828377 CAGCAGAGAAGGAAGGACCCAGG + Intronic
1183457219 22:37929438-37929460 CTCAACAGGCAGAAGGACCCAGG + Intronic
1183457684 22:37931680-37931702 CTCCAGGGCCAGCAGGACCCAGG - Intronic
1184372980 22:44094447-44094469 AGGCAGAGGCAGAAGGAGCAGGG + Intronic
1184752605 22:46496751-46496773 CTTCAGAGGCAGCAGCACACAGG + Intronic
1184948421 22:47821163-47821185 CTGCAGAGGCAGGGAGAACCAGG + Intergenic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1185318864 22:50191043-50191065 CTGCAGAGGCTCAAGGCCCCCGG + Intronic
1185419395 22:50727091-50727113 GTGCAGTGGCAGAAGGCCCGAGG + Intergenic
953282913 3:41575935-41575957 CTGCTCAGACAGGAGGACCCTGG + Intronic
953420920 3:42752544-42752566 CTCCAGAGGGAGAATGACCAAGG + Intronic
953532694 3:43752658-43752680 CAGCAAAGGCAGAAAGCCCCTGG + Intergenic
953735546 3:45491351-45491373 CTACAAAGGCAGAAGCACCTAGG + Intronic
953838632 3:46369844-46369866 CTACAGAGGCAGACTAACCCAGG - Intergenic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
953967811 3:47323562-47323584 CTGCTCAGGCAGAAGGTCACAGG - Intronic
955436093 3:58900153-58900175 CTGTGAAGGCAGAAGGACTCTGG + Intronic
955527557 3:59836869-59836891 CTGCAAAGGCAGAATGGCCCAGG + Intronic
956278925 3:67535679-67535701 CTGCTGAGCCATATGGACCCAGG - Intronic
956850916 3:73227707-73227729 CTGCAGAGACATAATGCCCCAGG - Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957156364 3:76550506-76550528 CTGCAGGGCCAGGAGGGCCCAGG + Intronic
961126297 3:124421154-124421176 CTGCAGAGCCAGGTGGACTCAGG + Intronic
961625936 3:128263855-128263877 CCGCAGAGAAGGAAGGACCCTGG + Intronic
961633961 3:128321408-128321430 GTGGAGAGGGGGAAGGACCCAGG + Intronic
961823467 3:129586884-129586906 CAGCAGAGGCAGAAGCATCAAGG - Intronic
961863233 3:129934655-129934677 CTGCAGAGCCAGAAATAACCAGG - Intergenic
962912569 3:139866858-139866880 ATGCAGACACAGGAGGACCCAGG + Intergenic
962930537 3:140031862-140031884 GTGCAGTGGCTGAAGGACACTGG - Intronic
963437894 3:145294939-145294961 CAGCAGAGGCAGAAGGCACTAGG + Intergenic
964292490 3:155196758-155196780 GCTCAGAGGCAGAAGGTCCCTGG - Intergenic
965349603 3:167597142-167597164 GCACAGAGGCAGCAGGACCCTGG - Intronic
965673811 3:171174026-171174048 CTGCAGAGGAAGGAGGAGCAGGG + Intronic
966817143 3:183898562-183898584 CTGGCGTGGCAGAAGGACCCAGG - Intergenic
966934366 3:184696100-184696122 CTGAGGAGGCTGAAGGGCCCTGG + Intergenic
967128131 3:186445031-186445053 CTGCACAGGATGAAGGAGCCAGG - Intergenic
967550364 3:190787143-190787165 CTGCAGTGACAGAAAGTCCCAGG + Intergenic
968578988 4:1380967-1380989 CTGCAGAAGCAGGAGCGCCCGGG + Exonic
968967301 4:3775608-3775630 GTGCAGAGCCATGAGGACCCTGG + Intergenic
969281936 4:6176670-6176692 CTGAACATGCAAAAGGACCCAGG + Intronic
969330553 4:6471698-6471720 CTGGAGAAGAAGAGGGACCCGGG - Intronic
970560506 4:17277288-17277310 CTTCAAAGGAAGAAGGACCTAGG + Intergenic
971255357 4:25009100-25009122 GTGCAGAGGCAGGAGGATGCAGG - Intronic
972253067 4:37325588-37325610 TCGAAGAGGCAGAAGGACACTGG - Intronic
972299263 4:37769663-37769685 CTGTAGAGGCAAAAATACCCAGG - Intergenic
972703366 4:41515725-41515747 CTCCAGAGACAGAAAGACCTGGG - Intronic
972918690 4:43910460-43910482 CTGAAGTGGCAGATGGTCCCAGG + Intergenic
976776349 4:88710431-88710453 TAGCAGAGCCAGGAGGACCCTGG - Intergenic
980097823 4:128511586-128511608 ATGCAGAGGTAGAGGGGCCCTGG + Intergenic
981079664 4:140626522-140626544 CTTAAGAGGCAAAAGAACCCAGG + Intronic
981251844 4:142612212-142612234 CTTCAGAGGCAGAAGCAGCAGGG - Intronic
982504288 4:156197973-156197995 CTAAAGAGGCATAATGACCCAGG - Intergenic
982772305 4:159407969-159407991 CTGCAGACGCAGAAGACCCATGG - Intergenic
984822791 4:183897334-183897356 CTACAAAGCCAGAAGCACCCAGG - Intronic
984919120 4:184748448-184748470 GTGCAGACACAGAAGGACTCTGG - Intergenic
984935121 4:184883109-184883131 CTGCAGAGGCAGAAGTCCAGTGG + Intergenic
987070653 5:14334243-14334265 CTCCAGTTGCAGAAGGACCCAGG + Intronic
987087367 5:14483390-14483412 CTGCAGAGCCAGGAGGACCCTGG - Intronic
987292879 5:16524933-16524955 CTGCAGGGGCTGGAGGACGCAGG - Intronic
987379988 5:17275813-17275835 CTGCAGAGGCTGCGGGGCCCTGG - Exonic
988728276 5:33944856-33944878 TTGCAGAGGCAGCAGGCCCCAGG - Exonic
990754834 5:59057012-59057034 CTGCAAAGACAGCAGGATCCTGG - Intronic
991970170 5:72133226-72133248 AGGCAGAGGCAGGAGGATCCTGG - Intronic
992326906 5:75668825-75668847 CAGCAGTGGCAGCAGCACCCGGG + Intronic
992342816 5:75843781-75843803 AAGAAGAGGAAGAAGGACCCTGG + Intergenic
993251581 5:85531444-85531466 AGGCAGAGGCAGATGGACCCAGG - Intergenic
994151059 5:96448036-96448058 CTGCACAGCCAGAATGGCCCTGG - Intergenic
995723881 5:115165659-115165681 CTGCAGAGCCAGCGGGACCCAGG + Intronic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
996367544 5:122719221-122719243 AGGCTGAGGCAGAAGAACCCAGG - Intergenic
997042918 5:130278460-130278482 CTGCAGAGCCAGCAGGAGCCAGG - Intergenic
997191563 5:131941514-131941536 CTGCAGAGGTAAAAGTAGCCTGG - Intronic
998821254 5:146059938-146059960 CTGCTGAGGCCGAAGGACCATGG - Exonic
998929346 5:147163446-147163468 CTCCAGAGGCAAAAGGCACCTGG + Intergenic
999019985 5:148154494-148154516 CTGCAGTGGCAGAAGGGATCAGG - Intergenic
999269496 5:150288608-150288630 CTGCTGAGGCAGCAGGAGCACGG - Intronic
999505141 5:152186676-152186698 CTGCAGAGGAAGAAGGAAGTTGG - Intergenic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1000054775 5:157595621-157595643 CTGCAGAGGCAAAAGCATTCAGG + Intergenic
1000096767 5:157978196-157978218 CAGCTGTGGAAGAAGGACCCAGG - Intergenic
1000862782 5:166476549-166476571 AGGCTGAGGCAGAAGGATCCTGG - Intergenic
1000981018 5:167816804-167816826 CAGCAAAGTCAGAATGACCCGGG + Intronic
1001705044 5:173735460-173735482 CTGCAGAGGCAGAAGAGCCAGGG - Intergenic
1001842219 5:174887652-174887674 AAGCAGAGGCAGCAGGAGCCAGG - Intergenic
1001960143 5:175875100-175875122 CTGCAGAGGCAGCAGAGCTCTGG + Intronic
1001962109 5:175885803-175885825 GTCCTGAAGCAGAAGGACCCTGG - Intergenic
1001993060 5:176133517-176133539 CTGCAGAGGTACGGGGACCCAGG - Intergenic
1002206994 5:177569630-177569652 CTGCAGAGGAAAAAGTAACCAGG - Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004233243 6:13851487-13851509 CTGAGGAGGCAGAAGGACAAAGG - Intergenic
1004554284 6:16680517-16680539 CTTCAAGGGAAGAAGGACCCAGG + Intronic
1004560206 6:16742500-16742522 CTGCAGCGGTCAAAGGACCCAGG + Intronic
1005340488 6:24839273-24839295 CTGTAAAGGCAGAAGGCACCAGG + Intronic
1005364234 6:25061331-25061353 GTGGAGAGCCAGAAGGACCTGGG + Intergenic
1005568778 6:27124377-27124399 CTTCAGAGGCTGAAGGAACATGG - Intergenic
1005812517 6:29528384-29528406 CTGGAAAGGCAGAAGTCCCCTGG - Intergenic
1005836066 6:29710565-29710587 CTGCAGGGCCAAAAGGAACCAGG + Intergenic
1006034546 6:31201334-31201356 GTGCAGAGCCAGAAGCAGCCAGG - Intronic
1006559616 6:34899146-34899168 CTTCCCAGTCAGAAGGACCCAGG - Intronic
1007124212 6:39411280-39411302 CTGGAGAGCCAAGAGGACCCAGG - Intronic
1007728954 6:43934133-43934155 CAGCAGAGGCACAAGGAACTGGG - Intergenic
1009307104 6:62103671-62103693 CTGCAGAGCCACAGGGAGCCAGG - Intronic
1009643222 6:66363322-66363344 CTGCAGAGTCATAAGGAGCTGGG - Intergenic
1010579325 6:77574737-77574759 GTGAAGAGGCAGAAAGACACAGG + Intergenic
1010815785 6:80356882-80356904 AGGCAGAGGCAGAAGGAGTCGGG - Intergenic
1011723294 6:90181887-90181909 CTGCAGAGTCAGAGAGACCTAGG - Intronic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1013891435 6:115032663-115032685 CTGCTGAGGGTGAAGGACCAAGG - Intergenic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015492643 6:133843963-133843985 CTGCTGAGGCAGAAGTAACTGGG - Intergenic
1015502893 6:133952283-133952305 CTGCAGGGGCCGGGGGACCCCGG - Intronic
1016034875 6:139374802-139374824 CTGCAGAGGCTGCGGGGCCCGGG + Intergenic
1016971948 6:149772226-149772248 CTTCAGAGGCAGAAAGAAGCAGG + Intronic
1017746880 6:157455196-157455218 CTGCATGGGCAGGAGGACCCAGG + Intronic
1018198471 6:161375198-161375220 CTGCAGAGGGAGGACGCCCCTGG + Intronic
1018836430 6:167487724-167487746 CAGCAGGGGAAGAAGGAGCCTGG - Intergenic
1018986398 6:168640403-168640425 CTGCAGACGCTGAGGGGCCCAGG + Intronic
1019151129 6:170006679-170006701 CTGCTGAGGCTGAGGAACCCTGG + Intergenic
1019460288 7:1154555-1154577 CTCCAGAGGCTGAGGGTCCCAGG + Intronic
1019597317 7:1864152-1864174 TTGCAGAGGAACAAAGACCCCGG + Intronic
1019706450 7:2499327-2499349 CTGCTGGGGCAGAGGGTCCCAGG + Intergenic
1019911300 7:4101973-4101995 CTTCAGAGGCAGAAGGGCTGTGG - Intronic
1020985020 7:15122345-15122367 CTGCAGATACAGAAGTACACAGG - Intergenic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1021866522 7:24963555-24963577 CTGCCTATGCACAAGGACCCTGG + Intronic
1023634747 7:42198368-42198390 CTGGAGAGTGAGAAGGATCCAGG + Intronic
1023759391 7:43449811-43449833 TTGCAGAGTGAGAAGGGCCCGGG - Intronic
1023792433 7:43763465-43763487 CTGCAGAGGCAGAAAGACATTGG - Intronic
1025250584 7:57348889-57348911 CTGGAGAAGCAGAACCACCCTGG + Intergenic
1026902057 7:74042922-74042944 GTGGGGAGGCAGAAGGGCCCGGG - Intronic
1026921961 7:74162345-74162367 CTGCAGAGACAGAGGGGCACTGG + Intergenic
1028209188 7:88052405-88052427 AGGCAGAGGCAGGAGAACCCGGG + Intronic
1029020464 7:97359602-97359624 ATCCAGAGACAGAAGGAACCTGG + Intergenic
1029366576 7:100120198-100120220 CTGCAGAGGCTGCAGGAGCCGGG + Intronic
1029598441 7:101549938-101549960 CTGCAGAGGCAGGGCGAACCTGG - Intronic
1031972355 7:128073976-128073998 CAGGAGAGGCAGAAAGACGCGGG - Intronic
1031993056 7:128210348-128210370 CTCCAGAGGGAGAGGGACTCAGG + Intergenic
1032036504 7:128525324-128525346 CAGGAGAGGCAGGTGGACCCGGG + Intergenic
1032453289 7:132052947-132052969 CTGCAGAGCCATATGGACCTTGG - Intergenic
1032737183 7:134703218-134703240 CTACAGAGGAAGAAGAACACGGG + Intergenic
1032952039 7:136925671-136925693 CTGCAGAGACAGGAGGTGCCAGG - Intronic
1034709338 7:153177059-153177081 CTGCAGAGGGAGAAGGTTTCTGG - Intergenic
1035239376 7:157520012-157520034 CTCTGGAGGCAGAAGGCCCCAGG - Intergenic
1035319234 7:158017757-158017779 CAGCAGGGACAGAAGGACGCAGG + Intronic
1036476755 8:9100401-9100423 CTGCAGGGTCAGAAAGACCTAGG - Intronic
1036693000 8:10956482-10956504 CTGGAGAGGATGAAGGGCCCAGG + Intronic
1036812190 8:11874802-11874824 CTGCAGATGAGGAAGGCCCCAGG - Intergenic
1037821997 8:22139567-22139589 CTGCAGAGGAAGAGGGACTCTGG - Intronic
1037832636 8:22198486-22198508 CTCCAGAGGTAACAGGACCCAGG + Intronic
1037878517 8:22561312-22561334 CTGCAGGAGCAGAAGGGACCAGG - Intronic
1039346157 8:36707941-36707963 AGGCAGAGGCAGGAGGATCCGGG - Intergenic
1039900250 8:41746719-41746741 CTGCAGAGGCTGATGGGCCCTGG + Intronic
1040073101 8:43204455-43204477 TTGCACAGGCAGGAGGGCCCTGG + Intergenic
1040899604 8:52404378-52404400 CTGCTGAGACAGAAGGAGTCGGG + Intronic
1040900631 8:52414062-52414084 CGGCGGAGGCAGCAGGGCCCGGG - Intronic
1041099501 8:54381912-54381934 CCGCAGAGGCAGCAGGGCACAGG + Intergenic
1041753924 8:61292055-61292077 CAGCAGTGGCAGCAGAACCCAGG - Intronic
1043349686 8:79345209-79345231 CTCCAAAGGAAGAAGTACCCAGG - Intergenic
1043380293 8:79695290-79695312 ATGAAGAGGCAGAAGGACTCAGG + Intergenic
1043695076 8:83207894-83207916 CTGTGGAGTCAGAAGGAGCCAGG + Intergenic
1043851473 8:85220976-85220998 CTGCAAAGGCACAAGAAACCAGG + Intronic
1045406175 8:101868797-101868819 ATGCAGTGGCTCAAGGACCCTGG - Intronic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1046108210 8:109691549-109691571 CTGCAGAGGCCGAGGGGCCGAGG - Exonic
1046600825 8:116315252-116315274 CTGCAGAGGCAGAAGCCTCATGG - Intergenic
1046659912 8:116938250-116938272 CTGCAGCGGCGGAAGTCCCCGGG - Exonic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1047333221 8:123911560-123911582 ATGCAGAGCCAGAAAGACCTAGG - Intronic
1049229846 8:141476278-141476300 CTGCAGAGGCAGGTGGGCCAGGG - Intergenic
1049237375 8:141518942-141518964 CTTCAGAGGGAGGAGGACCCGGG + Intergenic
1049285620 8:141773619-141773641 CTTCAGAGCCAGAAGGCCCTGGG + Intergenic
1049538325 8:143193429-143193451 CTGTGGAGGCAGAAGGACCTGGG + Intergenic
1049591040 8:143462724-143462746 CTGCAGATGCAGGAGGGCCAAGG + Intronic
1049642364 8:143721450-143721472 CAGCACAGGCAGAAGGGGCCCGG - Intronic
1052999918 9:34572186-34572208 CTGCAGATCCAGAAAGCCCCAGG + Intronic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1053469742 9:38337852-38337874 CTGCAGATCCTGAAGGTCCCAGG + Intergenic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1056562368 9:87742809-87742831 CTGCAAAGGCAGTAGTCCCCAGG - Intergenic
1056946797 9:91004610-91004632 CTGCAGAGGAATAATGACACTGG - Intergenic
1058813810 9:108665800-108665822 CTGGAGATGCAGAAAGCCCCAGG + Intergenic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059062752 9:111050821-111050843 CTGGGGAGACAGAAAGACCCTGG + Intergenic
1059382374 9:113936192-113936214 CTCCAGAGGCAGACAGACCTGGG + Intronic
1059424433 9:114211863-114211885 GGGCAGTGGCAGAGGGACCCTGG - Intronic
1060584882 9:124779747-124779769 CTGCAGAGCCAGCAGGAGTCTGG - Intronic
1060586650 9:124790730-124790752 CGGCAGAGGCAGTAGGAGACAGG + Intronic
1060885426 9:127148905-127148927 CTGCAGAGAAACGAGGACCCAGG - Intronic
1061211228 9:129194579-129194601 CTTTGGAGGCAGAAGGACCCAGG + Intergenic
1061425633 9:130496686-130496708 CTGGAGGGGCAGGAGGGCCCTGG + Intronic
1062081310 9:134625185-134625207 CTGCAGAGTCAGGAGGGCCTGGG - Intergenic
1062235094 9:135504059-135504081 CTGCAGGGCCAGAAGGAGCCCGG + Exonic
1062540271 9:137038942-137038964 ATGCAGAGCCAGGTGGACCCAGG - Intergenic
1203520804 Un_GL000213v1:43419-43441 ATGCAGAGGCAGGAGGACAGAGG + Intergenic
1186421428 X:9430065-9430087 CTGCAGAAGCAAAAGCACACCGG + Intergenic
1186430199 X:9498653-9498675 CTGCAGAGACCGCAGGAGCCTGG + Intronic
1187042668 X:15613353-15613375 CTGGAAAGGTAGAAGGACCCGGG + Intergenic
1188184401 X:27095988-27096010 AGGCTGAGGCAGGAGGACCCGGG - Intergenic
1189286338 X:39854671-39854693 CCTCAGAGCCAGAAGTACCCAGG + Intergenic
1189294867 X:39910939-39910961 CTGCAGAGGCCGCAGGGCCCAGG + Intergenic
1190681574 X:52830930-52830952 CTGTGGAGGCAGCAGGAGCCAGG + Intergenic
1192179898 X:68909905-68909927 CAGCTGAGGCAGATAGACCCAGG - Intergenic
1193329088 X:80215708-80215730 TTTCCTAGGCAGAAGGACCCTGG - Intergenic
1194607609 X:96000705-96000727 CTTCAGAGGCAAAAGGAACCTGG - Intergenic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1196117031 X:112009162-112009184 CTGCAGTGGCAGAGGATCCCAGG - Intronic
1196263045 X:113608304-113608326 ATGCAGAGCCAGAAGTACCTGGG + Intergenic
1196572254 X:117280011-117280033 CTGCAAAGGGTGAAGGACCAAGG - Intergenic
1196828371 X:119758384-119758406 CTGCAGAGGCGGCGGTACCCAGG + Intergenic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic
1198312979 X:135438258-135438280 CTGCAGCTGGAGAAGGACCCTGG + Intergenic
1199155017 X:144536784-144536806 CTGCAGAGGCAGAGGCCCCATGG - Intergenic
1199786662 X:151112256-151112278 CTGCAGTGGGAGAAGGATGCGGG + Intergenic
1200140822 X:153902154-153902176 CTGCAGAGATGGAAGGACCTGGG - Intronic