ID: 900094913

View in Genome Browser
Species Human (GRCh38)
Location 1:936387-936409
Sequence AGCCCTAGGAGGCGGGACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 4, 1: 0, 2: 13, 3: 26, 4: 132}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900094913_900094934 24 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094934 1:936434-936456 GGTCCCGCCTTCTAGGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 112
900094913_900094925 -8 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094925 1:936402-936424 CTAGGGCTCCTGGACGGAGGGGG 0: 2
1: 3
2: 1
3: 12
4: 171
900094913_900094933 18 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094913_900094928 3 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094928 1:936413-936435 GGACGGAGGGGGTCCCCGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 143
900094913_900094938 29 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094938 1:936439-936461 CGCCTTCTAGGGCTCCGGGAAGG 0: 1
1: 0
2: 6
3: 12
4: 107
900094913_900094924 -9 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094924 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 2
3: 15
4: 181
900094913_900094935 25 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094935 1:936435-936457 GTCCCGCCTTCTAGGGCTCCGGG 0: 1
1: 5
2: 1
3: 10
4: 108
900094913_900094931 17 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094931 1:936427-936449 CCCGGTCGGTCCCGCCTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 57
900094913_900094926 -1 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094926 1:936409-936431 TCCTGGACGGAGGGGGTCCCCGG 0: 2
1: 3
2: 1
3: 23
4: 380
900094913_900094922 -10 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094922 1:936400-936422 TCCTAGGGCTCCTGGACGGAGGG 0: 5
1: 0
2: 1
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900094913 Original CRISPR AGCCCTAGGAGGCGGGACCG GGG (reversed) Intronic
900094864 1:936270-936292 AGCCCTAGGAGGCGGGACCGGGG - Intronic
900094881 1:936309-936331 AGCCCTAGGAGGCGGGACCGGGG - Intronic
900094897 1:936348-936370 AGCCCTAGGAGGCGGGACCGGGG - Intronic
900094913 1:936387-936409 AGCCCTAGGAGGCGGGACCGGGG - Intronic
900114772 1:1023832-1023854 AGCGCTGGGAGGAGGGTCCGTGG + Intronic
900167070 1:1248097-1248119 AGCCCTGGGAGGCTGGACTGAGG + Intergenic
900167087 1:1248163-1248185 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167109 1:1248229-1248251 AGCCCTGGGAGGCTAGACCGAGG + Intergenic
900167130 1:1248294-1248316 AGCCCTGGGAGGCTGTACCGAGG + Intergenic
900167153 1:1248360-1248382 AGCCCTGGGAGGCTGGACCAAGG + Intergenic
900167171 1:1248426-1248448 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167192 1:1248492-1248514 AGCCCTGGGAGGCTAGACCGAGG + Intergenic
900167213 1:1248558-1248580 AGCCCTGGGAGGCTGGACCAAGG + Intergenic
900167231 1:1248624-1248646 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167253 1:1248690-1248712 AGCCCTGGGAGGCTGGAGCAAGG + Intergenic
900167275 1:1248756-1248778 AGCCCTGGGAGGCTAGACCGAGG + Intergenic
900167296 1:1248822-1248844 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167315 1:1248888-1248910 AGCCCTGGGAGGCTGGAGCGAGG + Intergenic
900167338 1:1248954-1248976 AGCCCTGGGAGGCTGGAGCGAGG + Intergenic
900167361 1:1249020-1249042 AGCCCTGGGAGGCTGGAGCGAGG + Intergenic
900167384 1:1249086-1249108 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167408 1:1249152-1249174 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167432 1:1249218-1249240 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167456 1:1249284-1249306 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167480 1:1249350-1249372 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167504 1:1249416-1249438 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167528 1:1249482-1249504 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167552 1:1249548-1249570 AGCCCTGGGAGGCTGGACCGAGG + Intergenic
900167575 1:1249614-1249636 AGCCCTGGGAGGCTAGACCGAGG + Intergenic
900420539 1:2554202-2554224 AGCCCAAGGAGGCGGGAGACGGG - Intergenic
900423625 1:2566482-2566504 AGCCCAAGGAGGCGGGAGACGGG + Intergenic
900462554 1:2808630-2808652 AGCCATAGGAGGTGGCCCCGAGG - Intergenic
901182182 1:7349448-7349470 AGCCCTAGGCAGCTGGACAGAGG - Intronic
902304313 1:15524951-15524973 AGCCCTTGGGGGCGGGGCGGTGG - Intronic
902410059 1:16207131-16207153 AGCGCGAGGAGGAGGGCCCGGGG - Exonic
902612967 1:17607970-17607992 AGCCCAAGGTGAGGGGACCGGGG + Exonic
905775182 1:40663756-40663778 TGCCCTGGGAGAAGGGACCGTGG + Intronic
906190181 1:43893806-43893828 AGTCCTAGGAGGCAGGGCCGAGG - Intronic
907861814 1:58361196-58361218 GGCCCTAGGAGGCCAGACCCAGG - Intronic
913203868 1:116517666-116517688 AGGCAGAGGAGGCGGGACTGGGG - Intronic
913565640 1:120069725-120069747 TGCCCAAGGCGGCGGGGCCGAGG - Intergenic
913632489 1:120723828-120723850 TGCCCAAGGCGGCGGGGCCGAGG + Intergenic
914286236 1:146229099-146229121 TGCCCAAGGCGGCGGGGCCGAGG - Intergenic
914547264 1:148679841-148679863 TGCCCAAGGCGGCGGGGCCGAGG - Intergenic
914619239 1:149390502-149390524 TGCCCAAGGCGGCGGGGCCGAGG + Intergenic
914796413 1:150923996-150924018 AGGCCCAGGAGGCGGAACCCGGG + Intergenic
921157081 1:212447055-212447077 AGCGCTAGGAGGTGGGGCCCAGG - Intergenic
921974051 1:221181954-221181976 AGCCCTAGATGGCTGGACTGTGG - Intergenic
922506291 1:226127908-226127930 AGACTTAGGAGGAGGTACCGGGG - Intergenic
1062920437 10:1274975-1274997 GGCCCTTGGAGGGGGGCCCGTGG + Intronic
1065214741 10:23439054-23439076 AGGCCCGGGAGGCGGGGCCGCGG - Intergenic
1067473329 10:46551113-46551135 AGCCCTAGGGGGTGGGGCTGTGG + Intronic
1069567797 10:69475030-69475052 AGCCTTGGGAGGCAGGCCCGTGG + Intronic
1071841478 10:89476479-89476501 ATCCCTAAGAGGAGGGACCCTGG + Intronic
1073459252 10:103656905-103656927 AGCCTTAGGAGGCTGGAACTGGG - Intronic
1076807299 10:132865377-132865399 AGTCCCAGGAGGAGGGGCCGAGG + Intronic
1077057405 11:601469-601491 AGCCCAAGGAGCCGGTACAGCGG - Intronic
1077293945 11:1815333-1815355 GGCCCTAGGAGGCTGGGCCTGGG + Intergenic
1077505629 11:2928841-2928863 CGCCCTAACAGCCGGGACCGGGG - Intronic
1078341400 11:10500013-10500035 AGCTCTGGGAGGCTGAACCGAGG + Intronic
1082024995 11:47565418-47565440 CGGCCTCGGAGGAGGGACCGAGG - Intronic
1083624033 11:64062856-64062878 TGGCCTAGGAGGCGGGGCCGGGG - Intronic
1083882033 11:65553571-65553593 AACCCTAACAGGCGGCACCGGGG - Intronic
1084238859 11:67805478-67805500 AGCGTTATGAGGCGGGACCTGGG + Intergenic
1089581420 11:119483963-119483985 AGCCGCAGGAGGCGGGAGGGAGG - Intergenic
1091225381 11:133953958-133953980 AGCCCTCGGGTGCGGGACAGAGG - Intronic
1092058390 12:5525367-5525389 AGCCCTAGAAGGCGGAACCCCGG - Intergenic
1098123832 12:67269687-67269709 AGCGCCAGCAGGCGGGATCGAGG + Exonic
1101836692 12:108300728-108300750 AGCCCTAGGAGGTGGGTCCTTGG - Intronic
1103080038 12:118016648-118016670 AACGCGAGGGGGCGGGACCGAGG + Intronic
1103940210 12:124497269-124497291 AGCCCACGCAGGCAGGACCGAGG - Intronic
1104775847 12:131389748-131389770 AGCCCTGGGAGGTGGGACAAAGG - Intergenic
1104923184 12:132301654-132301676 AGCCCTTGGAGGAGGGACCTGGG + Intronic
1106243572 13:27928395-27928417 AAGCCTCGGAGGCGGGACGGTGG + Intergenic
1112943027 13:104889873-104889895 AGCCCTGGGAGTCGGGAGTGGGG + Intergenic
1113868964 13:113546425-113546447 AGACCCAGGAGGAGGGGCCGTGG + Intronic
1118627639 14:67674244-67674266 AGCCCTAGGGGGCGTGTCTGAGG + Intronic
1120992519 14:90390425-90390447 AGCTCTAGAAGGCAGGACAGAGG + Intergenic
1121461320 14:94080946-94080968 AGCCCAAGGCGCGGGGACCGTGG + Intronic
1122885481 14:104708577-104708599 AGCCCAAGGAGGTGGGGACGGGG + Exonic
1124334795 15:28848646-28848668 AGCCACAGGAGGCGTCACCGGGG + Intergenic
1125752121 15:42036375-42036397 AGCCCCAGGAGGGGGAACTGGGG + Intronic
1129659045 15:77542920-77542942 AGCTCTAGGAGGCAAGCCCGGGG - Intergenic
1129909280 15:79212804-79212826 AGCCCTGGGAGGAGGCACCCAGG - Intergenic
1131174666 15:90202064-90202086 CGCCCTCGGGGGCGGCACCGCGG - Intronic
1132726123 16:1339068-1339090 TGCCCCAGGAGGTGGGAGCGAGG - Intronic
1133170653 16:3980779-3980801 GGCCCTAGGAGGGGGGACAGAGG + Intronic
1135464838 16:22676417-22676439 AGGCCTAAGAGGCTGGACTGTGG + Intergenic
1135538419 16:23312053-23312075 TGCCCTAGGAGAAGGGACCAGGG + Intronic
1136545306 16:30950982-30951004 AGTCCTAGCAGGGGTGACCGAGG + Intronic
1137676129 16:50304673-50304695 AGCCCCAGGAGGTGGGGCAGAGG - Intronic
1139891098 16:70253679-70253701 AGCCCTAGGGGAGGGGACCCTGG + Intronic
1141772798 16:86101316-86101338 AGCCCGAGGAGGCAGGACTAGGG - Intergenic
1141831601 16:86512380-86512402 AGCCCCAGGAGGCAGGAGCCAGG + Intronic
1142310098 16:89307278-89307300 GGTCCCAGGAGGCAGGACCGTGG - Intronic
1143102464 17:4512020-4512042 AGCCCTAGGAGGCTGGTACTAGG - Intronic
1143174781 17:4949660-4949682 AGCCCTCGGCGGCGGGTCGGAGG - Intronic
1143404957 17:6671272-6671294 AGCCCTTGGAGGCAGGAGCCTGG - Intergenic
1145908558 17:28529485-28529507 GGCCCTAGGAGGTGAGACCTTGG - Intronic
1145937933 17:28726120-28726142 AGACCTAGGAGGCGGCCTCGAGG - Exonic
1145957163 17:28862451-28862473 AGCCCAAGGAGGCCAGACCTAGG + Intergenic
1146176348 17:30668336-30668358 AGCCCAAGGAGGTGGCACGGGGG + Intergenic
1146349808 17:32084450-32084472 AGCCCAAGGAGGTGGCACGGGGG + Intergenic
1146659956 17:34659058-34659080 AGGCCCAGGATGCTGGACCGGGG + Intergenic
1148798118 17:50207138-50207160 AGCCATAGGGGGCGTGGCCGGGG + Intergenic
1151430887 17:74061998-74062020 ACCACTAGGAGACGGGACCGTGG + Intergenic
1152286244 17:79414888-79414910 AGCCCGAGGTGGCGGGAGCCAGG + Intronic
1158721715 18:59931181-59931203 AGCCCCAGAAGGCGGGTCAGGGG - Intergenic
1158751496 18:60266261-60266283 AGCCCTAGAAGCCGGGGCGGTGG - Intergenic
1160242364 18:77132822-77132844 AGCCCGGGGAGGCGGGGCCGGGG - Intronic
1160921609 19:1523509-1523531 GGACCCAGGAGGCAGGACCGGGG - Intergenic
1161771869 19:6235331-6235353 AGGCCTAGGAGGCAGGACCGTGG - Intronic
1162399962 19:10439682-10439704 AGGCCCAGGAGGCGGGTCAGAGG + Intronic
1162801043 19:13110613-13110635 AGCCCTTGGGGGCTGGAACGTGG - Intronic
1162982477 19:14248561-14248583 AGCCCAAGGAGGTGGCACGGGGG - Intergenic
1163007730 19:14406979-14407001 AGGACTTGGAGGCGGGGCCGGGG + Intronic
1163782174 19:19256381-19256403 AGCCCTAGTAGGAGGCACCCAGG + Exonic
1165408674 19:35645159-35645181 GGCCTAAGGGGGCGGGACCGGGG - Intergenic
1165859357 19:38899198-38899220 ACCCATAGCAAGCGGGACCGGGG + Intronic
1166183201 19:41123030-41123052 AGACCTGGGAGGCGGGGCCGTGG - Intronic
1167124372 19:47539154-47539176 AGCCCTGGGAGGCAGGGCCCAGG + Intronic
1167486563 19:49766625-49766647 GGTCCTAGGAGGCGGGACTTAGG - Intergenic
926090225 2:10044299-10044321 AACGCTTGGAGGCGGGAACGCGG + Intronic
932404982 2:71506801-71506823 AGCACTAGGAGGTGGGCCCCAGG - Intronic
941978931 2:171434139-171434161 GGCCGGAGGAGGCGGGGCCGCGG + Intronic
945984127 2:216340603-216340625 AACCCTGGGAGGCTGGACCAAGG - Intronic
948415249 2:237798413-237798435 CGCCCTCAGAGGCGGGACAGGGG - Intronic
1168966789 20:1903607-1903629 AGCCCAAGGAGGCAGGAGAGTGG - Intronic
1173741706 20:45406587-45406609 GGCCCTGGGAGCCGGGAACGAGG - Intronic
1173907945 20:46642374-46642396 AGGCCTATGAGGAGGCACCGAGG - Intronic
1174109502 20:48188575-48188597 AGTCCTAGGATGTGGAACCGTGG + Intergenic
1175220618 20:57414518-57414540 AGCCCTGGGAGGCAGGACCTTGG - Intergenic
1175647262 20:60685149-60685171 ATGACTAGGAGGCGGGACCTGGG - Intergenic
1175853165 20:62104536-62104558 AGCAGTAGGAGGGGGGACTGTGG + Intergenic
1178204228 21:30444337-30444359 AGCCCTAGCAGGAGGGAACTCGG - Intergenic
1181676325 22:24455843-24455865 AGCCCTGGGAAGCTGGACTGAGG - Intergenic
1182586129 22:31345305-31345327 AGCACCAGGCGGCGGGGCCGGGG - Exonic
1185402906 22:50627742-50627764 AGGGCCAGGAGGAGGGACCGCGG + Exonic
952301376 3:32106912-32106934 CGCCCGAGGAGGCCGCACCGGGG + Intronic
952906063 3:38139770-38139792 AGCCAGAGGAGGTGGGACAGCGG + Intronic
954711920 3:52509408-52509430 AGCCCCAGGAGGAGGGACGAAGG + Intronic
954711943 3:52509494-52509516 AGCCCCAGGAGGAGGGACGAAGG + Intronic
955218981 3:57008292-57008314 AGCCCCAGGAAGCGTGAGCGTGG - Intronic
960148671 3:114230439-114230461 AGCCCCAGGAGTCAGGACTGAGG + Intergenic
966412319 3:179656481-179656503 AGCCCTAGGAGGTGGGAAGAAGG - Intronic
967891939 3:194369809-194369831 GGCCCTGGGAGGGGGGACTGTGG + Intergenic
968550573 4:1221685-1221707 TGCTCTAGGAAGCGGGACCCGGG + Intronic
968582148 4:1400185-1400207 AGCCCTAGGAGGAGGGTCCATGG + Intergenic
971355991 4:25895754-25895776 AGCCCTAGGAGACAGGTCTGAGG + Intronic
976431321 4:84966239-84966261 AGGCCCAGGAGACGGGACCGCGG + Exonic
998059137 5:139105318-139105340 AGGCCAAGGAGGCTGGACTGTGG + Intronic
1006383381 6:33714469-33714491 AGCCCTAGGTGCCTGGACCTTGG - Intergenic
1017305583 6:152914700-152914722 AGCCCTAGGGGGCTGGAACCAGG + Intergenic
1018779258 6:167046979-167047001 ACCCCTAGGAGTGGGGACCATGG + Exonic
1019711404 7:2519713-2519735 AGCGCACGGGGGCGGGACCGGGG + Intronic
1023064778 7:36366849-36366871 AGCCCCGGGCGGCGGGACCCCGG + Intronic
1024064466 7:45720957-45720979 AGCCCTGAGAGGCAGGACCAGGG + Exonic
1027756776 7:82223858-82223880 AGCCCTAACAGGCAGGACCAAGG - Intronic
1028796520 7:94908659-94908681 AACCCAAGGAGGCGGGGGCGGGG - Intronic
1030193891 7:106834639-106834661 AGCTCCAGGAGGCGAGACAGAGG - Intergenic
1031051923 7:116953695-116953717 AGGCCTGGGAGCCGGGCCCGCGG + Intronic
1034535752 7:151724753-151724775 AGCCCTAGCAGGAGGGAGCGTGG - Intronic
1034974821 7:155441934-155441956 AGCCCTGGGAGGGGGGAGGGAGG - Intergenic
1038566339 8:28622706-28622728 GGCCTCAGGGGGCGGGACCGTGG + Intronic
1043471278 8:80565808-80565830 AGCCTTGGGGGGCGGGAGCGGGG - Intergenic
1045558593 8:103238966-103238988 ATCTCTAGGAGGTGGGACCCAGG - Intergenic
1049838486 8:144755220-144755242 GGCCCTAGAAGGCTGGACTGAGG - Intronic
1058077366 9:100664574-100664596 AGCACTAGGAGGCTGGGCTGAGG + Intergenic
1059417859 9:114173101-114173123 AGCCCCAGGAGGGGGGAACATGG + Intronic
1060596762 9:124853311-124853333 AGCCGCAGCAGGCGGGACCGCGG - Intergenic
1185567964 X:1110090-1110112 TGCCCCAGGAGGCAGGACCGAGG + Intergenic
1186496144 X:10014576-10014598 AGCCCCTGAAGGCGGGGCCGAGG - Intergenic
1186616011 X:11188737-11188759 AGCCCGAGGAGCCGGTTCCGGGG + Exonic
1196791409 X:119468369-119468391 AGGCGTCGGAGGCGGGGCCGGGG - Intergenic
1200226329 X:154419808-154419830 AGCCCGAGGGGGCGGGAGCCAGG - Intronic