ID: 900094918

View in Genome Browser
Species Human (GRCh38)
Location 1:936395-936417
Sequence CGTCCAGGAGCCCTAGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 5, 1: 1, 2: 0, 3: 33, 4: 385}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900094918_900094942 27 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094942 1:936445-936467 CTAGGGCTCCGGGAAGGATGGGG 0: 1
1: 0
2: 3
3: 22
4: 206
900094918_900094931 9 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094931 1:936427-936449 CCCGGTCGGTCCCGCCTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 57
900094918_900094933 10 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094918_900094935 17 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094935 1:936435-936457 GTCCCGCCTTCTAGGGCTCCGGG 0: 1
1: 5
2: 1
3: 10
4: 108
900094918_900094926 -9 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094926 1:936409-936431 TCCTGGACGGAGGGGGTCCCCGG 0: 2
1: 3
2: 1
3: 23
4: 380
900094918_900094938 21 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094938 1:936439-936461 CGCCTTCTAGGGCTCCGGGAAGG 0: 1
1: 0
2: 6
3: 12
4: 107
900094918_900094928 -5 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094928 1:936413-936435 GGACGGAGGGGGTCCCCGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 143
900094918_900094940 25 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094940 1:936443-936465 TTCTAGGGCTCCGGGAAGGATGG 0: 1
1: 0
2: 1
3: 16
4: 167
900094918_900094941 26 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094941 1:936444-936466 TCTAGGGCTCCGGGAAGGATGGG 0: 1
1: 0
2: 1
3: 16
4: 118
900094918_900094934 16 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094934 1:936434-936456 GGTCCCGCCTTCTAGGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900094918 Original CRISPR CGTCCAGGAGCCCTAGGAGG CGG (reversed) Intronic
900094853 1:936239-936261 CGTCCAGGAGCCCTAGGAGGCGG - Intronic
900094869 1:936278-936300 CGTCCAGGAGCCCTAGGAGGCGG - Intronic
900094886 1:936317-936339 CGTCCAGGAGCCCTAGGAGGCGG - Intronic
900094902 1:936356-936378 CGTCCAGGAGCCCTAGGAGGCGG - Intronic
900094918 1:936395-936417 CGTCCAGGAGCCCTAGGAGGCGG - Intronic
900094937 1:936438-936460 CTTCCCGGAGCCCTAGAAGGCGG - Intronic
900113233 1:1018389-1018411 CGCACAGGAGCCCACGGAGGGGG + Intergenic
900369784 1:2326555-2326577 GGTGCAGGAGCCCTGGGCGGTGG + Intronic
900438533 1:2642436-2642458 CGTCCAGCAGCCCCAGGGAGAGG - Intronic
900560744 1:3304852-3304874 TGTGGAGGAGCCCAAGGAGGTGG + Intronic
901157353 1:7149557-7149579 CCCCCAGCAGCCCCAGGAGGTGG - Intronic
901160235 1:7171772-7171794 CTGCCAGGAGCTGTAGGAGGGGG - Intronic
901505951 1:9686115-9686137 CTTCAAGGAGCCCTAGAAGATGG - Intronic
902185911 1:14725315-14725337 CCACCAGGAGCCTAAGGAGGGGG - Intronic
902376446 1:16032265-16032287 TGTCCTGGAGCCCTGGAAGGAGG - Exonic
902381613 1:16055497-16055519 TGTCCAGGAGCCCAGGAAGGAGG - Exonic
902818449 1:18929232-18929254 CATCCATGAGCCCTACAAGGTGG - Intronic
902985898 1:20153933-20153955 CTCTCAGCAGCCCTAGGAGGTGG + Intergenic
903028246 1:20444614-20444636 AGGCCAGGAGCCCAAGGTGGTGG + Intergenic
904598739 1:31662420-31662442 GGTGCGGGAGCCCTAGGAGGTGG + Intronic
904897072 1:33825227-33825249 GGTCCAGGGGCCCTTGGAGGAGG + Intronic
905448584 1:38043344-38043366 CTTCCAGGTGCCCTAGGACTGGG + Intergenic
906532536 1:46532023-46532045 CCTCCTGGAGACCTAGAAGGCGG - Intergenic
907889531 1:58623713-58623735 CGCACAGGAGCCCATGGAGGGGG - Intergenic
908253880 1:62286756-62286778 GGTCCTGGGGCCCCAGGAGGGGG - Intronic
911205961 1:95091649-95091671 CGCACAGGAGCCCACGGAGGAGG - Intergenic
912315969 1:108667758-108667780 CGCACAGGAGCCCACGGAGGGGG - Intergenic
914203394 1:145505948-145505970 CGCACAGGAGCCCACGGAGGGGG + Intergenic
914482516 1:148079102-148079124 CGCACAGGAGCCCACGGAGGGGG + Intergenic
915135554 1:153728713-153728735 GGAGCAGGAGCCCCAGGAGGGGG + Exonic
915764453 1:158349067-158349089 CGCACAGGAGCCCATGGAGGGGG + Intergenic
915767124 1:158374233-158374255 CGCACAGGAGCCCATGGAGGGGG + Intergenic
918884221 1:190169891-190169913 CTTACAGCAGTCCTAGGAGGTGG + Intronic
919649526 1:200132801-200132823 CCTCCAGGAGCCTTAGCAAGGGG + Intronic
920665159 1:207958301-207958323 GATCCAGGAGGCCTAGGAGGGGG + Intergenic
921396344 1:214673224-214673246 CGCACAGGAGCCCATGGAGGGGG + Intergenic
922056867 1:222050028-222050050 CGCACAGGAGCCCACGGAGGCGG - Intergenic
922155619 1:223038128-223038150 CCTCCTGGAGGCCTGGGAGGAGG - Intergenic
922541870 1:226426371-226426393 CGCACAGGAGCCCATGGAGGGGG + Intergenic
922721247 1:227901319-227901341 GGTCCAGGCTCCCTAGGAAGGGG - Intergenic
923573854 1:235140576-235140598 CGCACAGGAGCCCATGGAGGGGG - Intronic
923623200 1:235594510-235594532 CGTGCAGGAGCCCATGGTGGTGG + Intronic
923758649 1:236818435-236818457 CCTCCAGGAGCCCCAAGATGAGG + Intronic
924807256 1:247371469-247371491 CATCCAGAAGCCCTAGAATGCGG + Intergenic
924807264 1:247371512-247371534 CATCCAGAAGCCCTAGAATGCGG + Intergenic
924807273 1:247371555-247371577 CATCCAGAAGCCCTAGAATGTGG + Intergenic
1062883149 10:995013-995035 GGTGCAGGAGACCCAGGAGGTGG + Intronic
1063231217 10:4067383-4067405 AGTGAAGGAGCCCAAGGAGGGGG + Intergenic
1063663120 10:8047279-8047301 CGTCCTGGAACCATAGGAGGTGG + Intergenic
1066190305 10:33049508-33049530 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1066234083 10:33468315-33468337 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1066567360 10:36734697-36734719 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1067363233 10:45601023-45601045 CGCACAGGAGCCCACGGAGGAGG - Intergenic
1068978178 10:63033871-63033893 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1069650138 10:70041230-70041252 TGTCCAAGAGCCCTAGTAAGGGG + Intergenic
1069993012 10:72326236-72326258 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1070712641 10:78693906-78693928 GGTCCTGGAGCCCTGGGATGGGG + Intergenic
1072336597 10:94403237-94403259 CGCCCAGGAGCCCGAGGGCGCGG + Exonic
1073062925 10:100742987-100743009 CATCCTGGAGCCCCAGGAGAAGG + Intronic
1073589556 10:104743555-104743577 GGTCCAGGAACCCTAGCAGAAGG - Intronic
1075537485 10:123283431-123283453 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1076130133 10:128008327-128008349 CTTCCAGAAGCTCCAGGAGGAGG - Intronic
1076261621 10:129071430-129071452 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1076610288 10:131722150-131722172 CTTCCATGAGCCTCAGGAGGTGG - Intergenic
1076812874 10:132898409-132898431 CCTCCAACAGCCCTAGAAGGAGG + Intronic
1077107073 11:846790-846812 GGTCCAGGACCCCAGGGAGGAGG + Intronic
1077283073 11:1754240-1754262 CTTCCAGGAGCCCTGAGGGGAGG - Intronic
1077311762 11:1891919-1891941 GGTCCAGGAGCAAAAGGAGGTGG - Exonic
1077805804 11:5590161-5590183 CGCACAGGAGCCCATGGAGGCGG - Intronic
1077888609 11:6403533-6403555 TGTCCAGGTGAGCTAGGAGGAGG + Exonic
1079726183 11:23883509-23883531 CGTACAGGAGCCCATGGAGTGGG + Intergenic
1081329671 11:41788303-41788325 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1081428426 11:42950168-42950190 CGCACAGGAGCCCATGGAGGTGG - Intergenic
1083973784 11:66100439-66100461 CGTCCTTGAGCACTAGTAGGTGG + Intronic
1084005272 11:66319320-66319342 GGTCAAGGAGCCCCAGGGGGCGG - Intergenic
1084107448 11:66989076-66989098 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1084259163 11:67963505-67963527 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1084516158 11:69638990-69639012 CGTCCAGGAACCCGCGGGGGAGG - Intergenic
1084652405 11:70496841-70496863 CGTCCAGGAGAACCACGAGGCGG + Intronic
1085245636 11:75098489-75098511 CGCACAGGAGCCCAGGGAGGGGG - Intergenic
1086397709 11:86433601-86433623 CGCACAGGAGCCCACGGAGGTGG + Intergenic
1086808055 11:91269039-91269061 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1087486351 11:98763487-98763509 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1088881560 11:113977100-113977122 CATACAGCAACCCTAGGAGGTGG + Intronic
1090307646 11:125704780-125704802 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1091402217 12:188195-188217 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1091655714 12:2345348-2345370 GGTCCAGGAGCCCTGGAAGGAGG + Intronic
1092193334 12:6535129-6535151 CGACCCGGACCCCTAGGTGGGGG + Intronic
1092473003 12:8795008-8795030 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1093034536 12:14320376-14320398 TGCCCAGGAGCCCACGGAGGGGG - Intergenic
1094338565 12:29386319-29386341 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1094409874 12:30157142-30157164 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1095751990 12:45722714-45722736 AGTCCAGGAGCCCTATGAAACGG - Intergenic
1095878404 12:47106611-47106633 CGCCCAGGGACCCTATGAGGAGG - Intronic
1096714493 12:53482956-53482978 AGCCCAGGGGGCCTAGGAGGGGG - Exonic
1096864673 12:54555373-54555395 TGTCCAGGAGCCTCAGGAGGTGG + Intronic
1097128900 12:56795917-56795939 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1097863945 12:64543536-64543558 CGTGCAGGAGCCCACGGCGGGGG - Intergenic
1098168179 12:67719310-67719332 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1099790749 12:87330498-87330520 CGCACAGGAGCCCTTGGAGTGGG - Intergenic
1101009029 12:100430584-100430606 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1103783355 12:123414191-123414213 CGCACAGGAGCCCACGGAGGGGG + Exonic
1103884378 12:124189738-124189760 CCTCCAGGGGCTTTAGGAGGAGG + Intronic
1104749279 12:131228094-131228116 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1104877515 12:132046029-132046051 CCACCAGGAGCCCAAGGAGATGG - Intronic
1106100751 13:26693961-26693983 TGGCCAGGTGCCCTGGGAGGAGG - Intergenic
1109145430 13:58773555-58773577 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1110862176 13:80355829-80355851 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1110874330 13:80490640-80490662 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1111841376 13:93454863-93454885 CGCACAGGAGCCCATGGAGGGGG + Intronic
1112565028 13:100545413-100545435 CCTCCAGGGGCCCTGGGACGTGG - Intronic
1112613135 13:100975978-100976000 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1113482648 13:110633107-110633129 CGCACAGGAGCCCATGGAGGGGG + Intronic
1113538094 13:111083950-111083972 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1113583630 13:111447981-111448003 CGTCCAGGGGCACGGGGAGGAGG + Intergenic
1114593575 14:23892040-23892062 CGCACAGGAGCCCTTGGAGTGGG - Intergenic
1116114466 14:40629719-40629741 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1116311046 14:43326885-43326907 CGTGCAGGAGCCCATGGTGGTGG - Intergenic
1116789697 14:49327360-49327382 GGCCTAGGAGGCCTAGGAGGAGG + Intergenic
1117077902 14:52122527-52122549 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1118463834 14:66013335-66013357 CGTGGAGGACCCCTAGGACGTGG + Intergenic
1118844038 14:69533032-69533054 AGTCCAGGAGTCCTGGGGGGTGG + Intergenic
1119038885 14:71254580-71254602 CGCCCAGGAGCCCACGGAGCGGG - Intergenic
1119264055 14:73253847-73253869 CATCCAGGAGGCCGTGGAGGAGG + Exonic
1121008383 14:90504928-90504950 CTTCCAGCAGCCCTGGGTGGGGG + Intergenic
1121842474 14:97145731-97145753 AGTCCTGGAGCCCCAGTAGGAGG - Intergenic
1122262252 14:100530335-100530357 GGTCCAGCAGGCCTGGGAGGAGG - Intergenic
1122878702 14:104680338-104680360 CGTCCAGCAGCCCTAGGAGGTGG + Intergenic
1123019696 14:105391852-105391874 AGGCCAGGTGCCCTGGGAGGTGG - Intronic
1124215690 15:27805804-27805826 TGTCCAGGAGACCCAGGCGGCGG + Intronic
1125585232 15:40814897-40814919 GGGACAGGAGCCCTAGGAGCTGG - Exonic
1125752118 15:42036367-42036389 GGAGCAGGAGCCCCAGGAGGGGG + Intronic
1128553625 15:68615156-68615178 GGCCTAGGAGCCCTGGGAGGTGG - Intronic
1128704320 15:69827690-69827712 CATCCAGGAGCTCCTGGAGGAGG + Intergenic
1128813269 15:70587250-70587272 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1128841402 15:70854004-70854026 CATCCAGGAGGCCGAGGACGTGG - Exonic
1129820433 15:78598057-78598079 CCTCCTAGAGCCTTAGGAGGTGG - Intronic
1130382108 15:83379787-83379809 AGTCCAGGAGCCCGAGGACTGGG - Intergenic
1132511057 16:341546-341568 CGCACAGGAGCCCACGGAGGGGG - Intronic
1133127658 16:3656806-3656828 ATTCCAGGTTCCCTAGGAGGGGG - Intronic
1134134597 16:11670291-11670313 TGTCAAGGAGCCTCAGGAGGTGG + Intronic
1136160149 16:28414726-28414748 GGTGCAGGAGTACTAGGAGGAGG + Intergenic
1136381029 16:29895768-29895790 AGTCCAGGAGCCCCAGGGTGCGG + Exonic
1136450860 16:30353625-30353647 CGTCTGGGGGCCCGAGGAGGAGG - Exonic
1137270684 16:46900623-46900645 CCTCCTGGAGCTCTAGGAGTGGG + Intronic
1137393538 16:48100972-48100994 AGTCCAGGAGCTCAAGAAGGTGG - Exonic
1137442548 16:48508970-48508992 CGCACAGGAGCCCATGGAGGTGG - Intergenic
1138377228 16:56572921-56572943 AGTCCAGGAGGCAGAGGAGGAGG + Intergenic
1138492756 16:57385933-57385955 GGTCCAGGAGATCCAGGAGGTGG - Intergenic
1139489259 16:67278026-67278048 CCCCCAGGAGCCCTAAGAGCCGG - Exonic
1139603091 16:67998498-67998520 CGCACAGGAGCCCATGGAGGGGG - Intronic
1141667797 16:85474770-85474792 CCTCCAGGACCCCTGGAAGGGGG + Intergenic
1142212072 16:88813103-88813125 CCCCCAGGAGCCTTCGGAGGGGG + Intergenic
1142941773 17:3385965-3385987 CGTCCACCAGGCCGAGGAGGAGG - Intergenic
1143025694 17:3940939-3940961 CAGCCTGGAGCCCCAGGAGGGGG - Intronic
1143135237 17:4709170-4709192 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1143664239 17:8347197-8347219 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1144718390 17:17450498-17450520 CATGCAGGAGCCCTGAGAGGAGG + Intergenic
1145002101 17:19312734-19312756 CATGCAGGTGCCCGAGGAGGAGG + Intronic
1147391530 17:40112323-40112345 AGCCGGGGAGCCCTAGGAGGGGG - Intergenic
1147623714 17:41885657-41885679 CCTCCAGTAGCCCCATGAGGTGG + Intronic
1147648739 17:42050246-42050268 CCCCCAGGAGCCCGGGGAGGAGG - Intronic
1147935147 17:44006802-44006824 TGTCCAGGAGCCGTAGGGGGAGG + Intronic
1148016913 17:44528257-44528279 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1148236155 17:45970613-45970635 CTCCCAGGAGCTCTAGGAGGAGG + Intronic
1148366141 17:47057360-47057382 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1148503603 17:48110253-48110275 AGTTCAGGACCCCTTGGAGGTGG + Intronic
1148841913 17:50504222-50504244 CTTCCTGGAGCCCAGGGAGGAGG - Intergenic
1149515950 17:57280992-57281014 AGGCCAGGGGCCCAAGGAGGAGG + Intronic
1149712546 17:58756246-58756268 AGACCCGGAGCCCGAGGAGGAGG + Exonic
1150804572 17:68308987-68309009 CGCACAGGAGCCCACGGAGGGGG + Intronic
1152782236 17:82231516-82231538 GGTCCAGGAGGCCTCGGAGGTGG + Intronic
1155294996 18:24376657-24376679 CGCACAGGAGCCCATGGAGGGGG + Intronic
1156463441 18:37334392-37334414 CATCTAGGAGCCCTCGGATGTGG + Intronic
1156943205 18:42795515-42795537 CGCACAGGAGCCCATGGAGGGGG - Intronic
1159946512 18:74447997-74448019 TGTCCAGGAGCCCCCGGATGGGG + Intronic
1160039507 18:75333036-75333058 CTTCAAGGAGCCCTGGGAGGTGG - Intergenic
1160176582 18:76600208-76600230 CGCACAGGAGCCCATGGAGGCGG + Intergenic
1160823100 19:1067373-1067395 CGGCCGGGAGCCCGAGGGGGCGG - Intronic
1161036491 19:2087906-2087928 CATCCAGGAGGCCAAGAAGGCGG - Intronic
1161399112 19:4059763-4059785 CCTCCAGGAGGCCTAGGTGGGGG - Intronic
1161829318 19:6591085-6591107 CGCCCAGGAGCCCCGGGAGGGGG - Exonic
1162032520 19:7923636-7923658 CCTCAAGGATCCCTAGAAGGCGG + Intergenic
1162054196 19:8053014-8053036 CGTCCAGGTGCCCAGGGAGGAGG + Exonic
1162107035 19:8376047-8376069 CGCACAGGAGCCCATGGAGGGGG - Intronic
1162233072 19:9283531-9283553 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1162632666 19:11941373-11941395 CGCACAGGAGCCCATGGAGGAGG + Intronic
1162814689 19:13186782-13186804 GGTACAGGAGCCCACGGAGGGGG + Intergenic
1163419312 19:17205382-17205404 CGGCCAGGTGCACCAGGAGGTGG + Intronic
1163747409 19:19056657-19056679 AGACCAGCAGCCCAAGGAGGGGG - Intronic
1165346963 19:35254540-35254562 CCCCAAGGAGCCCGAGGAGGTGG - Intronic
1165994946 19:39837456-39837478 AGTACAGGAGACCTAGGAGATGG + Intronic
1166104318 19:40589938-40589960 AGGCCAGGAGCCCAGGGAGGAGG + Intronic
1167603150 19:50466127-50466149 CCTCCTGAAGCCCCAGGAGGAGG - Intronic
1168103668 19:54154030-54154052 CCTACAGGAGGCCTAGGAGCTGG - Intronic
925293304 2:2762599-2762621 GGTCCAAGAGCCCCAGGAGGAGG + Intergenic
925812827 2:7717907-7717929 CTTACAACAGCCCTAGGAGGTGG + Intergenic
926101877 2:10123036-10123058 CTTCCAGGAGCCCACGGAGCCGG + Exonic
927720049 2:25376765-25376787 CATCCTGGAGCCCAGGGAGGAGG + Intergenic
928753230 2:34494576-34494598 CGCACAGGAGCCCACGGAGGGGG - Intergenic
929070097 2:38020793-38020815 TGCACAGGAGCCCAAGGAGGCGG - Intronic
929379724 2:41335873-41335895 CGCACAGGAGCCCATGGAGGGGG - Intergenic
932322884 2:70834831-70834853 CTTCCTGGAGCCCTGGCAGGAGG + Intronic
933758609 2:85659815-85659837 AGGCCGGGAGCCCTAGGAGCTGG + Intronic
935872808 2:107469505-107469527 CGTGCAGGAGCCCACGGAGGCGG + Intergenic
936346923 2:111682133-111682155 CGCACAGGAGCCCATGGAGGGGG - Intergenic
937890392 2:126934085-126934107 CCTCCAGGGACCCCAGGAGGTGG + Intergenic
939960497 2:148561349-148561371 CTTCAAGGAGCCCTAGCTGGGGG - Intergenic
941178959 2:162235197-162235219 CGTGCAGGAGCCCATGGCGGAGG - Intronic
942017658 2:171832957-171832979 TGACCAGGAGCCCTATGATGTGG - Intronic
943680303 2:190761032-190761054 CGCACAGGAGCCCACGGAGGGGG + Intergenic
943835195 2:192508251-192508273 CGCACAGGAGCCCACGGAGGGGG - Intergenic
944857898 2:203785652-203785674 CGCACAGGAGCCCACGGAGGGGG + Intergenic
945988164 2:216371440-216371462 CGACCCGGAGCCGGAGGAGGAGG - Exonic
946371288 2:219283030-219283052 CCTCCAGCAGCCCTGCGAGGCGG + Intronic
947026666 2:225744416-225744438 CGCACAGGAGCCCATGGAGGGGG - Intergenic
947294185 2:228612713-228612735 CGTCCAGGCCCCTTAGGAAGAGG - Intergenic
947720459 2:232366623-232366645 CGCACAGGAGCCCATGGAGGGGG - Intergenic
948830319 2:240595428-240595450 CGTGCAACAGCCCAAGGAGGGGG - Intronic
1168819450 20:763250-763272 CTTCCAGCAGTCCTAGGAGGTGG + Intronic
1170646285 20:18198888-18198910 TCTCCAGCAGCCCTATGAGGTGG + Intergenic
1170649537 20:18227047-18227069 CGCACAGGAGCCCACGGAGGAGG - Intergenic
1170968960 20:21101377-21101399 CGCCCGGGAGCCCTAGGTGAGGG - Intergenic
1171313500 20:24166037-24166059 GGTTCAGAAGCCCTAGGAGAAGG - Intergenic
1172215198 20:33230695-33230717 CCTCCTGCAGCCCTAGGAGGTGG + Intergenic
1172612066 20:36259899-36259921 CGTCCAGGAGCCCAGGGTTGGGG - Intronic
1172752009 20:37257788-37257810 CTTCCAGGAGCCGAAGTAGGAGG - Intronic
1173443310 20:43096516-43096538 CTGTCAGGAGCCCCAGGAGGAGG - Intronic
1173601632 20:44299417-44299439 CGCACAGGAGCCCATGGAGGAGG - Intergenic
1174094659 20:48078741-48078763 GGTCCTGGAGCCCCAGCAGGTGG - Intergenic
1174303545 20:49599551-49599573 GGTCCTGGAGCACTGGGAGGGGG + Intergenic
1174595208 20:51678420-51678442 GGACAAAGAGCCCTAGGAGGAGG + Intronic
1175309396 20:58001187-58001209 CTCACAGCAGCCCTAGGAGGAGG - Intergenic
1175994770 20:62807164-62807186 TGGCCAGCAGGCCTAGGAGGAGG + Intronic
1176195296 20:63834113-63834135 TGTCCCGGGGCCCTAGGAAGAGG - Intergenic
1177637657 21:23807298-23807320 CGCACAGGAGCCCACGGAGGCGG - Intergenic
1178493330 21:33067972-33067994 CTTCCAGGAAGCCCAGGAGGGGG - Intergenic
1180741005 22:18053434-18053456 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1181078003 22:20394276-20394298 CGGCCAGGAGCCATCGGACGCGG - Exonic
1181413940 22:22746166-22746188 GGTCGAGGTGCTCTAGGAGGGGG + Intronic
1181419591 22:22788682-22788704 GGTCAAGGTGCTCTAGGAGGGGG + Intronic
1181426768 22:22848883-22848905 GGTCAAGGTGCTCTAGGAGGGGG + Intronic
1181602019 22:23958416-23958438 GGTCCAGGTGCCCGAGGAGAAGG - Exonic
1181606490 22:23982891-23982913 GGTCCAGGTGCCCGAGGAGAAGG + Exonic
1181728988 22:24831136-24831158 CGTGCAGGAGGGTTAGGAGGAGG + Intronic
1183403182 22:37616812-37616834 CGACCAGGGCCCCTTGGAGGAGG + Intronic
1183485307 22:38085050-38085072 AGTCCTGGAGCCCCTGGAGGGGG + Exonic
1184287835 22:43481965-43481987 CGTCACGGCGCCCTGGGAGGGGG - Intronic
1184470371 22:44692433-44692455 GGTGGAGGAGCCCCAGGAGGAGG - Intronic
1184470390 22:44692482-44692504 GGTGGAGGAGCCCTGGGAGGAGG - Intronic
1184479110 22:44736866-44736888 CGTGCAGGAGCACGAGGCGGAGG + Exonic
1184479415 22:44738026-44738048 CGTCCAGGTGGCCTAGGGGGTGG + Intronic
1184595161 22:45509466-45509488 GGGCCAGGAGCCCTAAGAGCAGG + Intronic
1184759272 22:46535754-46535776 GGTCCAGGTGCCCGAGGACGTGG - Exonic
1184906214 22:47488384-47488406 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1185377268 22:50488282-50488304 CGTGCAGGAGCCCGACGAGGTGG - Exonic
949259010 3:2083910-2083932 CGCACAGGAGCCCACGGAGGGGG - Intergenic
949770031 3:7568875-7568897 CGCACAGGAGCCCATGGAGGGGG - Intronic
951951050 3:28200490-28200512 CGCACAGGAGCCCACGGAGGGGG + Intergenic
952593677 3:34988660-34988682 CGCACAGGAGCCCAGGGAGGTGG - Intergenic
952730680 3:36634190-36634212 CGCACAGGAGCCCAAGGACGGGG - Intergenic
953018382 3:39098882-39098904 CGTCCAGGAAGCCTAGGGGAGGG + Exonic
953089865 3:39713598-39713620 CGCACAGGAGCCCACGGAGGGGG - Intergenic
953522460 3:43656504-43656526 CGCACAGGAGCCCATGGAGGGGG + Intronic
957002236 3:74900054-74900076 CGCACAGGAGCCCACGGAGGTGG + Intergenic
957277502 3:78108671-78108693 CGCACAGGAACCCTCGGAGGGGG - Intergenic
957371520 3:79300502-79300524 CGCACAGGAGCCCACGGAGGGGG - Intronic
957386482 3:79502504-79502526 CGTGCAGGAGCCCATGGCGGTGG - Intronic
957829977 3:85504753-85504775 CGCACAGGAGCCCACGGAGGGGG + Intronic
958022671 3:88015972-88015994 CGCACAGGAGCCCACGGAGGGGG - Intergenic
960149765 3:114238367-114238389 CGTACAGGAGCCCACGGAGGGGG + Intergenic
960282175 3:115791845-115791867 CGCACAGGAGCCCACGGAGGGGG - Intergenic
960615527 3:119592461-119592483 AATCCAGGAGACCTAGGAGGGGG + Intergenic
961279979 3:125758703-125758725 CGCACAGGAGCCCACGGAGGGGG + Intergenic
961825283 3:129596088-129596110 CTTCCATAAGCCCTAGGTGGTGG - Intronic
961869458 3:129977108-129977130 CATCCAGGAGCCCCAGCAGAAGG - Exonic
962600465 3:136987665-136987687 CGCACAGGAGCCCATGGAGGGGG + Intronic
963509120 3:146225509-146225531 CGCACAGGAGCCCATGGAGGGGG + Intronic
963651788 3:147989454-147989476 CGCACAGGAGCCCATGGAGGCGG + Intergenic
964014420 3:151928438-151928460 CGCACAGGAGCCCATGGAGGGGG - Intergenic
965040335 3:163499307-163499329 CGCACAGGAGCCCACGGAGGAGG - Intergenic
965220177 3:165918526-165918548 CGCACAGGAGCCCACGGAGGGGG + Intergenic
965245203 3:166258545-166258567 CGCACAGGAGCCCACGGAGGGGG + Intergenic
968181559 3:196599114-196599136 CGCACAGGAGCCCACGGAGGGGG + Intergenic
968616253 4:1579079-1579101 CGTCCAGCAGCGCTGGGAAGGGG - Intergenic
968716198 4:2161550-2161572 CGCACAGGAGCCCACGGAGGGGG - Intronic
968976885 4:3826747-3826769 CTACCAGGAGCCCTGGGAGGAGG - Intergenic
969058123 4:4414633-4414655 CATCCAGAAGCCCTTTGAGGTGG + Intronic
969315638 4:6380036-6380058 CATCCAGGAAACCAAGGAGGAGG - Intronic
971905157 4:32716302-32716324 CGCACAGGAGCCCACGGAGGGGG + Intergenic
972717150 4:41657849-41657871 TCCCCAGGAGCCCTAGGAAGGGG + Intronic
974147454 4:57965708-57965730 CGCACAGGAGCCCATGGAGGGGG - Intergenic
974590559 4:63942959-63942981 CGCACAGGAGCCCGTGGAGGGGG + Intergenic
974641709 4:64640550-64640572 CGCACAGGAGCCCTTGGAGTTGG + Intergenic
974827798 4:67152163-67152185 GGCACAGGAGCCCAAGGAGGGGG - Intergenic
975663593 4:76711281-76711303 CTTTCAGCATCCCTAGGAGGCGG - Intronic
978080289 4:104582264-104582286 TGCACAGGAGCCCAAGGAGGGGG - Intergenic
979290780 4:118977127-118977149 CGCACAGGAGCCCATGGAGGGGG + Intronic
979688630 4:123538200-123538222 CGCACAGGAGCCCACGGAGGAGG - Intergenic
980228018 4:130013064-130013086 CGCACAGGAGCCCACGGAGGGGG - Intergenic
980815593 4:137942354-137942376 CGCACAGGAGCCCACGGAGGGGG - Intergenic
984238780 4:177193273-177193295 CGCACAGGAGCCCACGGAGGGGG + Intergenic
984655000 4:182308170-182308192 AGTTCAGCACCCCTAGGAGGGGG - Intronic
984917869 4:184739773-184739795 AGTGCAGGAACCCAAGGAGGTGG + Intergenic
987476650 5:18399742-18399764 CGCACAGGAGCCCATGGAGGGGG + Intergenic
988177307 5:27743745-27743767 CGCACAGGAGCCCACGGAGGGGG - Intergenic
989003237 5:36782864-36782886 CGCACAGGAGCCCATGGAGGGGG - Intergenic
990345304 5:54865360-54865382 CGCACAGGAGCCCATGGAGGGGG - Intergenic
991567524 5:68020479-68020501 CGCCCAGGAGCCCATGGAGGGGG + Intergenic
991899696 5:71447370-71447392 CCTGCAGGAGACCCAGGAGGTGG + Intergenic
992947484 5:81824006-81824028 CGCACAGGAGCCCATGGAGGGGG - Intergenic
993274475 5:85838545-85838567 CCACCAGGAGCCCGAGGAAGAGG + Intergenic
993822074 5:92631615-92631637 CGCACAGGAGCCCATGGAGGGGG - Intergenic
995656543 5:114432964-114432986 CGCACAGGAGCCCATGGAGGGGG - Intronic
996435730 5:123430833-123430855 CGCACAGGAGCCCACGGAGGGGG - Intergenic
996815604 5:127569697-127569719 CGCACAGGAGCCCACGGAGGCGG - Intergenic
999395432 5:151223971-151223993 CGTCCGGGAGCCCCCGGAGGAGG - Exonic
1000070814 5:157739528-157739550 AGGCAAGGAGCCCTGGGAGGTGG - Exonic
1002795213 6:466259-466281 CATCCTGGAGCCCCGGGAGGCGG + Intergenic
1003056396 6:2824694-2824716 CCACCAGGAGCCAGAGGAGGTGG - Intergenic
1003060763 6:2860424-2860446 CGTACAGGAGCCCATGGAGTGGG - Intergenic
1003422846 6:5973847-5973869 CATCCAGGAGCCCTAGGCTGAGG + Intergenic
1003908168 6:10720873-10720895 CCTACAGGAGCCCACGGAGGTGG - Intergenic
1003947315 6:11087501-11087523 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1004499639 6:16198177-16198199 CGCACAGGAGCCCAAGGCGGGGG + Intergenic
1004511684 6:16288539-16288561 CGCACAGGAGCCCGTGGAGGGGG - Intronic
1005040477 6:21595700-21595722 GGACGAGGAGCCCGAGGAGGAGG - Exonic
1005596174 6:27381144-27381166 CGCACAGGAGCCCACGGAGGGGG + Intronic
1005749886 6:28872668-28872690 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1005978199 6:30816374-30816396 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1006033675 6:31195745-31195767 CGCACAGGAGCCCTTGGAGTGGG - Intergenic
1006116359 6:31778002-31778024 CTCCCAAGAGCCCTGGGAGGGGG - Intronic
1007240203 6:40419407-40419429 CATCCTGGAGCCCCAGGAGAGGG - Intronic
1007602107 6:43088832-43088854 CTTCCAGCAGCACCAGGAGGAGG - Intronic
1009407070 6:63326527-63326549 CGCACAGGAGCCCACGGAGGAGG + Intergenic
1009685378 6:66949499-66949521 CGCACAGGAGCCCTCGGAGGGGG - Intergenic
1010235609 6:73572612-73572634 CGTACAGGAGCCCATGGAGGGGG + Intergenic
1011338322 6:86284895-86284917 CATACAGGAGCCCACGGAGGGGG + Intergenic
1013960117 6:115889338-115889360 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1015572212 6:134633620-134633642 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1016067329 6:139697991-139698013 CGCACAGGAGCCCAAGGAGTGGG + Intergenic
1016482280 6:144495226-144495248 CGCACAGGAGCCCATGGAGGGGG + Intronic
1017581178 6:155866831-155866853 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1018064198 6:160114578-160114600 CGCACAGGAGCCCAGGGAGGGGG + Intergenic
1018808641 6:167281259-167281281 CGGAGAGGAGCCCCAGGAGGAGG + Intronic
1019265921 7:117577-117599 CGTGCGGGAGCCCTGGGACGGGG + Intergenic
1019733969 7:2641420-2641442 AGACCAGGAGCCCTAGGGTGGGG + Intronic
1022172343 7:27842234-27842256 CCTCCAGTAACCCTAGGAGGTGG + Intronic
1022652933 7:32293754-32293776 GGTCCATGAGCACTGGGAGGAGG + Intronic
1022750471 7:33219258-33219280 CGCACAGGAGCCCACGGAGGGGG - Intronic
1024522636 7:50319561-50319583 CATCCAGGAGACCCAGGAAGTGG + Intronic
1024834086 7:53495305-53495327 CGCACAGGAGCCCACGGAGGCGG - Intergenic
1026053729 7:66967442-66967464 CCTCCAGGAGGGCTAGGAAGAGG - Intergenic
1026900829 7:74036560-74036582 GGTCTCGGAGCCCTTGGAGGAGG + Exonic
1027561709 7:79739585-79739607 CGCACAGGAGCCCATGGAGGCGG - Intergenic
1027665930 7:81042992-81043014 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1028070135 7:86440851-86440873 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1028778358 7:94705777-94705799 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1029382148 7:100221278-100221300 CACCCAGGAGGCCTGGGAGGGGG - Exonic
1029489977 7:100865859-100865881 CTCCCAGGAGCCCGGGGAGGAGG - Exonic
1029495539 7:100894154-100894176 CACCCAGGAGCCAGAGGAGGAGG + Exonic
1030819277 7:114076927-114076949 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1031378826 7:121060219-121060241 CGCACAGGAGCCCACGGAGGGGG - Intronic
1032339687 7:131059045-131059067 CGTGCAGGAGCCCACGGTGGTGG - Intergenic
1035259046 7:157650098-157650120 CGTCCAGGTGCCATAGTAGCCGG - Intronic
1035638399 8:1163951-1163973 CGTCTAGGAGGCCTGGCAGGCGG - Intergenic
1035732638 8:1863643-1863665 TGCCCAGGAGCCCTCCGAGGTGG + Intronic
1036306116 8:7603588-7603610 CGTACAGGAGCCCACAGAGGGGG + Intergenic
1036356962 8:8051573-8051595 CGTACAGGAGCCCACAGAGGGGG + Intergenic
1036440993 8:8781468-8781490 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1036831386 8:12022886-12022908 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1036915011 8:12796547-12796569 CGCACAGGAGCCCACGGAGGAGG - Intergenic
1037806023 8:22058289-22058311 CACCCAGGAGCTCTAGGAGAGGG - Intronic
1037877527 8:22555237-22555259 CGTGCAGGAGCCCTGGGCGCCGG + Intronic
1037889520 8:22616185-22616207 GGTCAAGGAGCCCAAGGATGAGG + Exonic
1038266744 8:26044163-26044185 CGGCCGGGAGCTCTGGGAGGGGG - Intronic
1038426981 8:27469939-27469961 TCTCCAGGAGCCCTGGGAGGTGG + Exonic
1039069072 8:33633904-33633926 CGCACAGGAGCCCACGGAGGGGG + Intergenic
1039919323 8:41882281-41882303 CTTCCAGGAGCCCCAGGGCGTGG - Intronic
1043352454 8:79377281-79377303 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1043701162 8:83290635-83290657 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1044075858 8:87821118-87821140 GGCACAGGAGCCCAAGGAGGGGG - Intergenic
1046285022 8:112083100-112083122 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1046288943 8:112132975-112132997 CGCACAGGAGCCCATGGAGGGGG - Intergenic
1047631668 8:126714714-126714736 CGCACAGGAGCCCACGGAGGAGG + Intergenic
1048655382 8:136530529-136530551 CGCACAGGAGCCCATGGAGGTGG + Intergenic
1049219070 8:141420648-141420670 CCTCCAGGAGCTCAGGGAGGCGG - Intronic
1049409575 8:142466478-142466500 CCTCCAGTGGCCCGAGGAGGAGG + Intronic
1049574419 8:143383778-143383800 CGCTCAGCAGCCCTGGGAGGCGG + Exonic
1049696157 8:143985236-143985258 CATCCTGGAGCCCGAGGAGCTGG - Exonic
1050529964 9:6580203-6580225 AGTCAAGGAGCCCTAGGGTGAGG - Intronic
1050975229 9:11928978-11929000 AGTGCAGGAGCCCATGGAGGGGG + Intergenic
1051383341 9:16480791-16480813 CGCACAGGAGCCCATGGAGGGGG - Intronic
1053027247 9:34740313-34740335 CGCCCAGGAGCCCACGGAGTGGG + Intergenic
1054722489 9:68617307-68617329 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1056693554 9:88827795-88827817 CTTCCAGGTGCTCAAGGAGGGGG - Intergenic
1057584560 9:96317505-96317527 AGCCCAGCAGCCCTAGGAGCTGG - Intergenic
1058072151 9:100612227-100612249 GGTCTAGGAACCCCAGGAGGTGG - Intergenic
1058286600 9:103187175-103187197 CGCACAGGAGCCCACGGAGGAGG - Intergenic
1059340606 9:113595448-113595470 CAGCCAGGAGCCCTGGGATGTGG - Intronic
1059434073 9:114266027-114266049 AGTCCAGGAACCCCATGAGGAGG + Intronic
1059516607 9:114901799-114901821 CATAGAGGAGACCTAGGAGGAGG + Intronic
1060235226 9:121857961-121857983 CATCCAGGATCCCACGGAGGGGG - Intronic
1060786866 9:126458015-126458037 GGTCCAGGAGCTCAAGGAGATGG - Intronic
1060793575 9:126500890-126500912 CGTGCATGTGCCCTCGGAGGTGG + Intronic
1061483864 9:130910405-130910427 CGCACAGGAGCCCACGGAGGGGG - Intronic
1061822068 9:133234483-133234505 AATCCTGGAGCCCTCGGAGGGGG - Intergenic
1062237223 9:135516030-135516052 AATCCCGGAGCCCTCGGAGGGGG + Intergenic
1062490775 9:136803878-136803900 TGACCTGGAGCCCTGGGAGGAGG + Intronic
1185693929 X:2179743-2179765 ATTCCAGGAGCCGGAGGAGGCGG - Intergenic
1186200235 X:7148674-7148696 GGTCCAGGACCGCAAGGAGGCGG - Intergenic
1187304644 X:18084086-18084108 CGCACAGGAGCCCATGGAGGCGG - Intergenic
1189995737 X:46635620-46635642 CGTCGAGGAGCCCTCCGAAGAGG - Exonic
1190050739 X:47146773-47146795 TGGCCAGGAGCCCAGGGAGGTGG + Intronic
1190456177 X:50629807-50629829 CGTCCAGGGGCATTAGGAGCAGG + Intronic
1192139948 X:68638769-68638791 CATCCAGGGGCCCTAAGAGGAGG + Intergenic
1192186786 X:68952397-68952419 CGTACAGGAGCCCACGGAGGAGG - Intergenic
1195258005 X:103107427-103107449 CGCACAGGAGCCCATGGAGGGGG + Intergenic
1198020072 X:132648862-132648884 AGTCCTGGAGCCCTGGGAGGAGG + Intronic
1198300019 X:135325737-135325759 CGCACAGGAGCCCATGGAGGGGG - Intronic
1199665702 X:150094883-150094905 CTTCCAACAGCCCTAGGATGTGG - Intergenic
1202107098 Y:21383504-21383526 CGTGGAGGCGCCCTAGGGGGAGG + Exonic
1202109874 Y:21407484-21407506 CGCACAGGAGCCCACGGAGGGGG - Intergenic
1202137063 Y:21676741-21676763 CGCACAGGAGCCCAGGGAGGGGG + Intergenic