ID: 900094920

View in Genome Browser
Species Human (GRCh38)
Location 1:936398-936420
Sequence CTCCGTCCAGGAGCCCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 2, 1: 3, 2: 1, 3: 10, 4: 178}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900094920_900094938 18 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094938 1:936439-936461 CGCCTTCTAGGGCTCCGGGAAGG 0: 1
1: 0
2: 6
3: 12
4: 107
900094920_900094941 23 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094941 1:936444-936466 TCTAGGGCTCCGGGAAGGATGGG 0: 1
1: 0
2: 1
3: 16
4: 118
900094920_900094931 6 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094931 1:936427-936449 CCCGGTCGGTCCCGCCTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 57
900094920_900094935 14 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094935 1:936435-936457 GTCCCGCCTTCTAGGGCTCCGGG 0: 1
1: 5
2: 1
3: 10
4: 108
900094920_900094933 7 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094920_900094940 22 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094940 1:936443-936465 TTCTAGGGCTCCGGGAAGGATGG 0: 1
1: 0
2: 1
3: 16
4: 167
900094920_900094942 24 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094942 1:936445-936467 CTAGGGCTCCGGGAAGGATGGGG 0: 1
1: 0
2: 3
3: 22
4: 206
900094920_900094934 13 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094934 1:936434-936456 GGTCCCGCCTTCTAGGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 112
900094920_900094928 -8 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094928 1:936413-936435 GGACGGAGGGGGTCCCCGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900094920 Original CRISPR CTCCGTCCAGGAGCCCTAGG AGG (reversed) Intronic
900094855 1:936242-936264 TTCCGTCCAGGAGCCCTAGGAGG - Intronic
900094871 1:936281-936303 CTCCGTCCAGGAGCCCTAGGAGG - Intronic
900094888 1:936320-936342 TTCCGTCCAGGAGCCCTAGGAGG - Intronic
900094904 1:936359-936381 TTCCGTCCAGGAGCCCTAGGAGG - Intronic
900094920 1:936398-936420 CTCCGTCCAGGAGCCCTAGGAGG - Intronic
900094939 1:936441-936463 ATCCTTCCCGGAGCCCTAGAAGG - Intronic
900519510 1:3098804-3098826 CAGCGCCCAGGAGCCCAAGGAGG - Intronic
901748855 1:11393610-11393632 CTCAGTCCAGGTGTCCTAGGTGG - Intergenic
902290966 1:15434521-15434543 CTTCTTCCAACAGCCCTAGGAGG + Intergenic
905792193 1:40795934-40795956 ATCCTTCCAAGAGCCCTATGAGG + Intronic
906369642 1:45241666-45241688 CACAGGCCAGGAGGCCTAGGAGG - Intronic
908848742 1:68351879-68351901 CTCTGTCCAGGGGCACTACGTGG - Intergenic
909632980 1:77786275-77786297 CACCAGCCAGGAGGCCTAGGAGG - Intronic
916040963 1:160961045-160961067 CTCTGCCCAAGAGTCCTAGGGGG + Intergenic
917164359 1:172095692-172095714 CTGCAACCAGGAGCCCTAAGAGG - Intronic
917580814 1:176376164-176376186 ACCCTTTCAGGAGCCCTAGGAGG + Intergenic
920379121 1:205525752-205525774 TTCCCTCCAGGAGCCCAAAGAGG + Intronic
1062855198 10:776668-776690 CCCCGTCCAGATGCCCTGGGCGG + Intergenic
1064092208 10:12394909-12394931 CTGCGTGCAGGAGGCCTTGGAGG + Intronic
1065534178 10:26701382-26701404 CACAGGCCAGGAGGCCTAGGAGG + Intronic
1067828340 10:49595580-49595602 CTCCCTCCAGGCACCCCAGGTGG - Intergenic
1069546779 10:69334679-69334701 GTGTGCCCAGGAGCCCTAGGAGG - Intronic
1069717654 10:70531270-70531292 CTCCTGCCAGGAGCCCGAGGGGG - Exonic
1069812642 10:71173860-71173882 CTACCTCCAGGAGCCCTATCAGG + Intergenic
1070349988 10:75582564-75582586 CACAGTCCTGGAGGCCTAGGAGG - Intronic
1070404292 10:76080955-76080977 CTCCATCCAAGAGCCCTTGGTGG + Intronic
1070570585 10:77637444-77637466 CTCGGTCCACGAGCCCAAGATGG - Exonic
1070810244 10:79293859-79293881 GTCCCTCAAGCAGCCCTAGGAGG - Intronic
1073423054 10:103439916-103439938 CTTTCTCCAGGAGCCCTGGGAGG + Intronic
1074640204 10:115370882-115370904 CACAGGCCAGGAGGCCTAGGAGG + Intronic
1074717632 10:116234662-116234684 CTCTGTCCAGTAGCCCTGAGTGG - Intronic
1075693884 10:124419291-124419313 CTCCCTCCAGGAGCACAGGGCGG - Intergenic
1076312289 10:129517185-129517207 CGCTGTCCAGGAGCCATGGGCGG - Intronic
1076705448 10:132298771-132298793 CTCCATCCAGGAGCCACATGGGG + Intronic
1076812871 10:132898406-132898428 CTCCCTCCAACAGCCCTAGAAGG + Intronic
1077350874 11:2092680-2092702 CTCCTTCCAGCAGCCCCAGCCGG + Intergenic
1079193431 11:18302128-18302150 CAGTGTCCAGGAGCCCCAGGAGG - Intronic
1079358876 11:19753805-19753827 CTCCTTTAAGGAGCCCTTGGCGG + Intronic
1080560191 11:33456242-33456264 CTCCATTCAGCTGCCCTAGGGGG - Intergenic
1081689787 11:45070144-45070166 TTCCTTACAGGAGCCCTATGTGG + Intergenic
1081804314 11:45882069-45882091 TTCCTTCCAGGAGCAGTAGGTGG + Exonic
1082822238 11:57551975-57551997 CTCAGTGCCTGAGCCCTAGGGGG + Exonic
1084438330 11:69156944-69156966 CTCCATCAAGAAGCCTTAGGTGG - Intergenic
1088164821 11:106921662-106921684 CTCTTTCCAACAGCCCTAGGGGG - Intronic
1089173143 11:116529301-116529323 CTCCCTGCAAGAGACCTAGGAGG + Intergenic
1091670884 12:2451565-2451587 CACCGAACAGGAGCCCTGGGAGG + Intronic
1091974480 12:4813512-4813534 CTCAGTCCAAGAGGCCAAGGAGG - Intronic
1092023797 12:5223952-5223974 CTCTTGCCAGGAGCCCAAGGAGG - Intergenic
1096960288 12:55570252-55570274 CACAGGCCAGGAGGCCTAGGAGG - Intergenic
1098778563 12:74654237-74654259 CACAGGCCTGGAGCCCTAGGAGG - Intergenic
1100371061 12:93969063-93969085 CTCCCTCCAGGGGCTCTCGGGGG + Intergenic
1100955110 12:99899136-99899158 ATCCTTACAGCAGCCCTAGGAGG + Intronic
1102026659 12:109717620-109717642 CTGTGTCCTGGAGCCTTAGGTGG + Intronic
1103762168 12:123258726-123258748 GTCTGTCCAGCAGGCCTAGGCGG + Intergenic
1103884375 12:124189735-124189757 CTCCCTCCAGGGGCTTTAGGAGG + Intronic
1113784798 13:112996804-112996826 CCCCGTCCAGGTGCCGTGGGCGG - Intronic
1116917217 14:50537079-50537101 CACAGGCCAGGAGACCTAGGAGG + Intronic
1118653874 14:67926007-67926029 CGCAGGCCAGGAGGCCTAGGAGG - Intronic
1118844037 14:69533029-69533051 CTAAGTCCAGGAGTCCTGGGGGG + Intergenic
1122770956 14:104097445-104097467 CCCAGCCCAGGAGCCCCAGGCGG - Intronic
1122878699 14:104680335-104680357 TCCCGTCCAGCAGCCCTAGGAGG + Intergenic
1127791035 15:62398932-62398954 CTCAGGCCCGGAGGCCTAGGAGG + Intronic
1128766740 15:70255708-70255730 CTCCCTGCAGGAGCCCAGGGAGG + Intergenic
1129464153 15:75714529-75714551 TTCCATCCAGGTGCCCTAGGAGG + Intergenic
1129721044 15:77878176-77878198 TTCCATCCATGTGCCCTAGGAGG - Intergenic
1130151092 15:81312323-81312345 CTCCGTCTAGCAGCCCTGGCTGG - Exonic
1134067263 16:11236825-11236847 CTCCATGCAGGCTCCCTAGGAGG + Intergenic
1136088770 16:27903639-27903661 CTCCCTCCAGGGCCCCAAGGGGG - Intronic
1141720962 16:85754981-85755003 CACCCTGCAGGACCCCTAGGAGG - Intergenic
1144679435 17:17183034-17183056 CTGCTTCCAGGTGCCCTTGGGGG - Intronic
1146451984 17:32981807-32981829 CACAGGCCAGGAGGCCTAGGAGG - Intronic
1147758020 17:42781012-42781034 CTCGGTCCACGTGCCCTCGGGGG - Exonic
1147935145 17:44006799-44006821 TCCTGTCCAGGAGCCGTAGGGGG + Intronic
1148875290 17:50683600-50683622 CTCCTGCCAGGCGCCCTGGGTGG + Exonic
1149461777 17:56834530-56834552 GCGCGTCCAGGAGCCCAAGGCGG - Intronic
1149869211 17:60167789-60167811 CCCAGTCCTTGAGCCCTAGGTGG + Intronic
1152111408 17:78359502-78359524 CTCAGTCCAGTAGCCCCGGGCGG + Intronic
1160185705 18:76674776-76674798 CTCCTGCCTGGAGCCCCAGGAGG - Intergenic
1160823103 19:1067376-1067398 CCCCGGCCGGGAGCCCGAGGGGG - Intronic
1161162275 19:2768055-2768077 CTCAGGCCAGGCGCCCTTGGAGG - Intronic
1161524041 19:4742640-4742662 CTGTGTCCAGGGGACCTAGGGGG + Intergenic
1163350022 19:16770675-16770697 CTCTTCCCAGCAGCCCTAGGTGG - Intronic
1163475097 19:17521207-17521229 CTCCGGCCAGCAGCCCTACCCGG + Exonic
1163747412 19:19056660-19056682 CTCAGACCAGCAGCCCAAGGAGG - Intronic
1164526859 19:29019190-29019212 CTCCGTCCCTGAGGCCTAGAGGG + Intergenic
1166083708 19:40461265-40461287 CTGGGTCCAGGAGCCCAGGGAGG - Intronic
1167509032 19:49886445-49886467 CTCTGTCCTTGTGCCCTAGGAGG - Intronic
929029549 2:37637682-37637704 CTCCCTCCAGAGGCTCTAGGGGG + Intergenic
936169336 2:110155003-110155025 CACAGGCCAGGAGGCCTAGGAGG + Intronic
941319948 2:164041671-164041693 CCCAGGCTAGGAGCCCTAGGAGG - Intergenic
948479002 2:238239026-238239048 CTCCGTCCAGGGGCTCTAGGTGG + Exonic
1171772847 20:29338817-29338839 CTCCATTCAGGAGCCTGAGGCGG - Intergenic
1172146820 20:32762972-32762994 CTGCCTCCAGGAGCCCGAAGAGG + Intronic
1172239418 20:33402456-33402478 ATCCTTCCAGGTGCACTAGGAGG + Intergenic
1173605380 20:44327374-44327396 CTGGGTCCTGGAGCCCTAAGGGG - Intergenic
1173823066 20:46030942-46030964 CTCCGGCCAGAAGCCCGCGGGGG - Intronic
1174295661 20:49543368-49543390 CTCCATCCAGCAGCCAGAGGGGG + Intronic
1174787116 20:53443534-53443556 TTCCATCCATGAGCCCTGGGTGG + Intronic
1174787724 20:53448155-53448177 CTTCTTCCAGGAGGCCGAGGTGG - Intronic
1175308026 20:57991449-57991471 CGCCTTCCACCAGCCCTAGGCGG - Intergenic
1176315270 21:5236958-5236980 CACAGGCCAGGAGGCCTAGGAGG + Intergenic
1179384493 21:40929380-40929402 CACAGTCCTGGAGGCCTAGGAGG - Intergenic
1179577201 21:42315377-42315399 CTGCGTCCCGGAGCCCACGGTGG - Exonic
1180318243 22:11296690-11296712 CTCCATTCAGGAGCCTGAGGTGG - Intergenic
1180393056 22:12302912-12302934 CACAGACCAGGAGGCCTAGGAGG + Intergenic
1180406694 22:12561856-12561878 CACAGACCAGGAGGCCTAGGAGG - Intergenic
1183120274 22:35725030-35725052 CTCTGGCCTGGAGCCCTGGGTGG - Intronic
1183662174 22:39227706-39227728 CTCCGTCCTGGATTCCCAGGTGG + Intronic
1183947657 22:41335873-41335895 CTCGGTCCAGGCGCCCTGCGAGG - Intronic
1184479107 22:44736863-44736885 CCCCGTGCAGGAGCACGAGGCGG + Exonic
1184479646 22:44738985-44739007 CTCCATCATGGAGCCCGAGGTGG + Intronic
949693484 3:6667520-6667542 CACAGGCCAGGAGGCCTAGGAGG + Intergenic
953235610 3:41103649-41103671 CTGATTCCAGGAACCCTAGGAGG - Intergenic
953503718 3:43462741-43462763 CACAGGCCAGGAGGCCTAGGAGG + Intronic
955146966 3:56329390-56329412 CTACCTCCAGGAGCCCTATCAGG + Intronic
956019302 3:64916410-64916432 CCCTGTCCAGGAGCCCTTAGAGG - Intergenic
960615524 3:119592458-119592480 CTGAATCCAGGAGACCTAGGAGG + Intergenic
960960512 3:123067395-123067417 CTGCGTCCGGGAGCGCTTGGCGG - Intronic
961067840 3:123891187-123891209 CACAGGCCAGGAGGCCTAGGAGG - Intergenic
961825285 3:129596091-129596113 GTCCTTCCATAAGCCCTAGGTGG - Intronic
962132981 3:132702231-132702253 CTCTGACCAGGAGATCTAGGTGG - Intronic
963683588 3:148410683-148410705 CACAGTCCTGGAGGCCTAGGAGG - Intergenic
966881017 3:184351335-184351357 CTGCGTCCAGGACTCCTAAGGGG - Intronic
968137353 3:196228720-196228742 CTCAGCCCAGGAGCCCTGTGAGG + Intronic
970756802 4:19437137-19437159 CACAGGCCAGGAGGCCTAGGAGG + Intergenic
972781997 4:42294228-42294250 CTCCCTCCTGGAGCCCTTGCTGG - Intergenic
972887543 4:43510533-43510555 CTCAGGCCAGGAGGCATAGGAGG - Intergenic
974846062 4:67352065-67352087 CTCAGGCCTGGAGGCCTAGGAGG - Intergenic
977887809 4:102272851-102272873 CTCCCTCCTGGAGCCAAAGGAGG + Intronic
978806234 4:112803548-112803570 CTCCCTCCAGAAGCTCTAGAGGG - Intergenic
984281447 4:177675359-177675381 CTCTGTCCAGGACCTCAAGGAGG - Intergenic
985304273 4:188521817-188521839 CACTGGCCAGGAGGCCTAGGAGG + Intergenic
985717305 5:1469858-1469880 CTCAGATCAGGGGCCCTAGGAGG + Intronic
985915967 5:2919541-2919563 CTCAGTCCAGCAGCCCTTGCAGG + Intergenic
985971278 5:3380642-3380664 CTCCCTCCAGGGGCTCCAGGGGG - Intergenic
986401968 5:7391435-7391457 CTCCTTCCATGAGCGCTGGGAGG - Intergenic
987918596 5:24248945-24248967 CACAGTCCTGGAGGCCTAGGAGG - Intergenic
988134842 5:27157849-27157871 CACAGGCCAGGAGGCCTAGGAGG + Intergenic
989201827 5:38771690-38771712 CTCTGTCCCGGAGGCCAAGGTGG + Intergenic
989778154 5:45233354-45233376 CACAGGCCAGGAGGCCTAGGAGG - Intergenic
991293749 5:65059739-65059761 CACCGGCCCGGAGGCCTAGGAGG + Intergenic
992591802 5:78303354-78303376 CTCCCTCCAGAAGCTCTAGGGGG + Intergenic
992816334 5:80443540-80443562 CTCAGTACAGGAGCACCAGGAGG + Intronic
993084637 5:83348595-83348617 CACAGGCCAGGAGGCCTAGGAGG - Intronic
996349620 5:122523886-122523908 CTCCGTTGAGGCTCCCTAGGTGG + Intergenic
1000229143 5:159298634-159298656 CACAGGCCAGGAGGCCTAGGAGG - Intergenic
1002464537 5:179400173-179400195 CACAGGCCAGGAGGCCTAGGAGG + Intergenic
1004322097 6:14639924-14639946 CTCAGACCAGAAGCCCTGGGGGG - Intergenic
1009547027 6:65033426-65033448 CACAGGCCAGGAGGCCTAGGAGG + Intronic
1018686245 6:166307172-166307194 CTCCGCCTAGGGGCCCTCGGGGG - Exonic
1018990697 6:168671451-168671473 CTCCGTCCTGCATCCCTGGGGGG + Intronic
1018990716 6:168671504-168671526 CTCCGTCCTGCATCCCTGGGGGG + Intronic
1019183969 6:170210068-170210090 CTCGGTCCAGGTGCCCTGGGGGG + Intergenic
1019496307 7:1342091-1342113 CTCCATCCAGGAGGCCCTGGAGG - Intergenic
1021061420 7:16117511-16117533 CTCCCTCCAGCAGCCCTGGCTGG + Intronic
1025267317 7:57474428-57474450 CACAGACCAGGAGCCATAGGAGG + Intergenic
1025650118 7:63459195-63459217 CACAGGCCAGGAACCCTAGGAGG + Intergenic
1025721533 7:64020291-64020313 CACAGGCCAGGAGCCCTAGGAGG + Intergenic
1025985712 7:66449576-66449598 ATCCCTCCAGGAGCCCAATGTGG + Intergenic
1026002559 7:66572878-66572900 ATCCCTCCAGGAGCCCAATGTGG + Intergenic
1028668392 7:93372643-93372665 CTCAGGCCTGGAGGCCTAGGAGG - Intergenic
1029191465 7:98775136-98775158 CTCGATACAGGAGCCCCAGGAGG + Intergenic
1029495537 7:100894151-100894173 CTCCACCCAGGAGCCAGAGGAGG + Exonic
1033657509 7:143383137-143383159 TTCAGTCCTGGAGCCCCAGGTGG + Exonic
1034265681 7:149779578-149779600 CTGCGTCTATGAGCCCCAGGGGG - Intergenic
1034751090 7:153569541-153569563 CACAGGCCAGGAGGCCTAGGAGG - Intergenic
1036638120 8:10565247-10565269 CTCGGTCCAGGCTCCCTGGGTGG - Intergenic
1037826511 8:22163582-22163604 CTCCTCCCAGCAGCCCTGGGAGG - Intronic
1038235168 8:25745913-25745935 GTCCTTCCTGGAGCCCTGGGTGG - Intergenic
1041163781 8:55071797-55071819 CTCCTTCTAGGAGCCCTAGCAGG + Intergenic
1042989290 8:74620729-74620751 CACAGGCCAGGAGGCCTAGGTGG - Intronic
1043266323 8:78271220-78271242 CACAGGCCAGGAGACCTAGGAGG - Intergenic
1044087243 8:87956050-87956072 CACAGGCCAGGAGGCCTAGGAGG - Intergenic
1044395663 8:91708139-91708161 CACAGTCCTGGAGGCCTAGGAGG + Intergenic
1044504703 8:93004424-93004446 CTCAGGCCTGGAGGCCTAGGAGG - Intronic
1049221886 8:141432186-141432208 CTCCGTCCTGGGGCCCCAGGAGG + Exonic
1051013496 9:12447791-12447813 CACAGACCTGGAGCCCTAGGAGG + Intergenic
1053052217 9:34971448-34971470 CTCCGTCCAGGAGGTACAGGAGG + Exonic
1053152299 9:35750770-35750792 CTCCCTCCAGGAGACTTAGAAGG - Intronic
1053721032 9:40946653-40946675 CACAGGCCAGGAGGCCTAGGAGG - Intergenic
1054344957 9:63905502-63905524 CACAGGCCAGGAGGCCTAGGAGG + Intergenic
1062600949 9:137318353-137318375 CTCTGCCCGGGAGCCCTCGGAGG + Intronic
1203366470 Un_KI270442v1:262452-262474 CTCCATTCAGGAGCCTGAGGTGG - Intergenic
1185802308 X:3024097-3024119 CCCCGTCCAGGGGCTCCAGGTGG - Exonic
1189058618 X:37727817-37727839 CTCCGTCCTGAAGACCTGGGTGG + Exonic
1191625985 X:63271969-63271991 CTAAGAACAGGAGCCCTAGGTGG + Intergenic
1193482402 X:82043979-82044001 CACAGGCCAGGAGGCCTAGGAGG + Intergenic
1194893239 X:99406536-99406558 CACAGGCCAGGAGGCCTAGGAGG + Intergenic
1197088707 X:122510521-122510543 CACAGACCAGGAGGCCTAGGAGG - Intergenic
1197109602 X:122756710-122756732 CACAGTCCAGGAGGCCTAAGAGG - Intergenic
1197441252 X:126494163-126494185 CACAGGCCTGGAGCCCTAGGAGG + Intergenic
1198944187 X:141991530-141991552 CACAGGCCAGGAGGCCTAGGAGG + Intergenic
1199515300 X:148668749-148668771 CACAGGCCAGGAGGCCTAGGAGG - Intronic
1201072206 Y:10157779-10157801 CTCCATTCAGGAGCCTGAGGCGG + Intergenic