ID: 900094915

View in Genome Browser
Species Human (GRCh38)
Location 1:936389-936411
Sequence GGAGCCCTAGGAGGCGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 4, 1: 0, 2: 1, 3: 15, 4: 251}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900094915_900094931 15 Left 900094915 1:936389-936411 CCGGTCCCGCCTCCTAGGGCTCC 0: 4
1: 0
2: 1
3: 15
4: 251
Right 900094931 1:936427-936449 CCCGGTCGGTCCCGCCTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 57
900094915_900094935 23 Left 900094915 1:936389-936411 CCGGTCCCGCCTCCTAGGGCTCC 0: 4
1: 0
2: 1
3: 15
4: 251
Right 900094935 1:936435-936457 GTCCCGCCTTCTAGGGCTCCGGG 0: 1
1: 5
2: 1
3: 10
4: 108
900094915_900094925 -10 Left 900094915 1:936389-936411 CCGGTCCCGCCTCCTAGGGCTCC 0: 4
1: 0
2: 1
3: 15
4: 251
Right 900094925 1:936402-936424 CTAGGGCTCCTGGACGGAGGGGG 0: 2
1: 3
2: 1
3: 12
4: 171
900094915_900094928 1 Left 900094915 1:936389-936411 CCGGTCCCGCCTCCTAGGGCTCC 0: 4
1: 0
2: 1
3: 15
4: 251
Right 900094928 1:936413-936435 GGACGGAGGGGGTCCCCGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 143
900094915_900094938 27 Left 900094915 1:936389-936411 CCGGTCCCGCCTCCTAGGGCTCC 0: 4
1: 0
2: 1
3: 15
4: 251
Right 900094938 1:936439-936461 CGCCTTCTAGGGCTCCGGGAAGG 0: 1
1: 0
2: 6
3: 12
4: 107
900094915_900094934 22 Left 900094915 1:936389-936411 CCGGTCCCGCCTCCTAGGGCTCC 0: 4
1: 0
2: 1
3: 15
4: 251
Right 900094934 1:936434-936456 GGTCCCGCCTTCTAGGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 112
900094915_900094926 -3 Left 900094915 1:936389-936411 CCGGTCCCGCCTCCTAGGGCTCC 0: 4
1: 0
2: 1
3: 15
4: 251
Right 900094926 1:936409-936431 TCCTGGACGGAGGGGGTCCCCGG 0: 2
1: 3
2: 1
3: 23
4: 380
900094915_900094933 16 Left 900094915 1:936389-936411 CCGGTCCCGCCTCCTAGGGCTCC 0: 4
1: 0
2: 1
3: 15
4: 251
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900094915 Original CRISPR GGAGCCCTAGGAGGCGGGAC CGG (reversed) Intronic
900094866 1:936272-936294 GGAGCCCTAGGAGGCGGGACCGG - Intronic
900094883 1:936311-936333 GGAGCCCTAGGAGGCGGGACCGG - Intronic
900094899 1:936350-936372 GGAGCCCTAGGAGGCGGGACCGG - Intronic
900094915 1:936389-936411 GGAGCCCTAGGAGGCGGGACCGG - Intronic
900192753 1:1358425-1358447 GGGGCCCTGGGAGGCGGGTGGGG - Intronic
900656274 1:3759692-3759714 GGACCCCCAGGAGCTGGGACTGG - Intronic
901040264 1:6359254-6359276 GGAGCTCTAGAAGGCGGCAGTGG - Intronic
901433967 1:9234984-9235006 GGAGCCCTCGGGAGCGGGCCCGG + Exonic
901771012 1:11530401-11530423 GGATTCCTAGGAGGAAGGACAGG + Intronic
902271565 1:15308738-15308760 TGAGCCCTTGGAGTCGGGCCTGG + Intronic
902479727 1:16705111-16705133 GGAGCCATAGGAGGTGGCATGGG + Intergenic
902985900 1:20153939-20153961 GCAGCCCTAGGAGGTGGGTGAGG + Intergenic
906568873 1:46819595-46819617 GGAGGCCTGGGAGGCTGGATGGG + Intergenic
913203870 1:116517668-116517690 AGAGGCAGAGGAGGCGGGACTGG - Intronic
915367216 1:155323171-155323193 GGAAGCCTAGGAGGCGTGAGCGG - Intronic
916797288 1:168178975-168178997 GGAAGCCTAGGAGGCTGGGCCGG + Exonic
918064155 1:181088563-181088585 GGAGCCCGAGGAGGGGCGCCAGG - Intergenic
918234135 1:182562158-182562180 GGGGCCTCAGGAGGCAGGACTGG - Intergenic
919142512 1:193590043-193590065 GGTGCCGTAGGAGGTGGGAATGG + Intergenic
919922354 1:202174197-202174219 GGGGCCCTAAGAGGTGTGACAGG + Intergenic
923547254 1:234931893-234931915 GGATCTCTAGGATGCAGGACAGG - Intergenic
923818165 1:237403662-237403684 GGAGGCCAAGGAGGGGGGACTGG - Intronic
924218319 1:241848111-241848133 GAAGCCGCAGGAGGCGGAACCGG + Intronic
1062883152 10:995019-995041 GGAGACCCAGGAGGTGGGGCAGG + Intronic
1063243642 10:4195746-4195768 GGAGCTCAAGGAGCCAGGACTGG + Intergenic
1063320345 10:5046240-5046262 GCAGCCATAGGAGGAGGGAATGG - Intronic
1066064017 10:31749603-31749625 GGAGCCCTAGGAGAGGTGATGGG - Intergenic
1066406963 10:35127312-35127334 GGAGCCGTGGGCGGCGGGCCGGG + Intronic
1070813640 10:79310670-79310692 GGAGCCCCAGGAGGTGGGGAGGG - Intronic
1072003507 10:91220612-91220634 GTTGCCCTTGGAGGCGGCACCGG + Intronic
1072243139 10:93516066-93516088 GCAACCCTAAGAGGCGGGGCAGG + Intronic
1072344335 10:94488680-94488702 AGACCCCTTGGAGGCCGGACCGG - Intronic
1074699802 10:116083082-116083104 GGAGCCACAGGAGGCGAGCCAGG + Intronic
1075702510 10:124478433-124478455 GGATCCCTCGGAGGGGAGACTGG - Intronic
1075974820 10:126685984-126686006 GGGGCCCTTGGAGGGAGGACTGG + Intergenic
1076111654 10:127864309-127864331 GGAGTCCAAGGAGGCAGGAGTGG - Intergenic
1077192865 11:1262757-1262779 GGCGCGACAGGAGGCGGGACAGG - Intergenic
1077917232 11:6619254-6619276 AGAGCCCTAGGAGGCTGTAGGGG + Exonic
1081906747 11:46675103-46675125 GGAGAATTAGGAGGCGGGGCTGG - Intergenic
1082807542 11:57460410-57460432 CGACCACTAGGAGGCGGGAGCGG - Intergenic
1084891239 11:72238119-72238141 GGAGCGCTATGAGGAGGGCCTGG + Exonic
1084971260 11:72773346-72773368 GGGGCCCCTGGAGGCAGGACAGG + Intronic
1085454161 11:76656383-76656405 GGAGCACTGAGAGGCGTGACAGG - Intergenic
1085516545 11:77115304-77115326 GGAGGGCTAGGAGGCTGCACGGG - Intronic
1086699268 11:89881503-89881525 GGAGGCCTAGGTGGCTTGACCGG + Intergenic
1086706904 11:89963007-89963029 GGAGGCCTAGGTGGCTTGACCGG - Intergenic
1087270571 11:96107608-96107630 ATAGCCTCAGGAGGCGGGACTGG + Intronic
1089352402 11:117828972-117828994 GGAGCCCCACCAGGCGGGGCAGG + Intronic
1089621597 11:119725876-119725898 GGAGCCCTAGGAGGAGGCAGAGG - Intronic
1091386579 12:99811-99833 GGAACTCCAGGAAGCGGGACAGG - Intronic
1091887482 12:4027185-4027207 GGGGCCATAGGAGGCAGGCCAGG + Intergenic
1092094063 12:5827529-5827551 GGAGACCTGGGAGGAGGGCCTGG + Intronic
1092181217 12:6448246-6448268 GGAGCCCTAGGTGCCCTGACAGG - Intronic
1092239982 12:6830382-6830404 GGGGCGCCAGGAGGCAGGACTGG + Exonic
1092280154 12:7092212-7092234 TGATCCCTAGGAGGAGGGATGGG + Intronic
1093604009 12:21067765-21067787 GGAGCCCTAGGAATCTGGTCAGG + Intronic
1095967200 12:47876927-47876949 GGAGGCCTAGGAGGAGAGAGTGG + Intronic
1096216690 12:49801664-49801686 GGAGCACTGGGAGGAGGGAACGG + Intronic
1097264149 12:57736348-57736370 GGAGACTTGGGAGGCGGTACGGG - Intronic
1098392551 12:69984887-69984909 GGAGCTCTAGGAAGTGGGCCTGG + Intergenic
1098826671 12:75305940-75305962 GGAGCCCGAGGAGCATGGACAGG + Intronic
1100723951 12:97388483-97388505 GGAGGCCTAAAAGGCTGGACTGG + Intergenic
1100963809 12:99991046-99991068 GGAGCCTTAGGAGTGGAGACAGG - Intergenic
1101641739 12:106590489-106590511 TGAGCCCTAGGAAGCTGGGCTGG + Intronic
1103954198 12:124567439-124567461 GGCGCCCTAGGAGGCGGCGGCGG - Intronic
1104893626 12:132151654-132151676 GGGGCCCTCGGAGGCTGGGCTGG + Intronic
1104945994 12:132415130-132415152 GGAGCCCTGGGATCCGGAACTGG + Intergenic
1105286505 13:19008754-19008776 GGAGGGCTAGGAGGAGGAACAGG - Intergenic
1105423507 13:20273424-20273446 GGTACTCTAGGAGGAGGGACTGG - Intergenic
1110239832 13:73254795-73254817 TGAGCCCCAGGAGGCTGGAGAGG - Intergenic
1111396156 13:87672135-87672157 GGAGCCAGAGGAGGCTGGAGGGG + Intergenic
1112743873 13:102505649-102505671 AGAGCCCTAGGAAGTAGGACAGG - Intergenic
1112943025 13:104889871-104889893 GAAGCCCTGGGAGTCGGGAGTGG + Intergenic
1113433326 13:110268886-110268908 GGAACCCAAGGAGGAGGGAGTGG + Intronic
1113864577 13:113512629-113512651 GGAGCCCCAGGTGCTGGGACTGG + Intronic
1113864605 13:113512765-113512787 GGAGCCCCAGGTGCTGGGACTGG + Intronic
1113864622 13:113512833-113512855 GGAGCCCCAGGTGCTGGGACTGG + Intronic
1116789699 14:49327366-49327388 GGAGGCCTAGGAGGAGGCCCAGG + Intergenic
1119367488 14:74106508-74106530 GGAGGCCAAGGAGGGAGGACTGG - Intronic
1119617306 14:76107359-76107381 GGCGCCCTAGGATGGGGGAGGGG + Intergenic
1121947401 14:98136370-98136392 GGAGCCCAGGGAGCTGGGACAGG - Intergenic
1122145071 14:99684159-99684181 GGAGCTCTGGGGGGCGGGGCGGG + Intergenic
1122280229 14:100617847-100617869 GGAGACCTGGCAGGCTGGACTGG + Intergenic
1122688762 14:103521945-103521967 GCCGCCCTGGGAGGCGAGACGGG + Exonic
1122885479 14:104708575-104708597 GGAGCCCAAGGAGGTGGGGACGG + Exonic
1123034431 14:105466192-105466214 GAAGCCCTGGGGTGCGGGACTGG + Intronic
1123108838 14:105855850-105855872 GGAGCCGAAGGGGGCGGGAGTGG - Intergenic
1123706221 15:22953058-22953080 AGAGCCCTTGGAAGCGGGCCGGG - Intronic
1124817297 15:33007560-33007582 GGAGCCCTAGGAGGTGGAGGAGG - Intronic
1125518965 15:40337839-40337861 GGAGCCCCCGGAGGCGGGCTGGG - Exonic
1125752119 15:42036373-42036395 GGAGCCCCAGGAGGGGGAACTGG + Intronic
1126100018 15:45113281-45113303 GGATCCCTGGGAGGTGGGGCGGG - Intronic
1127260535 15:57323620-57323642 GGCTCCCAGGGAGGCGGGACTGG + Intergenic
1130379180 15:83357244-83357266 GCAGCCCCAGGAGGCAGGCCTGG + Intergenic
1131094322 15:89646205-89646227 GGAGCCAAAGCAGGCGGGAGGGG - Intronic
1131829534 15:96345215-96345237 GGAGCCCCAGGAGGATGGGCAGG - Intergenic
1132090703 15:98946179-98946201 AGAGCACTAGGAAGCGGGGCGGG + Intronic
1132502907 16:292528-292550 GGAGGCCCGGGAGGCGGGCCTGG + Intronic
1132575187 16:660841-660863 GGAGCGCCAGGAGGCGCTACCGG - Intronic
1132580701 16:683502-683524 GCAGCCCTAGGCGGCGGTAGGGG - Intronic
1132728415 16:1348774-1348796 GGAGCCCAAGGAAGCGGGCAGGG - Exonic
1132757744 16:1494108-1494130 GGAGGGGAAGGAGGCGGGACAGG + Intronic
1132856545 16:2047626-2047648 GGAGCCGCAGGAGGCGGCCCGGG + Exonic
1133119684 16:3598414-3598436 GGAGCCCTTGCAGGAGGGAAGGG - Intronic
1133239012 16:4403728-4403750 GGACCCCCAGGAGGAGGGCCTGG + Intronic
1134297793 16:12962205-12962227 ACAGCCCTAGGAGGCAGGAAGGG + Intronic
1136544835 16:30949092-30949114 GGAGCCCCAGGAGCCGGAGCGGG - Exonic
1137491561 16:48937365-48937387 GGAGGCAGAGGAGGCAGGACTGG + Intergenic
1139924631 16:70479370-70479392 GGAGGCCTTGGAGGCGGTGCTGG + Exonic
1140035767 16:71370230-71370252 GGGGCCCTAGGAGGAGAGGCTGG + Intronic
1141482945 16:84318760-84318782 GGAGGCCTAGGAGGTGCGAGCGG + Intronic
1143722060 17:8819301-8819323 GGGGCCCAAGGAGGAGTGACAGG - Intronic
1144794333 17:17880954-17880976 GGAACCTGAGGAGGCGGGAGTGG - Intronic
1145846345 17:28042020-28042042 GGAGCCCCGGGAGGCGGGCGGGG - Intronic
1146176346 17:30668334-30668356 GAAGCCCAAGGAGGTGGCACGGG + Intergenic
1146349806 17:32084448-32084470 GAAGCCCAAGGAGGTGGCACGGG + Intergenic
1146911921 17:36653794-36653816 GGAGCCCAAGGAAGCTGGGCAGG + Intergenic
1147155641 17:38543365-38543387 GGAGCCCTGGGAAGAGGGAGAGG + Intronic
1147723512 17:42553067-42553089 GGAGCCCTTGGAGGCCAGAAGGG + Intronic
1147864173 17:43542112-43542134 GGAGCCCTTGGAGGAGGGTTGGG + Intronic
1148388442 17:47253482-47253504 GGTCTCCCAGGAGGCGGGACTGG + Intergenic
1148766026 17:50038653-50038675 AGGGCCCTAGGAGTGGGGACAGG - Intergenic
1149182079 17:53951237-53951259 GGAACCCTGGGAAGTGGGACTGG - Intergenic
1149300793 17:55303262-55303284 GCAGCCCTGGGAGGAGGGACTGG + Intronic
1149993118 17:61393726-61393748 GGTGCCCTGGCAGGAGGGACTGG - Intergenic
1150788307 17:68180129-68180151 GGAGCCCACGGCGGCGGGGCGGG - Intergenic
1151611359 17:75177744-75177766 GGAGGCCGAGGTGGCGAGACGGG + Intergenic
1152272416 17:79332412-79332434 GGAGCCCTAGGATGCTGGAGAGG + Intronic
1156338097 18:36187447-36187469 GGAGGCCTGGGAGGCGTGGCGGG + Intergenic
1157301561 18:46483437-46483459 GGAGGCCTAGAAGGCAGGAAGGG - Intronic
1157856875 18:51111927-51111949 GGAGCCCACGGTGGCGGGGCGGG + Intergenic
1158721717 18:59931183-59931205 GGAGCCCCAGAAGGCGGGTCAGG - Intergenic
1160242366 18:77132824-77132846 GAAGCCCGGGGAGGCGGGGCCGG - Intronic
1160823096 19:1067367-1067389 GGAGCCCGAGGGGGCGGGCTGGG - Intronic
1160976945 19:1797270-1797292 GGGTCCCTGGGAGACGGGACGGG - Intronic
1162032524 19:7923642-7923664 GGATCCCTAGAAGGCGGGGAGGG + Intergenic
1162790827 19:13061987-13062009 GGAGCCCTAAGAGCCTGGGCAGG - Intronic
1162982479 19:14248563-14248585 GCAGCCCAAGGAGGTGGCACGGG - Intergenic
1163772512 19:19199390-19199412 GGAGCCCCAGGAGCCAGGACTGG - Intronic
1164630931 19:29761053-29761075 GGAGGCCGAGGAGGGGGGGCGGG - Intergenic
1165151530 19:33763518-33763540 GCTGCCCTAGGACACGGGACAGG - Intronic
1165346960 19:35254534-35254556 GGAGCCCGAGGAGGTGGAACAGG - Intronic
1165408676 19:35645161-35645183 GGGGCCTAAGGGGGCGGGACCGG - Intergenic
1166044719 19:40223240-40223262 GGAGGCCGAGGCGGCGGGATGGG - Exonic
1166144537 19:40825017-40825039 TCAGACCTGGGAGGCGGGACTGG + Intronic
1166205092 19:41264452-41264474 AGAGCCCTGGGAGGCCGGGCCGG + Exonic
1166290494 19:41860389-41860411 GCGGCTCTAGGGGGCGGGACGGG - Intronic
1166894517 19:46015496-46015518 GGAGCCTAAGGGGGCGGGGCGGG + Intronic
1167125459 19:47545584-47545606 GGACCCCGATGAGGCGGGGCAGG + Exonic
1167679234 19:50909331-50909353 GCAGCCCTGGCAGGCGGCACTGG - Exonic
1168169633 19:54576802-54576824 GGAGCCCGGGGAGGTGGGGCTGG + Intronic
927553104 2:24016052-24016074 GGAGGCCTGGGAACCGGGACCGG - Intronic
928669397 2:33585311-33585333 GGAGGCCGAGGAGGAGGGAGAGG - Exonic
929070093 2:38020787-38020809 GGAGCCCAAGGAGGCGGGGGAGG - Intronic
933487219 2:82938526-82938548 GGAGCCCACGGAGGCGGAGCGGG + Intergenic
934586975 2:95509107-95509129 GGAGGCCTAGGTGGCTTGACTGG - Intergenic
935204609 2:100887110-100887132 TGAGCCCTAGGAAGCAGGACTGG + Intronic
937118615 2:119427007-119427029 GGAGCCCTAGCTGGAGGGAAAGG + Intergenic
937857921 2:126686061-126686083 GGAGCCATAGGAGATGGGCCGGG + Intronic
938296384 2:130182067-130182089 GGCGCTCTAGGAGCCGGGAGTGG - Exonic
938421063 2:131147279-131147301 GGAGCCCCAGAGGGCAGGACGGG - Exonic
941580721 2:167293184-167293206 GGAGCACGAGGAGGCGGGGGCGG + Intergenic
944062873 2:195587989-195588011 GGAGGCCAAGGAGGCTGGATCGG + Intronic
945534026 2:210989602-210989624 GGAGGCCTAGGAGGGAAGACTGG + Intergenic
946412807 2:219523384-219523406 GGAGCCCTAGGAGCCAGGGAGGG - Intronic
1168766947 20:388232-388254 GGAGCCCGAGGAGGGCGGGCGGG + Exonic
1168806815 20:676493-676515 GGAGCCCGAGCAGGGGGGAGGGG - Intergenic
1169117174 20:3073039-3073061 GGAGCCCAAGCTGCCGGGACTGG + Intergenic
1171347681 20:24478305-24478327 GGAGCCCTAGGAGGGAGGGGTGG + Intronic
1172650241 20:36497402-36497424 TGACCCGTGGGAGGCGGGACTGG + Intronic
1173101384 20:40091892-40091914 GGAGCCCTAGGAGGGGAGAATGG - Intergenic
1173622362 20:44446220-44446242 GGAGCCCAAGGGGGCTGGAATGG - Intergenic
1176145481 20:63563497-63563519 GGAGCCGTAGGGGACGGGGCAGG + Exonic
1178534898 21:33403334-33403356 GGTGGCCTCGGGGGCGGGACGGG + Exonic
1179617947 21:42593805-42593827 GGAGCCCTGGGAGGAGGGGGTGG - Intergenic
1180235841 21:46458994-46459016 GGAGCGGGAGGCGGCGGGACAGG - Intronic
1180841836 22:18962506-18962528 GGAGGCCTAGGGTGAGGGACTGG + Intergenic
1181059668 22:20276358-20276380 GGAGGCCTAGGGTGAGGGACTGG - Intronic
1181626547 22:24125900-24125922 GGTGCCAGAGGAGGTGGGACAGG + Intronic
1183354436 22:37350768-37350790 GGGCCGCTGGGAGGCGGGACAGG + Intergenic
1183539109 22:38419391-38419413 GGAGCCCCAGGAGGCCAGAGGGG + Intergenic
1184727627 22:46355953-46355975 GGGGCCCTTGGAGGGGGCACAGG - Intronic
1184863266 22:47188918-47188940 GGAGCCTGAGGAGGAGGGGCTGG + Intergenic
1185211609 22:49573639-49573661 GGAGCCCCAGGAGCTGGGAGGGG + Intronic
1185270976 22:49929263-49929285 GGAGTCCTCGGAGGGGGGTCGGG + Intergenic
953099273 3:39809522-39809544 GGAGCCTGCGGAGGCGGGGCGGG - Intronic
954246940 3:49339696-49339718 GGAGCCCTAGGGGGCGGGCCCGG - Intronic
954560221 3:51550178-51550200 GGACCCTTAGGAGGCAGCACAGG - Intronic
954876103 3:53804121-53804143 GGAGGCGTAGCAGGCGGCACAGG + Intronic
955775250 3:62425909-62425931 GGTGCCCCAGGAGGCAGGACTGG - Intronic
957917035 3:86698584-86698606 GGAGTCCTAGAAGGGAGGACTGG - Intergenic
960704085 3:120465113-120465135 GCAGCCCCAGAAGGGGGGACTGG + Intergenic
961211411 3:125128831-125128853 GGACGCCTAGGAGGGGGGAATGG + Intronic
962390661 3:134969447-134969469 GGAGCCCTGGGAGGCAGGTGTGG + Intronic
962390941 3:134972146-134972168 GGAGCCCTGGGAGGCAGGTGTGG - Intronic
962400710 3:135056745-135056767 GGAGCCCTCGCAGACGAGACAGG + Intronic
962445055 3:135456454-135456476 GGATCCCTGGGAAGGGGGACAGG + Intergenic
964974210 3:162599979-162600001 GGAGACCACGGAGGCGGGAGGGG - Intergenic
968505267 4:968437-968459 GGAGCCCTGGGGGGTGGGGCGGG - Intronic
968835912 4:2964008-2964030 GGAGACTGAGGAGGCGGAACAGG - Exonic
969460699 4:7327284-7327306 GGAGCCACCGGAGGTGGGACAGG - Intronic
971193227 4:24447391-24447413 GGAGCCCAGGGATGCGGCACTGG + Intergenic
972314956 4:37917573-37917595 GGAGCCATGGGAGGCCGCACAGG + Intronic
985635110 5:1032066-1032088 GGAGCTCTGGGCGGCTGGACTGG - Intronic
985704487 5:1392502-1392524 GGAGCCTGGGGAGGGGGGACAGG + Intergenic
987216612 5:15744029-15744051 GGAGGCCTAGGAGGCAGAAATGG - Intronic
988688531 5:33549224-33549246 GGAGCCCTGTGAGGCGTGGCAGG - Exonic
992089217 5:73303078-73303100 GGACTCCAAGGAGCCGGGACTGG + Intergenic
992370936 5:76143420-76143442 GGAGCCCTAGTAACAGGGACAGG + Intronic
994195930 5:96923205-96923227 TGAGCCCAAGGCGGCAGGACGGG - Intronic
998142529 5:139708352-139708374 GGAGACCTGGGAGGAGGGGCTGG - Intergenic
998337958 5:141390034-141390056 GCAGCTCCAGGAGGCGGGGCTGG - Exonic
998376386 5:141693599-141693621 TGAGGCCTAGTAGGTGGGACGGG + Intergenic
999323406 5:150628312-150628334 GCAACCCTGGGAGGCTGGACAGG - Intronic
1000153718 5:158529683-158529705 GGAGCCCCAGGAGGTGGAGCAGG + Intergenic
1001087459 5:168711053-168711075 AGCGCCCTAGGAGGCAGAACAGG + Exonic
1001159471 5:169300763-169300785 GGAGCCCGAGGAGGCGCGCGGGG + Exonic
1001735397 5:173994405-173994427 GGAGAACTAGGAGGTGGGAGCGG - Intronic
1002071610 5:176681716-176681738 CCGGCCCTGGGAGGCGGGACAGG - Intergenic
1002205347 5:177559371-177559393 GGAGCCCTATGTGGTGGCACAGG - Intergenic
1002284647 5:178154095-178154117 GGAGCCCTGGGAATCGGGGCCGG + Intergenic
1002603366 5:180368001-180368023 GGAGCCCTCATAGGCTGGACAGG + Intergenic
1004199170 6:13532100-13532122 GCAGCCCTAGAAGGTGGGAGTGG - Intergenic
1005040476 6:21595694-21595716 GGAGCCCGAGGAGGAGGAAGAGG - Exonic
1006302335 6:33200266-33200288 GGAGCCAGGGGAGGCTGGACGGG - Exonic
1011178148 6:84587665-84587687 GGAGCCCACGGAGGCGGGGGAGG - Intergenic
1018090137 6:160339209-160339231 GCAGACCTGGGAGGCGGGGCTGG + Intergenic
1019143359 6:169962016-169962038 GCAGCCCCAGGAGGAGGGACGGG + Intergenic
1019527509 7:1487373-1487395 GGTGCCCGAGGCGGAGGGACTGG + Exonic
1020275431 7:6621927-6621949 GGAGCCCGAGGAGGAGGAAGAGG + Exonic
1023033268 7:36109238-36109260 GGAGCCCAAGGAGATGGGGCAGG - Intergenic
1023037725 7:36147799-36147821 GGAGCCCAAGGAGATGGGGCAGG + Intergenic
1024006909 7:45231354-45231376 AGGGCCCTAGGTGGAGGGACTGG - Intergenic
1025721535 7:64020300-64020322 GGAGCCCTAGGAGGCAACAATGG + Intergenic
1026408876 7:70098418-70098440 GGAGTCCTAGGAGGGGAGAGTGG + Intronic
1029374648 7:100170390-100170412 GGAGGCCGAGGAGGCCGGGCTGG + Exonic
1030121146 7:106112073-106112095 GGCGCCCTAGGCGGGGAGACGGG - Intronic
1031317219 7:120273113-120273135 GGAGCCCGAGGGGGCGGGGGCGG + Intergenic
1033610716 7:142961277-142961299 GAAGCCCCAGGAGCAGGGACTGG + Intronic
1035125800 7:156607299-156607321 GGAGCCCTGGAAGGTGGGCCTGG - Intergenic
1035259621 7:157653130-157653152 GGAGCCCCAGCAGGTGGGAGAGG - Intronic
1038266741 8:26044157-26044179 GGAGCTCTGGGAGGGGGGACAGG - Intronic
1039911965 8:41833250-41833272 GGAGACCTGGGAGGCTGGGCTGG - Intronic
1040014513 8:42689790-42689812 GGAGCCCACGGAGGCGGGGTGGG - Intergenic
1040072046 8:43196413-43196435 GCAGCACTAGGAAGAGGGACCGG - Intronic
1040481526 8:47831665-47831687 GGAGCCCCAGGAGGCTGGTTTGG + Intronic
1044722964 8:95168510-95168532 TGAGCCCAAGGAGGCAGGAAAGG + Intergenic
1049241423 8:141539272-141539294 GGAGCTGAAGGTGGCGGGACAGG + Intergenic
1049284453 8:141767068-141767090 AGTGCCCTAGGAGGCCGGAGGGG + Intergenic
1049404252 8:142444610-142444632 AGAGCCCTGGGTGGAGGGACTGG + Intergenic
1049574421 8:143383784-143383806 GCAGCCCTGGGAGGCGGCACGGG + Exonic
1052048589 9:23821879-23821901 AGAGCGCCAGGAGGCGGGGCCGG + Intronic
1052785105 9:32820870-32820892 GGAGCCTTAGGATGCTGGAGTGG + Intergenic
1053444075 9:38137985-38138007 GGAGCCATAGGAGGCAGGGAGGG + Intergenic
1056793414 9:89640474-89640496 GGAGCCCGGGGAGGCTGAACAGG - Intergenic
1060237255 9:121873606-121873628 GGAGGAGGAGGAGGCGGGACTGG - Intronic
1061016047 9:127981182-127981204 CCCGCCCTAGGAGGCGGGCCCGG - Intergenic
1061022797 9:128027089-128027111 CGAGCCCTGGGAGGAGGGAAGGG - Intergenic
1061181761 9:129028461-129028483 GGAGTCGGAGGGGGCGGGACTGG + Intergenic
1061367220 9:130178344-130178366 GGAGCCCAAGGAGGCAGAAAGGG - Intronic
1061773441 9:132944923-132944945 AGAGCCCGAGGGGGCGGGGCGGG + Intergenic
1061820795 9:133226314-133226336 GGAGCTCTGGGAGGCTGGAAGGG - Intergenic
1062173395 9:135147777-135147799 GGAGCCCTAGGAGGGGCTCCAGG + Intergenic
1062341299 9:136094969-136094991 GGAGCCCGCGGAGGGGGGCCGGG - Intronic
1185543924 X:926549-926571 GGAGCCCCAGGAGCTGGGAGAGG - Intergenic
1190358507 X:49627482-49627504 GGTGCCCAAGGAGCTGGGACTGG - Intergenic
1191599842 X:62990943-62990965 GGAGCCCTGGGAGGGGGTAGCGG + Intergenic
1195256337 X:103094354-103094376 GGAGCCCACGGAGGCGGGGGTGG - Intergenic
1197331145 X:125155552-125155574 GGAGCCCACGGAGGCGGGCGGGG + Intergenic
1200039530 X:153355468-153355490 GGAGCCCAGGGAGGAGGGAGGGG - Intronic
1200149258 X:153943321-153943343 GGAGCCCAGGGAGGAGGGAAGGG + Intronic