ID: 900094923

View in Genome Browser
Species Human (GRCh38)
Location 1:936401-936423
Sequence CCCCTCCGTCCAGGAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 2, 1: 3, 2: 1, 3: 39, 4: 259}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900094923_900094945 29 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094945 1:936453-936475 CCGGGAAGGATGGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 22
4: 177
900094923_900094931 3 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094931 1:936427-936449 CCCGGTCGGTCCCGCCTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 57
900094923_900094943 28 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094943 1:936452-936474 TCCGGGAAGGATGGGGTTCTCGG 0: 1
1: 0
2: 1
3: 13
4: 155
900094923_900094938 15 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094938 1:936439-936461 CGCCTTCTAGGGCTCCGGGAAGG 0: 1
1: 0
2: 6
3: 12
4: 107
900094923_900094942 21 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094942 1:936445-936467 CTAGGGCTCCGGGAAGGATGGGG 0: 1
1: 0
2: 3
3: 22
4: 206
900094923_900094941 20 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094941 1:936444-936466 TCTAGGGCTCCGGGAAGGATGGG 0: 1
1: 0
2: 1
3: 16
4: 118
900094923_900094940 19 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094940 1:936443-936465 TTCTAGGGCTCCGGGAAGGATGG 0: 1
1: 0
2: 1
3: 16
4: 167
900094923_900094934 10 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094934 1:936434-936456 GGTCCCGCCTTCTAGGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 112
900094923_900094933 4 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094923_900094935 11 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094935 1:936435-936457 GTCCCGCCTTCTAGGGCTCCGGG 0: 1
1: 5
2: 1
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900094923 Original CRISPR CCCCTCCGTCCAGGAGCCCT AGG (reversed) Intronic
900094857 1:936245-936267 CCCTTCCGTCCAGGAGCCCTAGG - Intronic
900094874 1:936284-936306 CCCCTCCGTCCAGGAGCCCTAGG - Intronic
900094890 1:936323-936345 CCCTTCCGTCCAGGAGCCCTAGG - Intronic
900094906 1:936362-936384 CCCTTCCGTCCAGGAGCCCTAGG - Intronic
900094923 1:936401-936423 CCCCTCCGTCCAGGAGCCCTAGG - Intronic
900438538 1:2642442-2642464 GCCCTCCGTCCAGCAGCCCCAGG - Intronic
900529772 1:3147420-3147442 GGCCTCCGACCAGGTGCCCTGGG + Intronic
900757399 1:4446036-4446058 CCCCTGCCTCCAGCAGCCCCTGG - Intergenic
901441574 1:9281491-9281513 CCCGCCAGGCCAGGAGCCCTGGG - Intergenic
901916908 1:12507072-12507094 CCCCTCCCACCAGAAGCCCATGG + Exonic
901923622 1:12552661-12552683 CCCCTCTGTGCAGGCGCCGTGGG - Intergenic
902179112 1:14674411-14674433 CCCTTCCTTCCAGGAGCCCAGGG - Intronic
902776670 1:18679315-18679337 CTCCTCAGTGCTGGAGCCCTGGG - Intronic
903128594 1:21263828-21263850 CCCCTGGTTCCAGGAGCCCACGG + Intronic
903926754 1:26835909-26835931 CCCCACAGGGCAGGAGCCCTGGG - Intronic
904278115 1:29397303-29397325 CCCCTAGGTTAAGGAGCCCTGGG - Intergenic
904320601 1:29695591-29695613 CCTCTCCCTACAGGAGTCCTGGG + Intergenic
904604475 1:31691301-31691323 CTCCTCCAGCCAGGATCCCTGGG + Intronic
905390765 1:37634303-37634325 CCCCTCCATCCCGCAGCCCCGGG - Intronic
905396909 1:37672559-37672581 TTCCTCCGTCCAGTTGCCCTTGG - Intergenic
906955486 1:50370570-50370592 GACCTCCTTCAAGGAGCCCTGGG + Intergenic
907113583 1:51949486-51949508 CCCCTCCCTCCAGGGGCCGAAGG - Intronic
912380614 1:109246260-109246282 CCCCACAGTCCAGGAGCTCCAGG + Intergenic
914917204 1:151826080-151826102 CCCCCCAGTCCAGAAGCACTGGG - Intronic
915107720 1:153544885-153544907 CCCATCCCTCCAGGAGCACTTGG + Intronic
915949808 1:160181592-160181614 TCCCACCTTCCAGGACCCCTGGG - Intronic
917967179 1:180186266-180186288 CCCCTCCCTCCAGAAGCCCATGG + Intronic
922125245 1:222714671-222714693 CCCCTGAGTCCAGGAGACGTAGG - Intronic
923558121 1:235017819-235017841 CACCTCACTCCAGGAGCTCTAGG + Intergenic
924650699 1:245924581-245924603 CCCTTCCTTTCAGGAGCCATGGG + Intronic
1062854574 10:773526-773548 GATCTCCGTCCAAGAGCCCTGGG - Intergenic
1063194682 10:3730274-3730296 CCCCGCAGGCCAGGTGCCCTGGG + Intergenic
1063421471 10:5915920-5915942 CCTCTACATCCAGGAGACCTGGG - Intronic
1063715095 10:8519259-8519281 CCACTCCTTCCAGGGGCTCTAGG - Intergenic
1064435905 10:15311019-15311041 CCCATCCTTCCAGCAGCCCTAGG - Intronic
1067350355 10:45470237-45470259 TCCCTCCTTCCTGGAGGCCTGGG + Intronic
1069869892 10:71526672-71526694 CCCCTCCATCCAGTACCCCTGGG - Intronic
1070404290 10:76080952-76080974 CACCTCCATCCAAGAGCCCTTGG + Intronic
1071817853 10:89251421-89251443 CCTCGCGGTCCAGGAGCACTGGG + Intronic
1073216601 10:101840042-101840064 CCCCCCCGTCCAGGAACTTTGGG - Intronic
1073423051 10:103439913-103439935 CCCCTTTCTCCAGGAGCCCTGGG + Intronic
1074945309 10:118275502-118275524 TCCCTCCTTCTAGGAGCCCAGGG + Intergenic
1075693887 10:124419294-124419316 TCCCTCCCTCCAGGAGCACAGGG - Intergenic
1076312290 10:129517188-129517210 CCTCGCTGTCCAGGAGCCATGGG - Intronic
1076631777 10:131856085-131856107 CTCCTCCCTCCAGGACCCCGAGG + Intergenic
1076758866 10:132590007-132590029 ACCATCCGTGCAGGAGCCATGGG - Intronic
1076877760 10:133224989-133225011 CCCCTCCGCCCCCGAACCCTGGG + Exonic
1076905701 10:133359740-133359762 CCCCTCCCTCCAGGCTCCCTGGG + Intergenic
1077339292 11:2018828-2018850 CCCCTTCGCCCAGGTCCCCTCGG + Intergenic
1083058278 11:59844029-59844051 TCCCTCAGCACAGGAGCCCTTGG - Exonic
1083170876 11:60923578-60923600 CCCTTCCCTCCAGGAGCACAAGG + Intergenic
1083995320 11:66268846-66268868 CCCCTCCCCCCAGGGGCCCCAGG + Intronic
1084165921 11:67374682-67374704 CCCCTCCTTCCCGCAGGCCTGGG + Intronic
1084980646 11:72826854-72826876 CCCCACCAGCCAGGAGCCCCAGG + Intronic
1085174558 11:74474644-74474666 CCCCTCAGACCAGGAGCTCCTGG + Intergenic
1085174564 11:74474653-74474675 CCCCTCCTTCCAGGAGCTCCTGG - Intergenic
1088522222 11:110712284-110712306 CCCCTCCGGCCGGCAGCCCGCGG - Exonic
1088796700 11:113271710-113271732 CCCCTCCCTGCAGCTGCCCTAGG + Intronic
1089314720 11:117583630-117583652 CCCATCAGCCCCGGAGCCCTTGG + Intronic
1090204639 11:124877588-124877610 CCCCTCGGCCCAGGAACCCAGGG + Exonic
1090237848 11:125162934-125162956 CTCCTCCCTCCAGGGGTCCTGGG + Intergenic
1090799413 11:130161006-130161028 CCCCTCCTTCCGGGTGCCCCTGG + Intronic
1202822276 11_KI270721v1_random:74010-74032 CCCCTTCGCCCAGGTCCCCTCGG + Intergenic
1091760077 12:3081366-3081388 CTCCTCCCTCCTGGAACCCTTGG + Intronic
1092447254 12:8568584-8568606 CTCCTTCGTGCAGGAGACCTGGG + Intergenic
1096220136 12:49823968-49823990 CCCCACCGCCCAGCAGCCCTCGG - Intronic
1096659503 12:53115512-53115534 CGCCTGCGTCCAGGTGCCCCTGG - Exonic
1097017331 12:55996920-55996942 CCCCTCCCTGGAGGAGGCCTCGG - Intergenic
1103941308 12:124502794-124502816 CCCCTGTGTCGAGGAGCACTGGG + Intronic
1104719202 12:131035240-131035262 CCACCCGGTCCAGGAGCGCTGGG - Intronic
1104917792 12:132274931-132274953 CCCCTGCTGCCAGGAGCCCACGG - Intronic
1104975122 12:132548771-132548793 CACCCCCGTCCAGGTGCCCCCGG - Intronic
1113870017 13:113553651-113553673 CACCTCCGTCCAGGACTCCGGGG + Intronic
1118366603 14:65102122-65102144 CCGCTCCGGCCAGGAGCCGGAGG + Intronic
1119704997 14:76777882-76777904 CCTCTCCTTCCAGGAGCCACAGG - Intronic
1122640407 14:103156112-103156134 CTCATACGTGCAGGAGCCCTGGG + Intergenic
1122840709 14:104461482-104461504 CCCCTACGGAGAGGAGCCCTGGG + Intergenic
1122878697 14:104680332-104680354 ACCTCCCGTCCAGCAGCCCTAGG + Intergenic
1122974277 14:105164644-105164666 CCCCTGCATCCAGCCGCCCTAGG - Intronic
1122975453 14:105168934-105168956 CCCCGCCGCCCGGGCGCCCTGGG - Intergenic
1123106882 14:105845922-105845944 CCCTCCCTTCCAGGAGCTCTCGG - Intergenic
1123477393 15:20599286-20599308 CCCCTGCCCCCAGGAGCCCTTGG - Intergenic
1123640623 15:22401096-22401118 CCCCTGCCCCCAGGAGCCCTTGG + Intergenic
1124167704 15:27342810-27342832 GCTCTGCGTCCAGGAGCCCCTGG - Intronic
1124238851 15:28013621-28013643 CCCCTCCCTCCAGCAGCCAGAGG - Intronic
1124355691 15:28993247-28993269 GCCCTCTGTCCAGGAGACATAGG + Intronic
1125724354 15:41860749-41860771 CCACTCCCACCAGGACCCCTTGG - Exonic
1126665703 15:51074837-51074859 CCCCTCCCACCATGAGCCCCTGG + Intronic
1128151058 15:65363661-65363683 CGCCTCCTGCCAGGACCCCTGGG + Intronic
1129455721 15:75675379-75675401 CCACTCTGTCCCGGACCCCTGGG + Exonic
1129759666 15:78122121-78122143 CCCCTGGGTCCAGGAACCCAAGG + Intronic
1130274546 15:82469569-82469591 TGCCTCCGTCCAGGGCCCCTGGG - Intergenic
1130589188 15:85201536-85201558 TGCCTCCGTCCAGGGCCCCTGGG - Intergenic
1131401507 15:92129106-92129128 TCCCACCTTCCAGGAGTCCTTGG + Intronic
1131507086 15:93028715-93028737 CCCCTGCGTCCAAGTCCCCTGGG - Intergenic
1132163601 15:99565234-99565256 TCCCTCCCTCGAGGCGCCCTTGG - Intergenic
1132621076 16:868562-868584 GCCCTCACTCCAGGAGCCCCAGG - Intronic
1132672429 16:1107320-1107342 CCTCTGCCTCCAGGTGCCCTGGG + Intergenic
1132855857 16:2044272-2044294 CCTCACCCTCCAGGAGCCCTGGG - Intronic
1133020475 16:2964735-2964757 CCCGCCCCTGCAGGAGCCCTCGG - Intronic
1133457356 16:5954219-5954241 CCCCTCCATCCATGAGACCACGG - Intergenic
1133717793 16:8466066-8466088 CTCCTTTGTCCTGGAGCCCTAGG - Intergenic
1134120488 16:11580734-11580756 CACCTGCCTCCAGGAGCCCCAGG + Intronic
1134827031 16:17293184-17293206 CCCAACCTTCCAGGACCCCTAGG - Intronic
1137393215 16:48098456-48098478 CCCCTCTGACCAGCCGCCCTGGG + Intronic
1137809984 16:51343482-51343504 CCACTCCTTTAAGGAGCCCTTGG - Intergenic
1141720965 16:85754984-85755006 CCCCACCCTGCAGGACCCCTAGG - Intergenic
1143161901 17:4877420-4877442 TCCCTCCGTCCAGGTCCCTTTGG + Intronic
1144547875 17:16215067-16215089 CCCCTCCGCACAGGACACCTCGG + Intronic
1144840738 17:18184149-18184171 CCCCTCCCTCCGGGGGCCCCGGG + Intronic
1147496906 17:40925361-40925383 TCTCTCCCTCCAGGAGCCGTCGG + Exonic
1147758025 17:42781015-42781037 TCCCTCGGTCCACGTGCCCTCGG - Exonic
1147978642 17:44261735-44261757 CCCCTCCTTCCCAGTGCCCTGGG + Intronic
1148783790 17:50135470-50135492 CCCCTCCCTCCAGGACCCACAGG + Intronic
1148875287 17:50683597-50683619 CCCCTCCTGCCAGGCGCCCTGGG + Exonic
1150477466 17:65486020-65486042 CCCCACCCTCCAGGAGACCGTGG + Intergenic
1151946717 17:77323651-77323673 CACCGCCCTCCAGGAGGCCTCGG - Intronic
1152065853 17:78112240-78112262 CCCCGCAGGCCTGGAGCCCTGGG + Exonic
1152065865 17:78112278-78112300 CCCCGCAGACCTGGAGCCCTGGG + Exonic
1152088128 17:78232401-78232423 TCCCTCCCTCCTGTAGCCCTTGG - Intronic
1152111407 17:78359499-78359521 CCGCTCAGTCCAGTAGCCCCGGG + Intronic
1152593225 17:81223631-81223653 CCCCTCTCTCCGGGAGCCCTGGG + Intergenic
1152721795 17:81927214-81927236 CCCCTCCCTCCAGGACGCCCGGG + Intronic
1152891080 17:82882036-82882058 CCCAACCATCCAGGAGCCCCAGG - Intronic
1153636543 18:7117835-7117857 CCCCTCCCTCCAGCCGCCCTCGG + Intergenic
1154001756 18:10487668-10487690 GCCCACCTGCCAGGAGCCCTCGG - Exonic
1156332536 18:36137258-36137280 CACCTGAGTCCAGGAGTCCTTGG - Intronic
1156469986 18:37371395-37371417 CCCCTGAGGCCAGGATCCCTGGG - Intronic
1160766140 19:808919-808941 CCCCTCCCTTGAGCAGCCCTCGG - Intronic
1161306561 19:3572386-3572408 CCCCTATGGCCAGAAGCCCTCGG + Intronic
1161797173 19:6393776-6393798 CCCATCCGGCCAGCAGCTCTTGG - Intronic
1162197603 19:8997711-8997733 CCTCTCCTCCCTGGAGCCCTAGG - Intergenic
1162534112 19:11253156-11253178 CCCCTCCCTCCAGGGGCTCCAGG + Intronic
1165496078 19:36152468-36152490 CTCCTCTGTCCAGGAACCCCAGG + Exonic
1166071540 19:40390767-40390789 CCCCTTCATCCCAGAGCCCTAGG - Intergenic
1166882974 19:45940281-45940303 CCCCCGCCTCCCGGAGCCCTGGG - Exonic
1167649118 19:50719859-50719881 CCCCTCCCTCCGGGAGCCGGCGG + Intergenic
925711242 2:6742950-6742972 CGCCTCCTTCAAGGAGTCCTGGG - Intergenic
927972965 2:27317156-27317178 TCCTTCAGTCCAGGAGGCCTGGG + Intronic
930058204 2:47268182-47268204 CCCCTCCTTCCAGGAGGGCCTGG + Intergenic
932702246 2:73999972-73999994 CCCTGCCTTCCAGCAGCCCTCGG - Intronic
934779386 2:96960218-96960240 CCCCTCCCTCCTGGAGTCCAGGG - Intronic
936039059 2:109135307-109135329 CCCCTCCTTCCACGTGTCCTGGG - Intronic
937029351 2:118725215-118725237 CCCCTGCTTCCTGGAGCCCCCGG - Intergenic
937338499 2:121076305-121076327 CTCCTGCGCCAAGGAGCCCTAGG - Intergenic
938070422 2:128305497-128305519 CCCCTCCAACCGGGAGCCCTGGG + Intronic
941066323 2:160907106-160907128 GCCCTCCACCCAGGAGCCCTTGG - Intergenic
942444523 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG + Intergenic
942693526 2:178612863-178612885 CCTGTCCTTCCATGAGCCCTGGG + Exonic
943524017 2:188994249-188994271 CCCATCAGTCCAGGAGCTCCAGG - Exonic
944684472 2:202105919-202105941 TCCCTCCCTCCAGCATCCCTCGG + Exonic
947715572 2:232337402-232337424 CTCCTCTGTCCAGGCTCCCTTGG - Intronic
947721097 2:232369753-232369775 CTCCTCTGTCCAGGCTCCCTTGG - Intergenic
947741927 2:232488534-232488556 CCCCTCTGGCCAGCAGCCCTAGG + Intergenic
947863885 2:233382543-233382565 CCCCTCTGTCCAGGTCACCTTGG + Intronic
948479001 2:238239023-238239045 CCACTCCGTCCAGGGGCTCTAGG + Exonic
948576727 2:238956444-238956466 CCACTCTGGCCTGGAGCCCTTGG - Intergenic
949043151 2:241858632-241858654 CCCCTCGCTCCGGGACCCCTGGG + Intronic
1169801380 20:9515657-9515679 GCCCTTCGCCCTGGAGCCCTAGG - Intronic
1169937230 20:10896667-10896689 CCCCACCCTCCTGGAGCCTTGGG + Intergenic
1170190642 20:13641481-13641503 CCCCTCTGTCCTGGTTCCCTGGG + Intergenic
1171058938 20:21937131-21937153 CCCCTGGGCCCAGGAGCCCTTGG - Intergenic
1171372487 20:24670607-24670629 CCCCCCCTCCCGGGAGCCCTGGG - Intergenic
1172275798 20:33678396-33678418 CCCCTCTGGCCAGGAGCCCTGGG + Intronic
1172360847 20:34311790-34311812 CCCCTCCCTCCAGGCCCCCTGGG + Intronic
1173823071 20:46030945-46030967 CCCCTCCGGCCAGAAGCCCGCGG - Intronic
1173843530 20:46174374-46174396 CCCCTCCGTCCAGCCGCCAAGGG + Exonic
1175250683 20:57608710-57608732 ACTCTCCCTCCAGGACCCCTGGG - Intronic
1175308029 20:57991452-57991474 CCCCGCCTTCCACCAGCCCTAGG - Intergenic
1175368495 20:58471224-58471246 CCCCTCCACCAAGGAGCCCTGGG + Intronic
1175760982 20:61562098-61562120 TCCCTCTCTCCGGGAGCCCTGGG - Intronic
1175761024 20:61562238-61562260 CCTCTCTCTCCGGGAGCCCTGGG - Intronic
1175761068 20:61562380-61562402 CCTCTCTCTCCGGGAGCCCTGGG - Intronic
1175883024 20:62271379-62271401 CCCGTCCCTCCAGGATGCCTCGG - Intronic
1175937847 20:62523128-62523150 CCCCTGCCTCCTGCAGCCCTGGG + Intergenic
1176430225 21:6570919-6570941 CCCCTCCTTCCCGGTGCCCCTGG - Intergenic
1178906547 21:36641836-36641858 GCACTGAGTCCAGGAGCCCTGGG - Intergenic
1179705619 21:43178381-43178403 CCCCTCCTTCCCGGTGCCCCTGG - Intergenic
1179950800 21:44707916-44707938 CCCACCCTTCCCGGAGCCCTGGG + Intronic
1181038184 22:20179796-20179818 CCCCTCTGCCCAGCTGCCCTGGG + Intergenic
1181116818 22:20636607-20636629 CCACTCTGCCCAGGAGCCCCGGG - Intergenic
1181935331 22:26434092-26434114 GCCCTCCATCCAGAAGCCCGAGG + Exonic
1183038601 22:35159331-35159353 CCCCACCTTGCAGGCGCCCTGGG - Intergenic
1183120275 22:35725033-35725055 CCACTCTGGCCTGGAGCCCTGGG - Intronic
1184234034 22:43173687-43173709 CCCCGCAGACCAGGAGCCCCAGG - Intronic
1184339619 22:43879112-43879134 CCCTTCCCTCCAGGACCCCCTGG - Intergenic
1184502638 22:44883097-44883119 CCCCACCGTCCAGCACCCCCAGG - Exonic
1185094047 22:48796364-48796386 CCCCTCCGTCCCGGTGCACCTGG + Intronic
951139759 3:19147105-19147127 CCCCTCCCTCCCGGAGCCCAAGG + Intergenic
952959957 3:38583008-38583030 CCCCAACCTCCAGGAGTCCTGGG + Intronic
953414015 3:42705314-42705336 CCCCTGCTCCCAGGAGCCCAGGG - Intronic
953458585 3:43063280-43063302 CTCCTCAGTGCAGGAGCTCTGGG + Intergenic
954149632 3:48650951-48650973 CCCTGTCGCCCAGGAGCCCTTGG - Exonic
955960771 3:64339477-64339499 CCTCTCCGTCCCTGAGCCCTAGG - Intronic
958595072 3:96212027-96212049 CCCCACCCTCCAACAGCCCTCGG - Intergenic
959703290 3:109317804-109317826 CCCTTCAGCCCAGGAGCCCGAGG + Intergenic
960960515 3:123067398-123067420 CCCCTGCGTCCGGGAGCGCTTGG - Intronic
960961052 3:123070607-123070629 CCCCTGTGTCCAGGAGCACTTGG - Intronic
961530481 3:127537244-127537266 CCCCACCCACCAGGAGCCCAGGG + Intergenic
961745791 3:129062746-129062768 CTCCTCCCTCCAGGGGCCTTTGG - Intergenic
963160957 3:142149908-142149930 CCCCTCCTTCCAAGAGAGCTGGG - Intergenic
966917296 3:184592127-184592149 CTCCTCCACCCAGGAGGCCTGGG - Intronic
969103394 4:4786766-4786788 CTCCACCCTCCAGGTGCCCTTGG - Intergenic
969848083 4:9935421-9935443 CACCTGCTTCCAGGAGCCTTGGG + Intronic
970637104 4:18021668-18021690 CCGCTCAGTGCCGGAGCCCTCGG - Exonic
972533008 4:39977407-39977429 CCCCTCCCTCCAGCAGCCTAGGG + Intronic
985078396 4:186241304-186241326 ACCCTCCTTCCAGGAGCCTTAGG - Intronic
985247492 4:187992693-187992715 ATCTTCAGTCCAGGAGCCCTGGG - Intergenic
985573247 5:661976-661998 CCTCTCCCTCCAGGATCCCAGGG + Exonic
986712759 5:10499713-10499735 GCACTCCGTCCAGGATACCTGGG - Intergenic
988944109 5:36177892-36177914 TGCCTCTGTCCAGGAGACCTAGG - Intronic
989566448 5:42905972-42905994 CCCTTGTGTTCAGGAGCCCTTGG + Intergenic
992591797 5:78303351-78303373 ACCCTCCCTCCAGAAGCTCTAGG + Intergenic
995417268 5:111925158-111925180 CCGTTACGCCCAGGAGCCCTGGG - Intronic
995549704 5:113268584-113268606 CCCCTCCATCCACTAGGCCTAGG + Intronic
997283959 5:132665240-132665262 CCCCTCGGTCCCTGTGCCCTTGG + Intergenic
997297218 5:132776129-132776151 CCCTTCCCTCCAACAGCCCTGGG + Intronic
997351964 5:133237197-133237219 CTTCTCCGTCCTGCAGCCCTCGG + Intronic
999375059 5:151080985-151081007 TGCCCCCGTCCAGGAGCCCTAGG - Intronic
1001447804 5:171799509-171799531 TCCCTCCTTCCAGCAGCCCCTGG - Intergenic
1001684304 5:173581918-173581940 GGCCTCAGCCCAGGAGCCCTGGG + Intergenic
1002052863 5:176581456-176581478 CCTCTCTGTCCAGGGGCCCCAGG - Exonic
1002428107 5:179187595-179187617 CCCCTCCCCCCAGCAGCCCTGGG + Intronic
1005463620 6:26091368-26091390 CCCGTACTTCCAGTAGCCCTCGG - Exonic
1006756837 6:36423515-36423537 CCGCTCCCGCCAGGAGCCCGAGG - Intronic
1007335202 6:41150652-41150674 CCCCTCCATCCCTCAGCCCTGGG + Intronic
1007382439 6:41499522-41499544 ACCCTCTGCCCACGAGCCCTAGG + Intergenic
1008466615 6:51838376-51838398 CCACTCAGTCCAGAAGCCATTGG - Intronic
1010637968 6:78283655-78283677 CCCATGGGTGCAGGAGCCCTGGG - Intergenic
1015478001 6:133675052-133675074 GCCCACAGTCCAGGAGCCCCAGG - Intergenic
1018686248 6:166307175-166307197 CCACTCCGCCTAGGGGCCCTCGG - Exonic
1018856544 6:167679048-167679070 CCCCTCCGTCCAGCATCCCGGGG + Intergenic
1018857596 6:167685723-167685745 GCCCTCCCTCCCTGAGCCCTGGG - Intergenic
1018907852 6:168085619-168085641 CCCTTCCGTCCAGGCCTCCTTGG - Intergenic
1018990694 6:168671448-168671470 CCTCTCCGTCCTGCATCCCTGGG + Intronic
1018990713 6:168671501-168671523 CCTCTCCGTCCTGCATCCCTGGG + Intronic
1019155265 6:170034279-170034301 CCCTTCTCTCCAGGAGCCCTCGG - Intergenic
1019174633 6:170153909-170153931 CCCCTCCAGCCAGTACCCCTGGG - Intergenic
1019265915 7:117571-117593 CCCTCCCGTGCGGGAGCCCTGGG + Intergenic
1019277266 7:182359-182381 CCCTCCCGTGCGGGAGCCCTGGG + Intergenic
1019320500 7:413278-413300 CCCCTCCCTCCCAGACCCCTTGG - Intergenic
1019496308 7:1342094-1342116 CCACTCCATCCAGGAGGCCCTGG - Intergenic
1019993440 7:4708116-4708138 CCCCGCCCTCCAGGAGTGCTTGG + Intronic
1020077122 7:5265447-5265469 CCCATCCTTCCATCAGCCCTGGG + Intergenic
1021468885 7:20978952-20978974 CCACTCTGCCCAGGACCCCTTGG + Intergenic
1022526982 7:31044447-31044469 CCCCTCCCACCAGGTGCCCCTGG - Intergenic
1022598443 7:31734453-31734475 CCCCTGCACCAAGGAGCCCTGGG + Intergenic
1023059802 7:36316201-36316223 TCCCTCCTTCCAGGTGGCCTGGG + Intergenic
1023819091 7:43970454-43970476 ACCCTCCTCCCAGCAGCCCTAGG - Intergenic
1023819140 7:43970718-43970740 ACCCTCCTCCCAGCAGCCCTAGG - Intergenic
1024245931 7:47470707-47470729 CCACTCCGGCTAGGAGGCCTGGG - Intronic
1024797453 7:53036160-53036182 CCCCGCCGCCCAGGAGCTCCTGG + Exonic
1025201988 7:56968200-56968222 CCCATCCTTCCATCAGCCCTGGG - Intergenic
1025669959 7:63608728-63608750 CCCATCCTTCCATCAGCCCTGGG + Intergenic
1026053732 7:66967448-66967470 CCTCTCCCTCCAGGAGGGCTAGG - Intergenic
1026968230 7:74453707-74453729 CCCCTGCGTCCCGGGGACCTGGG - Intergenic
1029463015 7:100706986-100707008 CCCCTCCGTCCAGCAGCTTCTGG - Exonic
1029711097 7:102300441-102300463 CCCCTCCTTCCAGCTCCCCTAGG - Intronic
1029744144 7:102507413-102507435 ACCCTCCTCCCAGCAGCCCTAGG - Intronic
1029744191 7:102507681-102507703 ACCCTCCTCCCAGCAGCCCTAGG - Intronic
1029762135 7:102606576-102606598 ACCCTCCTCCCAGCAGCCCTAGG - Intronic
1029762182 7:102606843-102606865 ACCCTCCTCCCAGCAGCCCTAGG - Intronic
1030128667 7:106178672-106178694 CCCCTAGGTCCTGGGGCCCTGGG + Intergenic
1031468768 7:122144797-122144819 CCCCTCCCTCCAGGCCTCCTAGG - Intergenic
1032239789 7:130151589-130151611 CCCTTCCCTGCAGCAGCCCTAGG + Intergenic
1032394138 7:131576820-131576842 CCCTACCTTCCAGGAGCTCTAGG + Intergenic
1033916823 7:146336291-146336313 CCCTTTCTTCCAGGAGCTCTCGG + Intronic
1034337122 7:150330814-150330836 CCCCTCCACCCCGGAGCTCTTGG - Exonic
1035355308 7:158273092-158273114 CCCCTTCGTCCCACAGCCCTGGG - Intronic
1035560757 8:602035-602057 CCCCTCCCTCAAGGTGCTCTCGG - Intergenic
1036755006 8:11466150-11466172 CCCTTGGGTCCAGGTGCCCTGGG + Intronic
1037812337 8:22094540-22094562 CCGCTCCCTCCAGGGTCCCTGGG - Intronic
1037828974 8:22177189-22177211 CCCCCACCTCCAGGACCCCTGGG + Intronic
1037880854 8:22572755-22572777 CCCCTGCCTCGAGCAGCCCTGGG + Intronic
1038844176 8:31213542-31213564 TCCCTGGGTCCTGGAGCCCTTGG + Intergenic
1039969504 8:42309035-42309057 CTCCTCCATCCAGGTGCCCCGGG - Intronic
1041149426 8:54915887-54915909 CCCCTCCTTCCAGGATCTCATGG - Intergenic
1041487252 8:58392648-58392670 CCCCTGCCTCCTGGAGCCCTTGG + Intergenic
1042857048 8:73277979-73278001 TCCCTCGGTGCAAGAGCCCTGGG - Intergenic
1044016235 8:87051324-87051346 CCTCACTATCCAGGAGCCCTGGG - Intronic
1048581001 8:135729761-135729783 CCTCTGAGTCCAGGAGCCCATGG + Intergenic
1049368990 8:142254581-142254603 CCCCTCCCTCCAGCACCCCCTGG + Intronic
1049431519 8:142567451-142567473 CCCCTCCCTCGAAGAGCCCAGGG + Intergenic
1050044158 9:1526112-1526134 CCCCTCCTTCCTTCAGCCCTGGG + Intergenic
1058109682 9:101018538-101018560 CCCCGCAGTGCAGGAGCCCTTGG + Intergenic
1059340609 9:113595454-113595476 CCCCGACAGCCAGGAGCCCTGGG - Intronic
1059755703 9:117291370-117291392 CCCCACTCTCCAGGAGCCCTCGG - Exonic
1060412313 9:123407946-123407968 CCCCTTCGTCCAGGAGACACTGG + Intronic
1060797740 9:126524078-126524100 CTCCTCCGTCCCCCAGCCCTTGG + Intergenic
1061257514 9:129461019-129461041 CCCTGCCCTCCAGGAGCCCCTGG + Intergenic
1061677018 9:132223255-132223277 CCCCTGCGTCCACCAGCCCTGGG - Intronic
1061955632 9:133959870-133959892 CCCCTCCCTCCAGAGGCACTAGG - Intronic
1062179568 9:135184037-135184059 CCCCTCCTCCAAGGACCCCTCGG - Intergenic
1185647018 X:1623189-1623211 CCGCCACGTCCAGGGGCCCTGGG - Exonic
1186674105 X:11797805-11797827 CCCCTCCACCCACGAACCCTAGG - Intergenic
1194765272 X:97841979-97842001 CCCCTCCGTCCTGTAGGCCCCGG + Intergenic
1194988474 X:100518247-100518269 TCCCTACGTTCAGGATCCCTGGG + Intergenic
1195115478 X:101694187-101694209 CCTCTCCATCCAGGAGCACTGGG - Intergenic
1195260285 X:103125095-103125117 CCCCTAGGACCAGGAGACCTTGG + Intergenic
1195705779 X:107737167-107737189 CCCATTGGTCCAGGGGCCCTGGG - Intronic
1197886104 X:131220046-131220068 CGACTCCATCCAGGAGCACTGGG + Intergenic
1200134406 X:153867900-153867922 CCCCACCCTCAGGGAGCCCTGGG - Exonic
1200208521 X:154334819-154334841 CCCCTCCTCACAGCAGCCCTAGG - Intergenic
1200231728 X:154447122-154447144 CCCCTCCTTCCTTGACCCCTGGG - Intronic