ID: 900094914

View in Genome Browser
Species Human (GRCh38)
Location 1:936388-936410
Sequence GAGCCCTAGGAGGCGGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 4, 1: 0, 2: 0, 3: 9, 4: 223}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900094914_900094934 23 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094934 1:936434-936456 GGTCCCGCCTTCTAGGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 112
900094914_900094928 2 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094928 1:936413-936435 GGACGGAGGGGGTCCCCGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 143
900094914_900094926 -2 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094926 1:936409-936431 TCCTGGACGGAGGGGGTCCCCGG 0: 2
1: 3
2: 1
3: 23
4: 380
900094914_900094924 -10 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094924 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 2
3: 15
4: 181
900094914_900094931 16 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094931 1:936427-936449 CCCGGTCGGTCCCGCCTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 57
900094914_900094925 -9 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094925 1:936402-936424 CTAGGGCTCCTGGACGGAGGGGG 0: 2
1: 3
2: 1
3: 12
4: 171
900094914_900094938 28 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094938 1:936439-936461 CGCCTTCTAGGGCTCCGGGAAGG 0: 1
1: 0
2: 6
3: 12
4: 107
900094914_900094933 17 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094914_900094935 24 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094935 1:936435-936457 GTCCCGCCTTCTAGGGCTCCGGG 0: 1
1: 5
2: 1
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900094914 Original CRISPR GAGCCCTAGGAGGCGGGACC GGG (reversed) Intronic
900094865 1:936271-936293 GAGCCCTAGGAGGCGGGACCGGG - Intronic
900094882 1:936310-936332 GAGCCCTAGGAGGCGGGACCGGG - Intronic
900094898 1:936349-936371 GAGCCCTAGGAGGCGGGACCGGG - Intronic
900094914 1:936388-936410 GAGCCCTAGGAGGCGGGACCGGG - Intronic
900410962 1:2512451-2512473 GAGCCCCAGGAGACGGCGCCAGG + Intronic
900420540 1:2554203-2554225 CAGCCCAAGGAGGCGGGAGACGG - Intergenic
900423624 1:2566481-2566503 CAGCCCAAGGAGGCGGGAGACGG + Intergenic
901323886 1:8355806-8355828 GAGGCCTTGGAGGAGGGGCCAGG - Intronic
902271566 1:15308739-15308761 GAGCCCTTGGAGTCGGGCCTGGG + Intronic
902383850 1:16065340-16065362 GAGCCCTGGGAGAAGGGAGCCGG - Intronic
903125109 1:21242503-21242525 GAACACAAGGAGGAGGGACCTGG + Intronic
903259979 1:22126349-22126371 GAATCCTAGGAGGCTGGTCCTGG + Intronic
908173486 1:61530773-61530795 GAGGCATAGGATGCTGGACCTGG - Intergenic
912576216 1:110674839-110674861 GAGCGCGAGGAGGAGCGACCTGG - Exonic
913203869 1:116517667-116517689 GAGGCAGAGGAGGCGGGACTGGG - Intronic
914796412 1:150923995-150924017 GAGGCCCAGGAGGCGGAACCCGG + Intergenic
918206560 1:182314869-182314891 GAGCCCTAGGCAGGAGGACCTGG - Intergenic
922545421 1:226453169-226453191 GAGGCCCAGGAGGCAGGGCCTGG + Intergenic
924218320 1:241848112-241848134 AAGCCGCAGGAGGCGGAACCGGG + Intronic
1062910338 10:1208234-1208256 CAGCCCTAGGAGGCTGGCACTGG - Intronic
1063040062 10:2329050-2329072 GGGCCCTAGGAGGAAGGACGTGG - Intergenic
1063865769 10:10363710-10363732 GAGCCAAAGGAGGTGGGAACTGG + Intergenic
1063994939 10:11611061-11611083 GAGCCCCAGTGGGCAGGACCCGG - Intronic
1064291802 10:14041581-14041603 GAGCCCCAAAAGGCGTGACCAGG + Intronic
1065024531 10:21527301-21527323 GCGCCGGAGGAAGCGGGACCTGG + Intergenic
1067557397 10:47282518-47282540 GAGTCCCAGGAGGCAGCACCTGG + Intergenic
1069546776 10:69334669-69334691 GAGCCCTAGGAGGCACCACGTGG - Intronic
1072623547 10:97096572-97096594 GAGCCCGAGCAGGAGGGGCCAGG + Intronic
1073459253 10:103656906-103656928 CAGCCTTAGGAGGCTGGAACTGG - Intronic
1074996306 10:118760232-118760254 GAGCCCACGGAGGCGGGGGCAGG + Intergenic
1076569990 10:131426246-131426268 GAGCCCTGGAAGGAGGGGCCAGG + Intergenic
1076979068 11:195745-195767 GAGCCCTAGGGAGGGGGCCCTGG + Intronic
1077241439 11:1512731-1512753 CAGCGCTAGGAGGTGGGGCCTGG + Intergenic
1077293944 11:1815332-1815354 CGGCCCTAGGAGGCTGGGCCTGG + Intergenic
1077505630 11:2928842-2928864 GCGCCCTAACAGCCGGGACCGGG - Intronic
1079452222 11:20606961-20606983 GAGCCCTAGGAGGCAAAAGCAGG - Intronic
1081809906 11:45908880-45908902 GAGCCATGGGAGGTGGGAGCTGG - Intergenic
1083624034 11:64062857-64062879 CTGGCCTAGGAGGCGGGGCCGGG - Intronic
1084238858 11:67805477-67805499 GAGCGTTATGAGGCGGGACCTGG + Intergenic
1085313764 11:75531260-75531282 GAGCTCTGGGGGGCGGGGCCGGG + Intergenic
1089556258 11:119317240-119317262 CAGCCCTAGGGGGCGGGCCCCGG + Intronic
1090237140 11:125157695-125157717 GAGGCCTAGTAGGAGGGACATGG - Intergenic
1090482669 11:127081885-127081907 GAGGCCAAGGCGGCGGGCCCTGG + Intergenic
1091170896 11:133518866-133518888 GAACCCTAGGGGGCGGGCACAGG - Intronic
1091777747 12:3195681-3195703 GTGCCCTAGGAAGCTGGGCCTGG - Intronic
1092280155 12:7092213-7092235 GATCCCTAGGAGGAGGGATGGGG + Intronic
1095180885 12:39145334-39145356 CAGCACCAGGAGGCGGGAACGGG - Intergenic
1095979573 12:47963782-47963804 CAGCCCCAGGAGGCGGGCTCAGG - Intronic
1096498321 12:52051261-52051283 GAGCCCGAGGGGGCGGGGCGAGG - Intronic
1102826465 12:115951393-115951415 GGGTCCAAGGAGGAGGGACCCGG - Intergenic
1103412968 12:120725807-120725829 GAGTGCTGGGGGGCGGGACCCGG - Exonic
1103856531 12:123973777-123973799 GAGCCCTTCCAGGCGGGTCCCGG + Exonic
1103954197 12:124567438-124567460 GCGCCCTAGGAGGCGGCGGCGGG - Intronic
1103971511 12:124675629-124675651 GAGCCCTGGGAGGAGGCCCCAGG + Intergenic
1104919436 12:132282992-132283014 GAGGCCTGGGAGTCTGGACCCGG - Intronic
1104923183 12:132301653-132301675 CAGCCCTTGGAGGAGGGACCTGG + Intronic
1105854471 13:24362029-24362051 GGGCCCTTGGGGGCAGGACCAGG - Intergenic
1108042929 13:46356214-46356236 GAGAACTAGGAGGCTGGTCCTGG + Intronic
1113695507 13:112342999-112343021 GAGCCCAAGGTCCCGGGACCTGG + Intergenic
1117978695 14:61321673-61321695 GAGCCTTCGGAGGCGGGGGCAGG + Intronic
1119460551 14:74798849-74798871 GAGCCCTAGGAGGCTCATCCCGG - Exonic
1122582189 14:102777748-102777770 GCGCCCTGGGCGGCGGGGCCCGG + Intronic
1122843231 14:104476869-104476891 GTGCCCTTGGGGGCAGGACCGGG - Intronic
1122843263 14:104476982-104477004 GTGCCCTTGGGGGCAGGACCGGG - Intronic
1122885480 14:104708576-104708598 GAGCCCAAGGAGGTGGGGACGGG + Exonic
1123469877 15:20541765-20541787 GAGCCAGAGGAGGCGTAACCAGG + Exonic
1123471972 15:20562352-20562374 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1123646031 15:22438001-22438023 GAGCCAGAGGAGGCGTAACCAGG + Intergenic
1123648178 15:22458916-22458938 GAGCCAGAGGAGGCGTAACCAGG - Intronic
1123667336 15:22617855-22617877 GAGCCAGAGGAGGCGTAACCAGG + Intergenic
1123730171 15:23136787-23136809 GAGCCAGAGGAGGCGTAACCAGG + Exonic
1123732276 15:23157343-23157365 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1123748309 15:23334197-23334219 GAGCCAGAGGAGGCGTAACCAGG + Intergenic
1123750411 15:23354725-23354747 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1124282781 15:28378641-28378663 GAGCCAGAGGAGGCGTAACCAGG - Intronic
1124299918 15:28532972-28532994 GAGCCAGAGGAGGCGTAACCAGG + Intronic
1124302017 15:28553545-28553567 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1124321178 15:28712422-28712444 GAGCCAGAGGAGGCGTAACCAGG + Intronic
1124334794 15:28848645-28848667 GAGCCACAGGAGGCGTCACCGGG + Intergenic
1124481320 15:30082932-30082954 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1124487775 15:30135028-30135050 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1124522277 15:30414261-30414283 GAGCCAGAGGAGGCGTAACCAGG + Intergenic
1124536388 15:30551957-30551979 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1124542866 15:30604005-30604027 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1124562823 15:30791454-30791476 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1124755753 15:32403293-32403315 GAGCCAGAGGAGGCGTAACCAGG + Intergenic
1124762263 15:32455635-32455657 GAGCCAGAGGAGGCGTAACCAGG + Intergenic
1124776366 15:32593433-32593455 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1125752120 15:42036374-42036396 GAGCCCCAGGAGGGGGAACTGGG + Intronic
1126130118 15:45332817-45332839 CAGCCTGAGGAGGCTGGACCGGG - Intergenic
1127480449 15:59372459-59372481 GCGTCCTAGGACGCCGGACCCGG - Intronic
1128261471 15:66235941-66235963 GAGCCTCAGGAGGAGGGACTTGG - Intronic
1129036697 15:72654674-72654696 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1129198003 15:73982512-73982534 GACCTCCAGGAGGCGGGACAAGG + Exonic
1129213190 15:74082551-74082573 GAGCCAGAGGAGGCGTAACCAGG + Intergenic
1129397209 15:75258535-75258557 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1129400821 15:75282812-75282834 GAGCCAGAGGAGGCGTAACCAGG - Intronic
1129474432 15:75775530-75775552 GAGCCAGAGGAGGCGTAACCAGG - Intergenic
1129659046 15:77542921-77542943 GAGCTCTAGGAGGCAAGCCCGGG - Intergenic
1129730323 15:77926867-77926889 GAGCCAGAGGAGGCGTAACCAGG + Intergenic
1132090704 15:98946180-98946202 GAGCACTAGGAAGCGGGGCGGGG + Intronic
1132101151 15:99024397-99024419 GAGCCCCAGGAGGATGGCCCAGG - Intergenic
1132519221 16:379748-379770 GAGCCCTGGGAGTCGGGGACTGG - Intronic
1132575186 16:660840-660862 GAGCGCCAGGAGGCGCTACCGGG - Intronic
1132684728 16:1157569-1157591 GAGCCCGGGGAGGCGGGCGCAGG - Intronic
1132797041 16:1729711-1729733 GAGACCCAGGAGGAGGGAGCTGG + Intronic
1132837077 16:1959545-1959567 GCGACCTAGGCCGCGGGACCCGG + Exonic
1134297794 16:12962206-12962228 CAGCCCTAGGAGGCAGGAAGGGG + Intronic
1135521641 16:23182687-23182709 GGTCCCTAGGGGGCGGGGCCTGG + Intergenic
1135538418 16:23312052-23312074 CTGCCCTAGGAGAAGGGACCAGG + Intronic
1135759542 16:25126138-25126160 GGGCACTAGGAGGTGGGAGCCGG + Intronic
1136455734 16:30378756-30378778 GAGGCCCAGGAGGCAGGGCCTGG + Intronic
1136505550 16:30700670-30700692 GGGCCCTGGAAGGCGGGTCCCGG + Exonic
1139269792 16:65671379-65671401 GAGCCCTTGGGGACAGGACCAGG + Intergenic
1139712844 16:68789767-68789789 GTGCCCCAGGAGGCTGGGCCCGG + Intronic
1141482946 16:84318761-84318783 GAGGCCTAGGAGGTGCGAGCGGG + Intronic
1141772799 16:86101317-86101339 CAGCCCGAGGAGGCAGGACTAGG - Intergenic
1142117534 16:88367690-88367712 GTGCCCAAGGATGCGGGGCCTGG - Intergenic
1142200130 16:88757198-88757220 GAGCCCTCGGAGCCGGGGGCTGG + Intronic
1142376082 16:89707809-89707831 CAGCCCTGGGAGGCGAGGCCAGG + Exonic
1142466558 17:140563-140585 GAGCCCTAGGGAGGGGGCCCTGG + Intergenic
1142709723 17:1716356-1716378 GCGCCCGGAGAGGCGGGACCAGG - Intergenic
1143500559 17:7336424-7336446 GAGCCCCAGGAGGAAGGAGCTGG + Intergenic
1145094157 17:20009824-20009846 GAGACCCAGGAGCCGGGGCCGGG - Intronic
1147353242 17:39868456-39868478 GAGGCGAAGGAGGCAGGACCGGG - Intronic
1148766025 17:50038652-50038674 GGGCCCTAGGAGTGGGGACAGGG - Intergenic
1152667548 17:81580072-81580094 GAGCACTGGGAGGCAGGAGCTGG - Intronic
1152739244 17:82011870-82011892 GAGCCCCAGGGGTGGGGACCAGG - Intronic
1152928668 17:83099339-83099361 GAGCCTTCTGAGGCGGCACCGGG + Intergenic
1154501472 18:14999866-14999888 GAGCGCTTGGACGCGGGTCCCGG + Intergenic
1158721716 18:59931182-59931204 GAGCCCCAGAAGGCGGGTCAGGG - Intergenic
1160242365 18:77132823-77132845 AAGCCCGGGGAGGCGGGGCCGGG - Intronic
1160884028 19:1336488-1336510 GAGCCTTTGGAGGCATGACCTGG - Intergenic
1160921610 19:1523510-1523532 GGGACCCAGGAGGCAGGACCGGG - Intergenic
1162407760 19:10485895-10485917 GAGCCCTAGGAGATGTGACTAGG + Intergenic
1162551034 19:11358344-11358366 CAGCCCTAGGAGGCCGGGCGTGG - Intronic
1163490399 19:17614452-17614474 GAGTCACAGAAGGCGGGACCGGG - Intronic
1163772511 19:19199389-19199411 GAGCCCCAGGAGCCAGGACTGGG - Intronic
1163779302 19:19238097-19238119 GAGCCTCAGGAGGAGGGGCCAGG + Intronic
1165346959 19:35254533-35254555 GAGCCCGAGGAGGTGGAACAGGG - Intronic
1165408675 19:35645160-35645182 GGGCCTAAGGGGGCGGGACCGGG - Intergenic
1166205093 19:41264453-41264475 GAGCCCTGGGAGGCCGGGCCGGG + Exonic
1167673178 19:50867728-50867750 CAGCCCTAGAAGGCAGAACCAGG - Intronic
932186312 2:69699236-69699258 GAGCCCTGGAAGGTGGGGCCAGG - Intronic
935238489 2:101157768-101157790 GAGACCTAGGAGCCAGGTCCTGG - Intronic
935682090 2:105647041-105647063 AAGCCCGAGGAGGAGGGAGCTGG - Intergenic
937986489 2:127640425-127640447 GGGCCCTGGGAGGCAGGGCCTGG - Intronic
938500653 2:131830048-131830070 GAGCGCTTGGAAGCGGGTCCCGG + Intergenic
938953491 2:136278395-136278417 GAGCCCCAGCAGGCTGGAACAGG + Intergenic
942046665 2:172102847-172102869 GGGCTCTGGGAGGCGGGAGCAGG + Exonic
943041933 2:182814337-182814359 GTGCTCAAGGAGGCGGAACCTGG + Intergenic
943503273 2:188719296-188719318 GAGCCCTAGGAATCCTGACCAGG + Intergenic
948896915 2:240931882-240931904 GAGCCACAGGAAGGGGGACCTGG + Intronic
1168794642 20:603400-603422 GAGCCCTGGGAGGTGAGAGCTGG - Intergenic
1170770262 20:19326469-19326491 GTGCCCCAGGAGGCCGGACCTGG - Intronic
1175334449 20:58186069-58186091 GAGCCCCAAGAGGAGGGTCCGGG + Intergenic
1175647263 20:60685150-60685172 GATGACTAGGAGGCGGGACCTGG - Intergenic
1176025900 20:62985551-62985573 GTGCCTTAAGAGGCGGGGCCCGG + Intergenic
1179511883 21:41878977-41878999 GCGCCCGCGGCGGCGGGACCCGG + Exonic
1180671165 22:17554576-17554598 GAGCCCTAGGCAGCAGCACCAGG - Intronic
1180801679 22:18634813-18634835 GAGCCCTAACTGGCGGCACCCGG - Intergenic
1180852924 22:19030352-19030374 GAGCCCTAACTGGCGGCACCCGG - Intergenic
1181220044 22:21360448-21360470 GAGCCCTAACTGGCGGCACCCGG + Intergenic
1182696594 22:32202933-32202955 GAGCAATAGGAGGCGGGTCCAGG + Exonic
1183076826 22:35432679-35432701 GAGCCAGATGAGGCTGGACCAGG - Intergenic
1184776504 22:46626127-46626149 GAGTCCTGGGAGCCGGGGCCAGG + Intronic
1185319077 22:50192233-50192255 GAGCCCCTCGAGGCGGGGCCAGG - Intronic
950881116 3:16323270-16323292 GAGCCCTTGGAAGCTGGAGCAGG + Intronic
952301375 3:32106911-32106933 GCGCCCGAGGAGGCCGCACCGGG + Intronic
954610401 3:51941979-51942001 GAGCAGTAGGAGGCGGGGCCCGG - Intergenic
954638539 3:52084756-52084778 GAGCCCTGGGTGGTGGTACCTGG + Intronic
954782685 3:53072859-53072881 GAGCCCTGTGAGGAGAGACCTGG - Intronic
955775249 3:62425908-62425930 GTGCCCCAGGAGGCAGGACTGGG - Intronic
955972084 3:64445710-64445732 GAGCCTTCAGGGGCGGGACCAGG - Intergenic
957549537 3:81686035-81686057 AAGCCCAAGGAGGGGGAACCAGG - Intronic
960044106 3:113179666-113179688 GGGCCCTTGGAGGCCTGACCTGG + Intergenic
960224063 3:115148275-115148297 GAGCCCTAGCACTGGGGACCCGG - Intergenic
961775061 3:129278766-129278788 GGGCCCTTGGGGGCGGGGCCTGG + Intergenic
962745997 3:138397515-138397537 GCGCCCTAGGAGGCAGGCGCAGG - Intronic
965381306 3:167992287-167992309 GATCACTATGAGGCAGGACCTGG + Intergenic
967146882 3:186613818-186613840 CAGCACCAGGAGGCAGGACCGGG - Intronic
968550572 4:1221684-1221706 CTGCTCTAGGAAGCGGGACCCGG + Intronic
969262925 4:6045030-6045052 GGGCCCTGGGAGGCGGGGCGCGG - Intronic
982325537 4:154125365-154125387 GTGCCCTAGGAGGAGGAACACGG + Intergenic
983136455 4:164088657-164088679 GAGCCCCAGGAGGCTGAAGCTGG + Intronic
984206367 4:176792442-176792464 GAGCCGGAGGCGGCGGGAGCGGG + Exonic
986393644 5:7306655-7306677 GAGCCACAGGAGGCGTCACCAGG + Intergenic
987607725 5:20159367-20159389 GTGCCCTAGGAGGAGGAATCTGG + Intronic
992850032 5:80797770-80797792 GAGGCCAAGGAGGCTGGCCCAGG + Intronic
995060275 5:107805943-107805965 GGGCTCCAGGAGGCGGGGCCAGG - Intergenic
997990630 5:138542522-138542544 GAGCCCGAAGAGGGAGGACCTGG + Intronic
998376387 5:141693600-141693622 GAGGCCTAGTAGGTGGGACGGGG + Intergenic
1001441936 5:171750200-171750222 GAGGCCTAGGAGGGGCCACCAGG - Intergenic
1003110804 6:3250695-3250717 GAGCCTGAGAAGGAGGGACCTGG + Intronic
1005781773 6:29200873-29200895 GAGCCCCTGGAGCCGGGAACAGG + Intergenic
1006058555 6:31403417-31403439 GAGATTTAGAAGGCGGGACCTGG - Intronic
1010201648 6:73287567-73287589 GATCCCCAGGAGGAAGGACCTGG + Intronic
1018778905 6:167044748-167044770 CAGCCCTGGGAGGAGGGGCCGGG + Exonic
1019181426 6:170189401-170189423 GGGCCCTAGGAGGACAGACCTGG - Intergenic
1019621682 7:1995543-1995565 GAGCCCCAGGCGGGGGGCCCAGG + Intronic
1019711403 7:2519712-2519734 GAGCGCACGGGGGCGGGACCGGG + Intronic
1020040842 7:4999672-4999694 GAGCCCTGGAAGGTGGGGCCAGG - Intronic
1020078509 7:5274227-5274249 GAGCTCCAGGAAGTGGGACCAGG - Intergenic
1023163539 7:37321425-37321447 AAGCCCTAGGAGGCCGGGCGCGG + Intronic
1023895886 7:44432583-44432605 GAGCCCCAGGGGGCGGGAAGTGG - Intronic
1024064465 7:45720956-45720978 CAGCCCTGAGAGGCAGGACCAGG + Exonic
1025200383 7:56957966-56957988 GAGCTCCAGGAAGTGGGACCAGG + Intergenic
1025671560 7:63618966-63618988 GAGCTCCAGGAAGTGGGACCAGG - Intergenic
1029489973 7:100865852-100865874 GAGCCCGGGGAGGAGGGAACAGG - Exonic
1032020352 7:128404343-128404365 GAGGCCTTAGAGGTGGGACCAGG + Intronic
1032082760 7:128868336-128868358 GAGCCCTAGAAGCGGGGAGCAGG + Intronic
1034977745 7:155458004-155458026 GAGCCCGAGGCGGCCGGACGCGG + Intergenic
1035317983 7:158009104-158009126 GAGCCCCAGGAGGCCCCACCTGG + Intronic
1035448195 7:158957296-158957318 CAGCCCCAGCAGCCGGGACCTGG - Intergenic
1039382591 8:37099952-37099974 GGGCCCTAGGAGGGAGGAACAGG - Intergenic
1039512931 8:38105835-38105857 GAGCCATTGGCGGCGGGGCCTGG - Intronic
1040072045 8:43196412-43196434 CAGCACTAGGAAGAGGGACCGGG - Intronic
1044731145 8:95229521-95229543 GTGCCCTGGGAGGCCTGACCTGG - Intergenic
1046595679 8:116258675-116258697 GAGGCCTATGAGGCGGTACATGG - Intergenic
1046632878 8:116639058-116639080 CACCCCTAGGTGGCAGGACCGGG - Intergenic
1047091938 8:121584389-121584411 CAGTCCTATGAGGCAGGACCTGG - Intergenic
1049262247 8:141646016-141646038 GAGGCCTCGGAGGCGGGAGGTGG - Intergenic
1049284454 8:141767069-141767091 GTGCCCTAGGAGGCCGGAGGGGG + Intergenic
1049415664 8:142493755-142493777 GAGCCCTAGAGGGCGGGCCACGG + Intronic
1049614217 8:143569178-143569200 GGGGCCTGGGAGGCGGGGCCTGG + Intronic
1049800322 8:144514636-144514658 TAGCCCTAGGACCCAGGACCTGG - Intronic
1060053661 9:120394456-120394478 GAGCCCTCGGAGGCAGGAAGTGG + Intronic
1061065650 9:128276035-128276057 GAGCCAGAGGAGGCGTAACCAGG + Intronic
1061457886 9:130712619-130712641 GAGCCCCAGAAGTCGGGGCCCGG + Intergenic
1062499033 9:136844481-136844503 GAGCACTTGGACGCGGGTCCCGG - Exonic
1191599843 X:62990944-62990966 GAGCCCTGGGAGGGGGTAGCGGG + Intergenic
1195197900 X:102516936-102516958 GAGGCCTGGGAGGTGGGGCCTGG - Intergenic
1195347143 X:103962449-103962471 GAGGCCTGGGAGGTGGGGCCTGG + Intronic
1195360299 X:104076392-104076414 GAGGCCTGGGAGGTGGGGCCTGG - Intergenic
1199697261 X:150351605-150351627 GAGTCCTGGGAGGTGGGAACAGG + Intergenic
1200155557 X:153972875-153972897 CAGCCCTGGGAGGTGGGTCCCGG + Intronic