ID: 900094917

View in Genome Browser
Species Human (GRCh38)
Location 1:936394-936416
Sequence GTCCAGGAGCCCTAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 5, 1: 0, 2: 1, 3: 37, 4: 353}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900094917_900094938 22 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094938 1:936439-936461 CGCCTTCTAGGGCTCCGGGAAGG 0: 1
1: 0
2: 6
3: 12
4: 107
900094917_900094941 27 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094941 1:936444-936466 TCTAGGGCTCCGGGAAGGATGGG 0: 1
1: 0
2: 1
3: 16
4: 118
900094917_900094942 28 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094942 1:936445-936467 CTAGGGCTCCGGGAAGGATGGGG 0: 1
1: 0
2: 3
3: 22
4: 206
900094917_900094934 17 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094934 1:936434-936456 GGTCCCGCCTTCTAGGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 112
900094917_900094935 18 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094935 1:936435-936457 GTCCCGCCTTCTAGGGCTCCGGG 0: 1
1: 5
2: 1
3: 10
4: 108
900094917_900094926 -8 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094926 1:936409-936431 TCCTGGACGGAGGGGGTCCCCGG 0: 2
1: 3
2: 1
3: 23
4: 380
900094917_900094928 -4 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094928 1:936413-936435 GGACGGAGGGGGTCCCCGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 143
900094917_900094931 10 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094931 1:936427-936449 CCCGGTCGGTCCCGCCTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 57
900094917_900094933 11 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094917_900094940 26 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094940 1:936443-936465 TTCTAGGGCTCCGGGAAGGATGG 0: 1
1: 0
2: 1
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900094917 Original CRISPR GTCCAGGAGCCCTAGGAGGC GGG (reversed) Intronic
900094852 1:936238-936260 GTCCAGGAGCCCTAGGAGGCGGG - Intronic
900094868 1:936277-936299 GTCCAGGAGCCCTAGGAGGCGGG - Intronic
900094885 1:936316-936338 GTCCAGGAGCCCTAGGAGGCGGG - Intronic
900094901 1:936355-936377 GTCCAGGAGCCCTAGGAGGCGGG - Intronic
900094917 1:936394-936416 GTCCAGGAGCCCTAGGAGGCGGG - Intronic
900094936 1:936437-936459 TTCCCGGAGCCCTAGAAGGCGGG - Intronic
900475698 1:2875415-2875437 GTCCAGGAGCCCCTGGAGGATGG + Intergenic
901475606 1:9487187-9487209 TTACAGGAGGCCTAGGATGCTGG - Intergenic
902290968 1:15434525-15434547 TTCCAACAGCCCTAGGAGGGAGG + Intergenic
902336542 1:15757955-15757977 CTCCAGGAGCTCTGGAAGGCAGG - Intronic
903066965 1:20705014-20705036 GCACAGGAGCCCCAGGAAGCAGG + Intronic
903273586 1:22207281-22207303 GTCGATGAGCCCTAGGATCCTGG - Intergenic
903767240 1:25742647-25742669 TCCCAGGAGCCTTATGAGGCAGG + Intronic
904279543 1:29409289-29409311 CTCCAGGGGCCAAAGGAGGCAGG - Intergenic
904282069 1:29427605-29427627 GGCCAGGAGGCCTGTGAGGCTGG - Intergenic
904379622 1:30102014-30102036 GTCCAGGAGGCCCAGCAAGCAGG + Intergenic
904563413 1:31413434-31413456 GTCCAGGAGGGCGAGCAGGCGGG - Intronic
904598740 1:31662421-31662443 GTGCGGGAGCCCTAGGAGGTGGG + Intronic
905792195 1:40795938-40795960 TTCCAAGAGCCCTATGAGGTAGG + Intronic
906144173 1:43550243-43550265 GCCCAAGAGCCGTGGGAGGCTGG - Intronic
906461046 1:46035313-46035335 GTCCAGAGACCCTAGGAGCCTGG + Exonic
908888630 1:68817993-68818015 GCACAGGAGCCCACGGAGGCAGG - Intergenic
909904146 1:81175431-81175453 GCTCAGGACCCCAAGGAGGCAGG + Intergenic
911165376 1:94720069-94720091 GCCCGGGAGCCCTGGGAAGCTGG - Intergenic
912417094 1:109516769-109516791 GGCCTGGAGCCCCAGAAGGCAGG - Intergenic
915135555 1:153728714-153728736 GAGCAGGAGCCCCAGGAGGGGGG + Exonic
915618970 1:157067249-157067271 GTCCAGGAGGGCAAGGTGGCTGG - Intergenic
915745037 1:158149438-158149460 TTCCAGCAGCGATAGGAGGCAGG + Intergenic
916219905 1:162433433-162433455 GCACAGGAGCCCACGGAGGCGGG - Intergenic
917580817 1:176376168-176376190 TTTCAGGAGCCCTAGGAGGATGG + Intergenic
918659724 1:187073895-187073917 GCACAGGAGCCCACGGAGGCTGG + Intergenic
918993924 1:191732052-191732074 GCACAGGAGCCCACGGAGGCTGG - Intergenic
919091944 1:192987191-192987213 GCACAGGAGCCCACGGAGGCGGG - Intergenic
920864610 1:209741474-209741496 CTCCAGGTGCCCAAGGAGCCAGG - Intergenic
922056866 1:222050027-222050049 GCACAGGAGCCCACGGAGGCGGG - Intergenic
922306940 1:224352598-224352620 GTACAGGAGCCCACGGAGGTCGG + Intergenic
922855832 1:228773985-228774007 GCACAGGAGCCCACGGAGGCGGG - Intergenic
922887618 1:229032042-229032064 GTCCTGGAGCCCCCAGAGGCTGG + Intergenic
924807257 1:247371470-247371492 ATCCAGAAGCCCTAGAATGCGGG + Intergenic
924807265 1:247371513-247371535 ATCCAGAAGCCCTAGAATGCGGG + Intergenic
1062883150 10:995014-995036 GTGCAGGAGACCCAGGAGGTGGG + Intronic
1062910339 10:1208240-1208262 CCACAGCAGCCCTAGGAGGCTGG - Intronic
1063243640 10:4195741-4195763 GGCCAGGAGCTCAAGGAGCCAGG + Intergenic
1064353776 10:14600238-14600260 GGCCAGTAGCCCTGGGAAGCCGG - Intronic
1065512631 10:26494286-26494308 GGCCAGGGGCCCTAAGTGGCAGG + Intronic
1067656716 10:48197934-48197956 GTCAAGCAGCCCCAGGAGGCAGG - Intronic
1067712347 10:48659020-48659042 GTGCAGGAGCCACAGGAGGCTGG - Intergenic
1070712642 10:78693907-78693929 GTCCTGGAGCCCTGGGATGGGGG + Intergenic
1070728289 10:78807482-78807504 GGCTAGGAGCCCTTGAAGGCAGG - Intergenic
1070751900 10:78968773-78968795 GGTCTGGAGCCCTAGGAGCCAGG + Intergenic
1070810241 10:79293855-79293877 CTCAAGCAGCCCTAGGAGGCAGG - Intronic
1070968348 10:80543495-80543517 GCACAGGAGCCCACGGAGGCAGG - Intronic
1072336598 10:94403238-94403260 GCCCAGGAGCCCGAGGGCGCGGG + Exonic
1074382151 10:112990108-112990130 GTGCAGGAGTCCTGAGAGGCAGG - Intronic
1074996303 10:118760226-118760248 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1075200952 10:120403503-120403525 GTTCAGGCGTCATAGGAGGCCGG - Intergenic
1075592464 10:123702835-123702857 ACCCAGGAGACCTAGAAGGCTGG - Intergenic
1076010618 10:126985329-126985351 TACCAGCAGCCCTATGAGGCAGG + Intronic
1076659102 10:132043646-132043668 GTCCAGGAGCCCGTGGACACAGG + Intergenic
1076799100 10:132812450-132812472 GCCCAGGAGCCCAGGAAGGCTGG - Intronic
1077177381 11:1196943-1196965 GTCCAAGAGCCCGAGGAGGGAGG + Intronic
1077805803 11:5590160-5590182 GCACAGGAGCCCATGGAGGCGGG - Intronic
1077888610 11:6403534-6403556 GTCCAGGTGAGCTAGGAGGAGGG + Exonic
1081412264 11:42773862-42773884 GGGCAGGAGCCCCAGGAGGCAGG - Intergenic
1081855405 11:46300196-46300218 GCCCAGGAGGCCCAGGAGGGAGG + Intronic
1083442887 11:62688473-62688495 GGCCAGGAGCCACAGAAGGCAGG + Exonic
1083684453 11:64368239-64368261 GGCCAGGAGCGCTATGATGCAGG + Exonic
1083799548 11:65038640-65038662 GACCAGGAACCCTGGGAGCCAGG + Exonic
1084044109 11:66559373-66559395 GCCCAGGAGCTCAAGTAGGCGGG + Exonic
1084112003 11:67020292-67020314 GGCCAGAAGGCCCAGGAGGCAGG + Intronic
1084652406 11:70496842-70496864 GTCCAGGAGAACCACGAGGCGGG + Intronic
1084794060 11:71492344-71492366 GTCCTGGTGACCTAAGAGGCTGG - Intronic
1085387864 11:76167513-76167535 GTCGAGGAGCCTGAGGAGGGCGG + Intergenic
1085636142 11:78160848-78160870 GATCAGGAGCACTAGGAGGTTGG + Intergenic
1085709245 11:78814139-78814161 CTCCAGAAGCCCTTGGAGGGAGG - Intronic
1089466366 11:118689054-118689076 GCACAGGAGCCCAGGGAGGCGGG + Intergenic
1089581424 11:119483970-119483992 GTCCTAGAGCCGCAGGAGGCGGG - Intergenic
1091655715 12:2345349-2345371 GTCCAGGAGCCCTGGAAGGAGGG + Intronic
1091670887 12:2451569-2451591 GAACAGGAGCCCTGGGAGGGAGG + Intronic
1091887480 12:4027180-4027202 TGCCAGGGGCCATAGGAGGCAGG + Intergenic
1093524755 12:20093400-20093422 GTGCAGGAGCCCACGGCGGCTGG + Intergenic
1101672481 12:106888893-106888915 GCCCAGTAGTCCTGGGAGGCAGG + Intronic
1102269958 12:111525238-111525260 GACCTGGAGCCCTGGGATGCAGG - Exonic
1102912343 12:116726572-116726594 GTGCAGGAGCCCTGGGAGTATGG + Intronic
1103146106 12:118597255-118597277 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1103459629 12:121093614-121093636 GTGCAGGAGCCCACGGGGGCGGG + Intergenic
1104894238 12:132153966-132153988 CCCCAGGAGCCCAAGGAGGGCGG - Intergenic
1105538459 13:21292696-21292718 GTCCATGAGCTCAAGGATGCAGG - Intergenic
1106231400 13:27823891-27823913 GTACAGCAGCCCTATGAGACTGG - Intergenic
1108508857 13:51136753-51136775 GGCCAGGACCCCCAGGAGCCTGG + Intergenic
1110654961 13:77987035-77987057 GTCCTGAAGCAGTAGGAGGCAGG - Intergenic
1111865365 13:93761591-93761613 GTCTAGGAGCTCTAGGTTGCAGG - Intronic
1113893726 13:113749760-113749782 TTCCAGGAGCACTTGGGGGCTGG - Intergenic
1116852518 14:49922603-49922625 GTCCAGGAGGCTGAGGTGGCAGG + Intergenic
1117301026 14:54428233-54428255 TTCAAGGAGTCCTAGAAGGCAGG + Intronic
1118844039 14:69533033-69533055 GTCCAGGAGTCCTGGGGGGTGGG + Intergenic
1119300281 14:73566412-73566434 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1119328273 14:73775154-73775176 GTCCAGGAGCAGCAAGAGGCCGG + Intronic
1121711171 14:96039858-96039880 GTCCCGGAGCCCTCCAAGGCCGG + Intronic
1122262251 14:100530334-100530356 GTCCAGCAGGCCTGGGAGGAGGG - Intergenic
1122520716 14:102341669-102341691 GTCCAGGCCCCCCAGGCGGCAGG - Exonic
1122691386 14:103533545-103533567 GAGCAGGAAGCCTAGGAGGCAGG - Intronic
1122878703 14:104680339-104680361 GTCCAGCAGCCCTAGGAGGTGGG + Intergenic
1123016145 14:105376667-105376689 CTGCAGGAGCAATAGGAGGCGGG - Intronic
1123161675 14:106284573-106284595 GACCAGGAGCCACAGGAAGCAGG - Intergenic
1202915314 14_GL000194v1_random:165332-165354 GTCCAGGAGACCTAGCAGAGAGG - Intergenic
1124215691 15:27805805-27805827 GTCCAGGAGACCCAGGCGGCGGG + Intronic
1124800852 15:32831507-32831529 CTCAAGGAGCCCCAGGAGCCAGG + Intronic
1125585231 15:40814896-40814918 GGACAGGAGCCCTAGGAGCTGGG - Exonic
1125601888 15:40919824-40919846 GGCCAGGAGAGCAAGGAGGCAGG + Intergenic
1125755105 15:42058143-42058165 GTCCAGCAGCCCTAGGAGAGAGG - Intergenic
1128570434 15:68729709-68729731 GACCTGGAGCCCTTGGAGGCTGG + Intergenic
1130773561 15:86951173-86951195 GTCCAGGAGTACAATGAGGCAGG - Intronic
1131248834 15:90817959-90817981 CTCCCGCAGCCCTGGGAGGCAGG + Intergenic
1131798945 15:96049651-96049673 ATCCAGGAGCCCTGACAGGCAGG + Intergenic
1132299882 15:100768838-100768860 GTCCAGGAGCCAGAGGTGCCAGG + Intergenic
1133201531 16:4207093-4207115 GCCACGGAGCCCCAGGAGGCTGG - Intronic
1134018903 16:10907929-10907951 GCCCACGAGGCCGAGGAGGCTGG + Exonic
1134832110 16:17332070-17332092 ATCCAGGGGCCATGGGAGGCAGG - Intronic
1137315599 16:47317866-47317888 GTCCTGGAGTCCCAAGAGGCTGG - Intronic
1138194919 16:55044883-55044905 GCCAAGGAGACCAAGGAGGCAGG + Intergenic
1138229362 16:55326072-55326094 GCCCCAGAGCCCCAGGAGGCCGG - Intronic
1138417798 16:56881155-56881177 GCCCATGAGCCCAGGGAGGCTGG - Intronic
1139147774 16:64344175-64344197 GCACAGGAGCCCACGGAGGCGGG - Intergenic
1139489257 16:67278025-67278047 CCCCAGGAGCCCTAAGAGCCGGG - Exonic
1139917711 16:70438699-70438721 GAGCGGGAGCCCTGGGAGGCTGG + Intronic
1139956916 16:70697588-70697610 GTCCCGGAGCCCCATGGGGCTGG + Intronic
1140929585 16:79614828-79614850 TTACAGGACCCCTAGGAGCCAGG - Intergenic
1141153230 16:81579156-81579178 CTGCAATAGCCCTAGGAGGCAGG - Intronic
1141602506 16:85135059-85135081 GTCCAGCAGCCCTGAAAGGCTGG - Intergenic
1141679566 16:85536371-85536393 ATCCAGAAGCTCCAGGAGGCAGG + Intergenic
1141708447 16:85683045-85683067 GTCCAGGACACCTGGAAGGCTGG - Intronic
1141973875 16:87501102-87501124 GGCTAGCAGCCCTTGGAGGCTGG - Intergenic
1142485418 17:244570-244592 GCCCCGGGGCCCTCGGAGGCAGG + Intronic
1143417571 17:6760803-6760825 GTCCAGGGAGACTAGGAGGCCGG + Intronic
1143643359 17:8212929-8212951 CTTCAGGAGCCCAAGGAGGGTGG + Intergenic
1144765225 17:17728897-17728919 CTGCAGGACCCCTGGGAGGCTGG + Intronic
1145752797 17:27367396-27367418 GGCCAGCAGCACTATGAGGCGGG + Intergenic
1145846348 17:28042025-28042047 GAACAGGAGCCCCGGGAGGCGGG - Intronic
1147261139 17:39210340-39210362 CTCCAGCAGCCCGAGGAGGGTGG - Intergenic
1148699395 17:49578729-49578751 GGCCAGCAGCCCTAGGAGAGTGG - Exonic
1149304499 17:55335049-55335071 GTGGAGGAGCACCAGGAGGCAGG - Intergenic
1150462909 17:65367550-65367572 GTCCATGTGCACCAGGAGGCAGG + Intergenic
1150626663 17:66845947-66845969 GTCTTGGAGCCCCAAGAGGCAGG - Intronic
1151184995 17:72357363-72357385 AACCAGAAGCCCTAGGGGGCAGG + Intergenic
1151526300 17:74671283-74671305 ATCCTGGAGTCCTAAGAGGCAGG + Intronic
1151658866 17:75508275-75508297 GCCCAGGAGCTCTAGGGGTCAGG + Exonic
1152018569 17:77768400-77768422 ATCCAGGAACCCTGGAAGGCTGG + Intergenic
1152698118 17:81806324-81806346 GTCCCGGATCCCTAGGGGTCAGG - Intronic
1152780468 17:82225574-82225596 GCCCAGGACCCCAGGGAGGCGGG + Intergenic
1152782237 17:82231517-82231539 GTCCAGGAGGCCTCGGAGGTGGG + Intronic
1153976017 18:10269041-10269063 GTCCAGGAACCCGAGCTGGCTGG - Intergenic
1154107370 18:11534222-11534244 GCCCAGGAGCGGTAGGAGGGCGG + Intergenic
1156299250 18:35821272-35821294 ATCCAGGAGCCAAAGGATGCTGG + Intergenic
1156399027 18:36724344-36724366 AACCAGCAGCCCCAGGAGGCAGG - Intronic
1157301563 18:46483442-46483464 GTTCAGGAGGCCTAGAAGGCAGG - Intronic
1159890096 18:73944929-73944951 TCCCAGTAACCCTAGGAGGCAGG - Intergenic
1160099164 18:75904394-75904416 GCCCAGGGGCCACAGGAGGCAGG + Intergenic
1160176583 18:76600209-76600231 GCACAGGAGCCCATGGAGGCGGG + Intergenic
1160823099 19:1067372-1067394 GGCCGGGAGCCCGAGGGGGCGGG - Intronic
1161306922 19:3573566-3573588 GTGCATGAGCCCGAGGAGGCAGG - Intronic
1162032521 19:7923637-7923659 CTCAAGGATCCCTAGAAGGCGGG + Intergenic
1162197601 19:8997704-8997726 TCCCTGGAGCCCTAGGAAGCTGG - Intergenic
1162457033 19:10791610-10791632 CTCCAGGGCCCCCAGGAGGCTGG + Intronic
1162895521 19:13762912-13762934 GTGCAGCAGCCCGAGGGGGCAGG + Exonic
1162948276 19:14056549-14056571 GTCTAGGAGCCCAAGGAGCCTGG - Intronic
1164558794 19:29274295-29274317 ATGCAGGAGCCCCAGGAGGGTGG + Intergenic
1164748149 19:30631059-30631081 CTCCAGGAGCCCTTGCAGGATGG - Intronic
1164835025 19:31350572-31350594 GTCCAGCAGCCCCGGCAGGCCGG - Intergenic
1165015414 19:32876694-32876716 GTCCAGGATGCCAAGGAGGGCGG - Intergenic
1165023246 19:32940681-32940703 ATCCAGGTACCCTAGGAAGCAGG + Intronic
1165113029 19:33513163-33513185 GTCCAGGCTCCCTACCAGGCAGG + Intronic
1165256487 19:34579658-34579680 GTCCAGGAGCTCTAGGGCCCTGG - Intergenic
1165846622 19:38821778-38821800 GTGCAGGAGCCCACGGCGGCGGG - Intronic
1165994947 19:39837457-39837479 GTACAGGAGACCTAGGAGATGGG + Intronic
1166776277 19:45314953-45314975 GTGCGGGAGGCCTAGGAGGGAGG - Intronic
1167124370 19:47539147-47539169 GACTAGGAGCCCTGGGAGGCAGG + Intronic
1167125277 19:47544946-47544968 CTCCAGGAGGCCCAGAAGGCAGG - Exonic
1167434335 19:49470384-49470406 GACCAGGAGGCCGAGGGGGCAGG + Exonic
1167724433 19:51200830-51200852 CTCCAGGAGCCACAGGAGCCAGG - Intergenic
1167758321 19:51427023-51427045 CTCCAGGAGCCACAGGAGCCAGG + Intergenic
1167799043 19:51728507-51728529 GTGCAGGACCCCGAGGAGCCAGG + Intergenic
1168324344 19:55530391-55530413 GCCCAGGACGCCAAGGAGGCCGG + Intronic
925293305 2:2762600-2762622 GTCCAAGAGCCCCAGGAGGAGGG + Intergenic
925305708 2:2846840-2846862 GTGCAGCAGCCCAGGGAGGCAGG + Intergenic
925696145 2:6581226-6581248 GGCAAGGCACCCTAGGAGGCAGG + Intergenic
925706931 2:6694611-6694633 TTCCAGGAGGCCTAGAAGACAGG + Intergenic
926229251 2:10990385-10990407 GCCCAGCAGCCCCAGGAGGCAGG + Intergenic
927517888 2:23682651-23682673 GTGCAGGAGCACGAGGGGGCAGG - Intronic
928856428 2:35808203-35808225 TTCCGTGAGCCCTGGGAGGCAGG - Intergenic
929053734 2:37858576-37858598 ATTCAGGAGCCTTGGGAGGCTGG - Intergenic
929070096 2:38020792-38020814 GCACAGGAGCCCAAGGAGGCGGG - Intronic
930845085 2:55895180-55895202 GTCTTGGAGCCCTGGGAGCCTGG - Intronic
931233531 2:60394339-60394361 ATCCAGGAGACCAAGTAGGCTGG + Intergenic
933758610 2:85659816-85659838 GGCCGGGAGCCCTAGGAGCTGGG + Intronic
933775114 2:85767009-85767031 GACAAGGGGCCCCAGGAGGCAGG - Intronic
934857404 2:97737880-97737902 GGCCAGAAGCCCTACAAGGCAGG + Exonic
934898531 2:98139284-98139306 GCACAGGAGCCCACGGAGGCGGG - Intronic
937968335 2:127531473-127531495 GCCCAGGTGCCATTGGAGGCTGG - Intergenic
939275161 2:139990772-139990794 GCACAGGAGCCCACGGAGGCGGG + Intergenic
940862252 2:158782959-158782981 TTCCAGGAGGCCTCGGTGGCTGG - Intergenic
942299561 2:174548670-174548692 GCGCAGGAGCCCATGGAGGCCGG + Intergenic
945154619 2:206825557-206825579 GTCCAGGATCCCTTGCAGGTAGG - Intergenic
946692156 2:222318458-222318480 TTCCAGGACCGCTAGGAAGCAGG + Intergenic
947606334 2:231488462-231488484 GTCCTTGAGCCCTTGAAGGCAGG + Intergenic
948932560 2:241141514-241141536 GCCCAGGTGCCCGAGGAGGGTGG - Intronic
1168766943 20:388227-388249 CTCCTGGAGCCCGAGGAGGGCGG + Exonic
1168951139 20:1803102-1803124 TCCCAGCAGCCCTTGGAGGCAGG - Intergenic
1169375747 20:5065626-5065648 GTCCAGGACACCTGGGAAGCTGG - Intergenic
1172601352 20:36185703-36185725 GTATAGGAACCCTAGCAGGCTGG - Intronic
1173057755 20:39632697-39632719 GTCCAGAAGTCCTAGGACACTGG + Intergenic
1173243306 20:41317207-41317229 GTCCAGGGGTCCTAGGGGTCAGG - Intronic
1174390994 20:50218143-50218165 GTCCTGGGGCCCAATGAGGCAGG + Intergenic
1174562181 20:51439276-51439298 GTACAGCACCCATAGGAGGCAGG + Intronic
1175406927 20:58741052-58741074 CTCCATGAGCCCTGGGAGCCAGG + Intergenic
1175501493 20:59454065-59454087 ATCCTGGAGCCCAAGAAGGCAGG - Intergenic
1175796836 20:61776544-61776566 GTCCAGCAGCCCCTGCAGGCAGG + Intronic
1175978337 20:62724795-62724817 CTCCAGGAGCTGCAGGAGGCAGG - Intronic
1176195295 20:63834112-63834134 GTCCCGGGGCCCTAGGAAGAGGG - Intergenic
1176423950 21:6536260-6536282 GTCTGGGAGCCCCAGGGGGCTGG - Intergenic
1176634664 21:9179978-9180000 GTCCAGGAGACCTAGCAGAGAGG - Intergenic
1177637656 21:23807297-23807319 GCACAGGAGCCCACGGAGGCGGG - Intergenic
1179408473 21:41144075-41144097 GTTGGGGAGCCCTGGGAGGCAGG - Intergenic
1179473980 21:41631745-41631767 GTCCATGAGCTCTTGGAGGGAGG + Intergenic
1179699443 21:43144575-43144597 GTCTGGGAGCCCCAGGGGGCTGG - Intergenic
1179933684 21:44589875-44589897 GTCCTGGAGCCCTAGGATGAAGG + Intronic
1180099328 21:45577127-45577149 GGCCAGAAGCCATAAGAGGCAGG - Intergenic
1181442101 22:22941964-22941986 GCCCAGCTGCCCCAGGAGGCAGG + Intergenic
1182448727 22:30405518-30405540 TGTCAGGAGCCCTGGGAGGCAGG + Intronic
1182735870 22:32532106-32532128 GTCCGGGAGCTCTAGGAGACAGG + Intronic
1183039690 22:35167627-35167649 CTCCAGGAGCTCTTGTAGGCAGG - Intergenic
1183422081 22:37717918-37717940 GCACAGGAGCCCACGGAGGCGGG + Intronic
1183489157 22:38107663-38107685 CTCTAGCAGCCCTAGGAGGCTGG - Intronic
1183901030 22:41006139-41006161 GAGCAGGAACCTTAGGAGGCAGG + Intergenic
1184479416 22:44738027-44738049 GTCCAGGTGGCCTAGGGGGTGGG + Intronic
1184632507 22:45794223-45794245 GTCCTGGAGAGGTAGGAGGCAGG - Intronic
1184749135 22:46474209-46474231 GACAAGGAGGACTAGGAGGCTGG - Intronic
1184759271 22:46535753-46535775 GTCCAGGTGCCCGAGGACGTGGG - Exonic
1185145876 22:49136437-49136459 GTCCTGGATCCGTAGGAGGCTGG + Intergenic
1185252622 22:49813004-49813026 GACCAGGAGGCCAAGCAGGCTGG + Intronic
950841750 3:15974635-15974657 GTCAAGGAGCACCATGAGGCTGG + Intergenic
951781864 3:26372488-26372510 GTGCAGGAGCACTACAAGGCAGG + Intergenic
953864940 3:46575956-46575978 GGCCTGAAGCTCTAGGAGGCCGG - Intronic
954445121 3:50542262-50542284 TTCCTGGAGCCCAAGGAGGCAGG - Intergenic
956002823 3:64747373-64747395 GTTCAGGATCCCTGGGAGCCTGG - Intergenic
960615528 3:119592462-119592484 ATCCAGGAGACCTAGGAGGGGGG + Intergenic
960938828 3:122920466-122920488 CTCCAGAGGGCCTAGGAGGCTGG + Intronic
961803483 3:129470938-129470960 ATTCAGGAGCCATAGGTGGCAGG + Intronic
962390660 3:134969442-134969464 TTAGAGGAGCCCTGGGAGGCAGG + Intronic
962390942 3:134972151-134972173 TTAGAGGAGCCCTGGGAGGCAGG - Intronic
962877000 3:139542757-139542779 GTCCAGGTGACCAAGGAGACAGG + Intergenic
964265340 3:154889325-154889347 GTGCAGGAGCCCATGGCGGCCGG + Intergenic
965460570 3:168956868-168956890 GTCCATGAGCATTAGGAGTCCGG + Intergenic
966372391 3:179263131-179263153 GCACAGGAGCCCACGGAGGCGGG + Intronic
967968668 3:194983770-194983792 AGCCAGGAGCCCTGGCAGGCAGG - Intergenic
968966940 4:3773524-3773546 GCCCGGGAGCCCTAGGAGGGTGG - Intergenic
969684605 4:8664126-8664148 GCCCAGGTGCCCTCGAAGGCCGG - Intergenic
970429309 4:15973950-15973972 GTCCAGCAGCCCCAGGAACCGGG - Intronic
971104846 4:23513268-23513290 TTACAGTAGCCCTAGGAGTCAGG + Intergenic
971355990 4:25895747-25895769 TTTGAGGAGCCCTAGGAGACAGG + Intronic
971366698 4:25983429-25983451 GTCCAGGAGACAGTGGAGGCAGG - Intergenic
972429246 4:38964549-38964571 TTCAAGGAGCGCAAGGAGGCTGG - Intergenic
973814577 4:54607361-54607383 GCCCAGGAGGCTTTGGAGGCTGG - Intergenic
973817099 4:54629415-54629437 ATTCAGGAGCCCTGGGATGCCGG + Intergenic
974892258 4:67896632-67896654 GTGCAGGAGCCCACGGTGGCAGG + Intergenic
980051891 4:128047637-128047659 GCACAGGAGCCCACGGAGGCAGG + Intergenic
980702772 4:136454631-136454653 GGCCTGGAGGCCTAGGAGGAAGG + Intergenic
981094908 4:140769264-140769286 GTTCAGGAGCTCTAGGAGAAAGG - Intergenic
981968627 4:150637442-150637464 GACCATGAACACTAGGAGGCAGG - Intronic
982309012 4:153964466-153964488 GATCAGGAGGCCGAGGAGGCAGG + Intergenic
983886756 4:172988647-172988669 GGCCTGGAGGCCTAGGAGGGAGG + Intronic
984281446 4:177675355-177675377 GTCCAGGACCTCAAGGAGGCCGG - Intergenic
984552987 4:181182736-181182758 GTCCATGAGCCAAAGGAGGCAGG + Intergenic
985641774 5:1066775-1066797 GCCCAGGAGCTGGAGGAGGCAGG + Intronic
985683730 5:1270966-1270988 GCCCAGGAGCCGGAGGGGGCGGG + Intronic
985717306 5:1469862-1469884 GATCAGGGGCCCTAGGAGGCAGG + Intronic
987383972 5:17311851-17311873 GCACAGGAGCCCACGGAGGCGGG + Intergenic
990348187 5:54889582-54889604 GTGCAGGAGCTCTGTGAGGCTGG + Intergenic
991125492 5:63065444-63065466 GTCCATGAGCCTAGGGAGGCAGG + Intergenic
991330197 5:65485551-65485573 GCACAGGAGCCCACGGAGGCCGG + Intergenic
992202512 5:74398324-74398346 GACCCGGAGCCATAGGAAGCAGG - Intergenic
992587227 5:78252746-78252768 GTCTAGGAGCCCTGGGAGTCAGG - Intronic
995568713 5:113457426-113457448 GCACAGGAGCCCACGGAGGCGGG - Intronic
996978272 5:129460296-129460318 TCCCCGGAGCGCTAGGAGGCCGG - Exonic
997585268 5:135039909-135039931 GGCCAGGACCCCTAGCCGGCGGG - Intronic
999204319 5:149837132-149837154 AGCCAGGAGCCCCAGGAGGGAGG + Intronic
1000070813 5:157739527-157739549 GGCAAGGAGCCCTGGGAGGTGGG - Exonic
1000107075 5:158069912-158069934 AGCCAGGAGCCCTAGGAGATAGG - Intergenic
1001523960 5:172415422-172415444 ATCCCGGGGCCCAAGGAGGCAGG + Intronic
1002004596 5:176222103-176222125 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1002081560 5:176740597-176740619 GTCCTGGAGGCCCTGGAGGCTGG + Intergenic
1002221782 5:177688517-177688539 GCACAGGAGCCCACGGAGGCGGG - Intergenic
1002336250 5:178480428-178480450 GTTCAGGAGCTCTGGGAGACTGG - Intronic
1002603364 5:180367996-180368018 GTCCTGGAGCCCTCATAGGCTGG + Intergenic
1002795214 6:466260-466282 ATCCTGGAGCCCCGGGAGGCGGG + Intergenic
1003131470 6:3398680-3398702 GTCAAGGAGCCTGAGGAGGCAGG - Intronic
1004373728 6:15074409-15074431 TTACAGCAGCCCTAGGAAGCTGG - Intergenic
1005707408 6:28469431-28469453 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1005872085 6:29982066-29982088 TTCCAGGCGCCCTAAGATGCAGG - Intergenic
1006300549 6:33191668-33191690 GTCCAGGAGGCCAATGAGACAGG + Intronic
1006471534 6:34232096-34232118 TCCCAGGAGGCCTAGGAAGCAGG - Intergenic
1006860985 6:37171186-37171208 GTCCAGGAGCCTAATGACGCCGG - Exonic
1007306231 6:40907551-40907573 CTCCAGGAGCCTCAGGAAGCAGG + Intergenic
1007926630 6:45654903-45654925 GTCCAGGAGCCCTGGCTGGGAGG - Intronic
1010150640 6:72727933-72727955 GGCCAGGAGCTATATGAGGCAGG + Intronic
1011178151 6:84587670-84587692 GCACAGGAGCCCACGGAGGCGGG - Intergenic
1013599712 6:111692550-111692572 GGCCAGGAGCCAGAGGATGCTGG - Intronic
1018003097 6:159596940-159596962 GGCCAGGTACCCCAGGAGGCTGG + Intergenic
1018545706 6:164933580-164933602 GCACAGGAGCCCACGGAGGCGGG - Intergenic
1018624607 6:165765364-165765386 GCACAGGAGCCCACGGAGGCGGG + Intronic
1018830356 6:167437951-167437973 GTCCGGGATGCCTAGGTGGCTGG + Intergenic
1019496305 7:1342087-1342109 ATCCAGGAGGCCCTGGAGGCTGG - Intergenic
1019733970 7:2641421-2641443 GACCAGGAGCCCTAGGGTGGGGG + Intronic
1019925844 7:4191334-4191356 GCCCAGGAGACCTTGGTGGCGGG + Intronic
1019965716 7:4497008-4497030 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1021612039 7:22466945-22466967 TTACAGCAGCCCTGGGAGGCAGG - Intronic
1021621569 7:22555015-22555037 GCCCTGGAGCCCAAGGAGGGTGG - Intronic
1022172344 7:27842235-27842257 CTCCAGTAACCCTAGGAGGTGGG + Intronic
1022497034 7:30859785-30859807 GGCCAGGAGGCCCTGGAGGCAGG + Intronic
1022821646 7:33968116-33968138 GTCCAGCAGCCTTGGGAGTCAGG + Intronic
1023662875 7:42488658-42488680 GACCAGGAACCCCAGGAAGCAGG - Intergenic
1024292021 7:47811785-47811807 CTCCAGGAGGCCCAAGAGGCAGG + Intronic
1024691323 7:51806117-51806139 GCACAGGAGCCCACGGAGGCCGG - Intergenic
1024834085 7:53495304-53495326 GCACAGGAGCCCACGGAGGCGGG - Intergenic
1025942305 7:66083226-66083248 GAACAGGAGACCTAGGGGGCAGG + Intronic
1026335931 7:69394109-69394131 GCGCAGGAGCCCATGGAGGCGGG - Intergenic
1030295930 7:107927340-107927362 TTTCAGGGGCCCTAGGGGGCAGG - Intronic
1030599944 7:111582021-111582043 GCACAGGAGCCCACGGAGGCAGG + Intergenic
1031056494 7:116998074-116998096 GCACAGGAGCCCATGGAGGCAGG + Intronic
1031891176 7:127294615-127294637 GTCCTCTAGCCCTAGGGGGCTGG - Intergenic
1034306310 7:150047745-150047767 GGCCAGGGGCCCGAGGAGGACGG - Intergenic
1034544286 7:151779673-151779695 GACTAGGAGCCCTTGAAGGCAGG + Intronic
1034594933 7:152181019-152181041 GTCCAGGGGGCCTAGGTGTCTGG + Exonic
1034800537 7:154052908-154052930 GGCCAGGGGCCCGAGGAGGACGG + Intronic
1034940781 7:155228780-155228802 GTCCTGGAGCCCTACATGGCGGG + Intergenic
1034967058 7:155398222-155398244 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1035356182 7:158277262-158277284 GGGCAGGACCCCGAGGAGGCTGG - Intronic
1035732639 8:1863644-1863666 GCCCAGGAGCCCTCCGAGGTGGG + Intronic
1035750325 8:1991692-1991714 GTGCAGGACCCCCAGGAAGCAGG - Intronic
1035768287 8:2126594-2126616 ACACAGGAGCCCTGGGAGGCTGG + Intronic
1036638798 8:10569391-10569413 GCCCAGGAGCCCCATGGGGCGGG - Intergenic
1037752994 8:21694714-21694736 CTCCAGGAGCCAGAGGAGTCGGG - Intronic
1038426982 8:27469940-27469962 CTCCAGGAGCCCTGGGAGGTGGG + Exonic
1039433999 8:37547215-37547237 GTCCTGGTGCCAGAGGAGGCTGG - Intergenic
1039479342 8:37860251-37860273 GTCCAAGTGCCCTGGGGGGCAGG - Exonic
1040014516 8:42689795-42689817 GCACAGGAGCCCACGGAGGCGGG - Intergenic
1040481525 8:47831660-47831682 GTGGGGGAGCCCCAGGAGGCTGG + Intronic
1043268688 8:78301019-78301041 GCCCAGGAGGTCTAGGCGGCAGG - Intergenic
1044088518 8:87971398-87971420 GCACAGGAGCCCACGGAGGCAGG - Intergenic
1045287840 8:100807284-100807306 TTCCAGGAAGCCTATGAGGCAGG - Intergenic
1045312061 8:101011511-101011533 GTCCAGGAGTTCAAGGAGCCTGG - Intergenic
1045467725 8:102485591-102485613 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1048130086 8:131686289-131686311 GTCCTCTAGCCCTGGGAGGCAGG - Intergenic
1048985616 8:139733259-139733281 GCCAAGGAGCCCTGGGTGGCTGG + Intronic
1049219069 8:141420647-141420669 CTCCAGGAGCTCAGGGAGGCGGG - Intronic
1049441695 8:142612580-142612602 GGCCAGCTGCCCTGGGAGGCAGG + Exonic
1049471286 8:142776080-142776102 GACCAGGAGCTCCGGGAGGCAGG - Exonic
1049613505 8:143566774-143566796 CGCCAGGAGCCTTAGGATGCTGG + Exonic
1049671637 8:143872711-143872733 GTCCAGGAGGCCCTGGTGGCAGG + Exonic
1050096044 9:2067570-2067592 CTGCAGAAGCCCTAGGAAGCAGG + Intronic
1050529963 9:6580202-6580224 GTCAAGGAGCCCTAGGGTGAGGG - Intronic
1050975230 9:11928979-11929001 GTGCAGGAGCCCATGGAGGGGGG + Intergenic
1051226848 9:14908348-14908370 GCCCAGCAGCCCCAGGAGGCTGG + Intronic
1051705223 9:19872071-19872093 GACCAGGTGCACTAGGAGTCAGG + Intergenic
1052830287 9:33209664-33209686 GCCAAGGAGCCCTTGGAAGCTGG - Intergenic
1052940032 9:34125989-34126011 TTCCATGGGCCCTAGGAAGCTGG - Intronic
1057584559 9:96317504-96317526 GCCCAGCAGCCCTAGGAGCTGGG - Intergenic
1058908919 9:109503329-109503351 GTCCAGGAGCCTTAGAACACAGG - Intergenic
1061495728 9:130973279-130973301 CTCCAGCAGACCTCGGAGGCTGG + Intergenic
1061502666 9:131012871-131012893 GTCCAGGAGCCACGGGGGGCTGG - Intronic
1061518943 9:131106060-131106082 GTTGAGGAGCCCGAGGAGGGAGG - Intronic
1061653105 9:132066938-132066960 GTGCAGGAGCACTGAGAGGCAGG - Intronic
1061665826 9:132160867-132160889 TCCCAGAAGCCCTGGGAGGCAGG + Intergenic
1061820797 9:133226319-133226341 GTCAGGGAGCTCTGGGAGGCTGG - Intergenic
1062002272 9:134222327-134222349 TTCCTGCAGCCCCAGGAGGCAGG + Intergenic
1062238479 9:135523747-135523769 GTCAGGGAGCTCTGGGAGGCTGG + Intronic
1062326702 9:136015840-136015862 GTCCAGAAGCCCGTGGGGGCCGG - Intronic
1062600950 9:137318357-137318379 GCCCGGGAGCCCTCGGAGGCAGG + Intronic
1062689698 9:137834888-137834910 GCCCAGGAGGCCCAGGAGGACGG + Exonic
1186200234 X:7148673-7148695 GTCCAGGACCGCAAGGAGGCGGG - Intergenic
1187260253 X:17678955-17678977 GTCCAGCAGCTCTGGGAGTCTGG - Intronic
1189585343 X:42455395-42455417 GAACAGCAGCCCTACGAGGCAGG - Intergenic
1191625987 X:63271973-63271995 GAACAGGAGCCCTAGGTGGGAGG + Intergenic
1192186785 X:68952396-68952418 GTACAGGAGCCCACGGAGGAGGG - Intergenic
1195256340 X:103094359-103094381 GCACAGGAGCCCACGGAGGCGGG - Intergenic
1195909575 X:109875973-109875995 GCCCAGGAGCCCACGGAGGGCGG + Intergenic
1196582728 X:117394962-117394984 GCACAGGAGCCCACGGAGGCGGG - Intergenic
1197331142 X:125155547-125155569 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1197376764 X:125690658-125690680 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1198872279 X:141188617-141188639 GCACAGGAGCCCACGGAGGCGGG + Intergenic
1199606512 X:149583617-149583639 TTCCAGGAGCTCCAGGAAGCAGG - Exonic
1199632610 X:149785751-149785773 TTCCAGGAGCTCCAGGAAGCAGG + Exonic
1199899382 X:152158168-152158190 GGCCAGGAGCCAAAGGATGCAGG - Intergenic
1200212164 X:154351540-154351562 GCCCAGGAGCCCCAGGTGGGCGG + Intronic
1201780019 Y:17710321-17710343 CTTCAGGAGCCCTACAAGGCAGG - Intergenic
1201821536 Y:18195671-18195693 CTTCAGGAGCCCTACAAGGCAGG + Intergenic