ID: 900094927

View in Genome Browser
Species Human (GRCh38)
Location 1:936410-936432
Sequence ACCGGGGACCCCCTCCGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 2, 1: 3, 2: 0, 3: 18, 4: 210}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900094927_900094943 19 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094943 1:936452-936474 TCCGGGAAGGATGGGGTTCTCGG 0: 1
1: 0
2: 1
3: 13
4: 155
900094927_900094934 1 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094934 1:936434-936456 GGTCCCGCCTTCTAGGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 112
900094927_900094946 23 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094946 1:936456-936478 GGAAGGATGGGGTTCTCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 186
900094927_900094935 2 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094935 1:936435-936457 GTCCCGCCTTCTAGGGCTCCGGG 0: 1
1: 5
2: 1
3: 10
4: 108
900094927_900094933 -5 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094927_900094947 24 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094947 1:936457-936479 GAAGGATGGGGTTCTCGGGAGGG 0: 1
1: 0
2: 0
3: 23
4: 215
900094927_900094942 12 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094942 1:936445-936467 CTAGGGCTCCGGGAAGGATGGGG 0: 1
1: 0
2: 3
3: 22
4: 206
900094927_900094941 11 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094941 1:936444-936466 TCTAGGGCTCCGGGAAGGATGGG 0: 1
1: 0
2: 1
3: 16
4: 118
900094927_900094938 6 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094938 1:936439-936461 CGCCTTCTAGGGCTCCGGGAAGG 0: 1
1: 0
2: 6
3: 12
4: 107
900094927_900094931 -6 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094931 1:936427-936449 CCCGGTCGGTCCCGCCTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 57
900094927_900094940 10 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094940 1:936443-936465 TTCTAGGGCTCCGGGAAGGATGG 0: 1
1: 0
2: 1
3: 16
4: 167
900094927_900094948 28 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094948 1:936461-936483 GATGGGGTTCTCGGGAGGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 265
900094927_900094949 29 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094949 1:936462-936484 ATGGGGTTCTCGGGAGGGAAGGG 0: 1
1: 0
2: 1
3: 13
4: 236
900094927_900094945 20 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094945 1:936453-936475 CCGGGAAGGATGGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 22
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900094927 Original CRISPR ACCGGGGACCCCCTCCGTCC AGG (reversed) Intronic
900094861 1:936254-936276 ACCGGGGACCCCTTCCGTCCAGG - Intronic
900094878 1:936293-936315 ACCGGGGACCCCCTCCGTCCAGG - Intronic
900094894 1:936332-936354 ACCGGGGACCCCTTCCGTCCAGG - Intronic
900094910 1:936371-936393 ACCGGGGACCCCTTCCGTCCAGG - Intronic
900094927 1:936410-936432 ACCGGGGACCCCCTCCGTCCAGG - Intronic
900319627 1:2076116-2076138 ACTGGGCACCCCCTCAGCCCCGG - Intronic
900435192 1:2627857-2627879 GCCCTGGACCCCCTCCCTCCAGG - Intronic
900482464 1:2905735-2905757 GCCGGGCACCCCCACCCTCCTGG + Intergenic
902375349 1:16027725-16027747 ACCTGGCACCCCCTCCACCCTGG + Intronic
902380313 1:16049522-16049544 ACCTGGCACCCCCTCCACCCTGG + Intronic
903928448 1:26848629-26848651 ACCGGCCACCCCCTCGGACCCGG + Exonic
909863086 1:80633359-80633381 TCCAGGGACCCCCTCCCACCTGG - Intergenic
924511299 1:244730825-244730847 AGCGGGGCCCCCCTCCGCGCGGG - Intergenic
924625689 1:245695081-245695103 GCCAGGGATCCCCTCCTTCCAGG - Intronic
1062874273 10:932118-932140 GCCGGGGTCGCCATCCGTCCTGG - Intergenic
1064960169 10:20954791-20954813 TCCGGGGACCCCCTCCCATCTGG + Intronic
1066140498 10:32500244-32500266 ACCGGGCAGCCGCCCCGTCCAGG - Intronic
1067476116 10:46567550-46567572 ACTGGGGACCCCCTCCTATCTGG - Intergenic
1069197385 10:65570395-65570417 TCCAGGGACCCCCTCCCACCTGG - Intergenic
1071926557 10:90416006-90416028 TCCAGGGACCCCCTCCCACCTGG - Intergenic
1073574190 10:104608127-104608149 TCTGGGGACCCCCTCCCACCTGG - Intergenic
1073574728 10:104612871-104612893 TCTGGGGACCCCCTCCCACCTGG - Intergenic
1079762325 11:24344504-24344526 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1081779541 11:45700428-45700450 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1085312565 11:75525235-75525257 ACAGGGGTCCCCTTCTGTCCCGG - Exonic
1092252141 12:6905395-6905417 ACTGAGGACCCCCTCCCTTCAGG - Intronic
1096311638 12:50526246-50526268 ACAGGGGTCCCCATCCTTCCTGG - Intronic
1098805452 12:75016140-75016162 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1099009271 12:77272272-77272294 TCTGGGGACCCCCTCCTACCTGG + Intergenic
1103085651 12:118060741-118060763 CCCGGGAGCCCCCTCTGTCCCGG + Intronic
1103989155 12:124786645-124786667 GCCAGGGACCTCCTCCCTCCAGG + Intronic
1104862252 12:131929775-131929797 GCCTGGGACCGCGTCCGTCCTGG + Exonic
1105405329 13:20128194-20128216 CCCGGGCTCCCCCTCCGCCCGGG - Intergenic
1107588902 13:41881978-41882000 AGTGAGGAGCCCCTCCGTCCCGG - Intronic
1108518236 13:51222437-51222459 ACCCGGGGCGCCCTCCCTCCCGG - Exonic
1109388727 13:61666722-61666744 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1111132508 13:83996070-83996092 GCCGGGAACCCCCTCCCACCTGG - Intergenic
1112192425 13:97191189-97191211 TCCGGGGACCCCCTCCCACCTGG - Intergenic
1113599673 13:111559709-111559731 CCCGGGGACCCCCACGGTGCAGG - Intergenic
1113599701 13:111559789-111559811 CCCGGGGACCCCCACGGTGCAGG - Intergenic
1113641071 13:111956941-111956963 AGCGGGGACACCCCCTGTCCTGG + Intergenic
1120320653 14:82956341-82956363 TCCGGGGACCCCTTCCCACCTGG + Intergenic
1202864336 14_GL000225v1_random:105206-105228 ACCGGGCCCGCCCTGCGTCCAGG + Intergenic
1123490148 15:20774479-20774501 GCCGGTGGCCCCCTGCGTCCAGG - Intergenic
1123546649 15:21343566-21343588 GCCGGTGGCCCCCTGCGTCCAGG - Intergenic
1128113072 15:65088589-65088611 CCTGGGAACCCCCTCCCTCCAGG + Intergenic
1129791018 15:78340600-78340622 CCCGGGGACTCCCTCCTGCCTGG - Intronic
1130224021 15:82044688-82044710 ACCGGGGACAGCCCGCGTCCAGG + Intronic
1132086917 15:98916150-98916172 AACGGTCACACCCTCCGTCCAGG - Intronic
1132550065 16:550647-550669 ACCGGGGACCCTCACCGACAGGG - Intronic
1132550084 16:550697-550719 ACAGGGGACCCTCACCGACCGGG - Intronic
1132550146 16:550860-550882 ACAGGGGACCCTCACCGACCGGG - Intronic
1132550180 16:550959-550981 ACAGGGGACCCTCACCGACCGGG - Intronic
1132550192 16:550992-551014 ACAGGGGACCCTCACCGACCGGG - Intronic
1132550213 16:551041-551063 ACCGGGGACCCTCACCGACCGGG - Intronic
1132550233 16:551090-551112 ACCGGGGACCCTCACCGACCGGG - Intronic
1132550271 16:551188-551210 ACTGGGGACCCTCACCGACCGGG - Intronic
1132550283 16:551221-551243 ACCGGGGACCCTCACTGACCGGG - Intronic
1132550289 16:551238-551260 ACAGGGGACCCTCACCGACCGGG - Intronic
1132654570 16:1036501-1036523 CCCGGGGAACCCCTCCTTCAGGG - Intergenic
1132997465 16:2830603-2830625 ACAGGGGACCCCACCCCTCCAGG - Intronic
1141381360 16:83579944-83579966 GCCTGGGACAGCCTCCGTCCAGG - Intronic
1141400593 16:83743829-83743851 ACCGGGCACCGTCTGCGTCCAGG + Intronic
1142151685 16:88515320-88515342 AAGGGGGACGCCCTCTGTCCTGG - Intronic
1143763385 17:9121043-9121065 ACAGGGGAAGCCCTCCATCCTGG - Intronic
1143904434 17:10198094-10198116 CCCGGGGCGCCCCTCCGACCGGG + Intronic
1144604571 17:16653502-16653524 CCCGGGAACCCCCTCCCTGCGGG - Intronic
1145325077 17:21816100-21816122 ACGGGGGGACCCCTCTGTCCTGG - Intergenic
1158640861 18:59202535-59202557 GCCAGGGACCCCCTCCCACCTGG - Intergenic
1159134927 18:64326439-64326461 TCTGGGGACCCCCTCCCACCTGG + Intergenic
1160406939 18:78652787-78652809 TCCTGGGAACCCCTCAGTCCCGG + Intergenic
1160406952 18:78652822-78652844 CCCGGGAACCCCCTCAGTCCCGG + Intergenic
1160406990 18:78652924-78652946 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407009 18:78652974-78652996 CCCCGGGAGCCCCTCAGTCCCGG + Intergenic
1160407031 18:78653027-78653049 CCCGGGAACCCCCTCATTCCCGG + Intergenic
1160407084 18:78653182-78653204 CCCGGGAACCCTCTCAGTCCCGG + Intergenic
1160407091 18:78653200-78653222 CCCGGGAACCCCCTCGGTCCCGG + Intergenic
1160407147 18:78653355-78653377 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407171 18:78653423-78653445 TCCCGGGAACCCCTCAGTCCTGG + Intergenic
1160407207 18:78653526-78653548 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407238 18:78653612-78653634 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407282 18:78653734-78653756 CCCAGGAACCCCCTCGGTCCCGG + Intergenic
1160407341 18:78653890-78653912 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407365 18:78653959-78653981 CCCGGGAACCCCCTCAGTCCCGG + Intergenic
1160407391 18:78654029-78654051 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407417 18:78654098-78654120 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407432 18:78654133-78654155 CCCGGGAACCCCTTCGGTCCCGG + Intergenic
1160407458 18:78654202-78654224 CCCGGGAACCCCCTCAGTCCCGG + Intergenic
1160407466 18:78654220-78654242 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407502 18:78654322-78654344 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407510 18:78654340-78654362 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407525 18:78654376-78654398 CCCGGGAACCCCCTCAGTCCCGG + Intergenic
1160407533 18:78654394-78654416 CCCGGGAAACCCCTCTGTCCTGG + Intergenic
1160407550 18:78654445-78654467 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407556 18:78654462-78654484 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407564 18:78654480-78654502 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407576 18:78654513-78654535 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407584 18:78654531-78654553 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407599 18:78654567-78654589 CCCGGGAACCCCCTCAGTCCCGG + Intergenic
1160407607 18:78654585-78654607 CCCGGGAAACCCCTCTGTCCTGG + Intergenic
1160407624 18:78654636-78654658 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407630 18:78654653-78654675 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407638 18:78654671-78654693 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407645 18:78654689-78654711 CCCGGGAACCCCCTCAGTCCCGG + Intergenic
1160407653 18:78654707-78654729 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407689 18:78654811-78654833 CCCAGGAACCCCCTCAGTCCCGG + Intergenic
1160407697 18:78654829-78654851 CCCGGGAACCCCCTCAGTCCCGG + Intergenic
1160407705 18:78654847-78654869 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407734 18:78654933-78654955 TCCCGGAACCCCCTCAGTCCCGG + Intergenic
1160407749 18:78654968-78654990 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407756 18:78654986-78655008 CCCGGGAACCCCCTCAGTCCCGG + Intergenic
1160407764 18:78655004-78655026 CCCGGGAAACCCCTCAGTCCCGG + Intergenic
1160407823 18:78655177-78655199 TCCCGGGAACCCCTCAGTCCCGG + Intergenic
1160407858 18:78655264-78655286 CCCGGGAAACCCCTCAGTCCGGG + Intergenic
1160407864 18:78655281-78655303 TCCGGGAAACCCCTCGGTCCCGG + Intergenic
1160452270 18:78973868-78973890 ACGGGGGACCCCCTGGCTCCGGG - Intergenic
1161009439 19:1953241-1953263 ACCGGGGACCCCTGCCCCCCTGG + Intronic
1161038430 19:2097763-2097785 CCTGGGGACCCCTTCCCTCCGGG + Intronic
1162099540 19:8331557-8331579 ACCAGGAGCCCCCTCCCTCCAGG - Intronic
1163547187 19:17947573-17947595 ACCGGGGCTCCCCATCGTCCTGG - Intergenic
1163862105 19:19747966-19747988 CCTGGGGAGCCCCTCCCTCCAGG + Intergenic
1165829772 19:38724614-38724636 GCCGGGGACCCCCTCACTACGGG - Intronic
1167648585 19:50718407-50718429 ACCGGCCACCCCCTCCGAGCGGG - Intronic
925407559 2:3615916-3615938 ACCCGGCAGCCCCCCCGTCCGGG - Intronic
928178174 2:29049248-29049270 ACCTGGGACCCCCACAGTGCTGG + Intronic
932313838 2:70767168-70767190 ACCGGGGATGGCCTCCGCCCCGG + Intronic
933130823 2:78672744-78672766 TCCGGGGAACCCCTCAGACCTGG + Intergenic
933131474 2:78678040-78678062 ACCGGGGACGCCCTCCCACCTGG + Intergenic
934522999 2:95031607-95031629 ACCAGGGACCTCCTCTGTTCTGG + Intronic
937153135 2:119699655-119699677 TCCAGGGACCCCCTCCCACCTGG + Intergenic
940190018 2:151030925-151030947 TCCGGGGACCCCTTCCCACCTGG + Intronic
942838910 2:180336426-180336448 TCCAGGGACCCCCTCCCACCTGG - Intergenic
943258563 2:185629161-185629183 TCTGGGGACCCCCTCCCACCTGG + Intergenic
944073087 2:195695146-195695168 TCTGGGGACCCCCTCCCACCTGG + Intronic
946179721 2:217942189-217942211 ACCTGGGACCCTCTGCTTCCAGG - Intronic
947672347 2:231946327-231946349 ACCGGGGACTCCCTGCTTACCGG + Intergenic
948529237 2:238593476-238593498 GCCGGGGCCTCCCTCCCTCCTGG + Intergenic
1168797818 20:623174-623196 TCCGGGGCCTCCCTCCTTCCTGG + Intergenic
1169218692 20:3808056-3808078 ACTCGGGACCCCCTCTGCCCTGG + Intergenic
1171411664 20:24952020-24952042 CCCGGGGACCTCCTGCCTCCTGG + Intronic
1173335930 20:42112454-42112476 ACCGGGCAACCCGTCAGTCCTGG - Intronic
1174085496 20:48004941-48004963 ACTGGTGACCCCGTCCCTCCAGG - Intergenic
1174130723 20:48341792-48341814 ACTGGTGACCCCGTCCCTCCAGG + Intergenic
1174200886 20:48805632-48805654 ACCGGGGGCTCCCTTCTTCCTGG + Intronic
1175374254 20:58514062-58514084 ACCAGGGAACCCCTTAGTCCTGG + Intronic
1175973538 20:62699073-62699095 TCCTGGGACCCCCACCCTCCTGG - Intergenic
1180180996 21:46118629-46118651 CCCGGGGGCCCTCTGCGTCCTGG - Exonic
1180996784 22:19969791-19969813 ACCTGGGACCACCTCCACCCAGG + Exonic
1181339343 22:22165800-22165822 ACAGGGCATCCCCTCCCTCCAGG - Intergenic
1181813775 22:25421385-25421407 GCCAGCGACCCCCTGCGTCCGGG + Intergenic
1182118930 22:27774503-27774525 ACTGGGAACCCCCACCCTCCTGG + Intronic
1183418598 22:37697182-37697204 ACCCGGGACCCTCTCCATCCAGG - Intronic
1183961208 22:41412987-41413009 ACCAGGGGCCTCCTCGGTCCTGG + Intergenic
949307380 3:2658104-2658126 GCCAGGTACCCCCTCCGACCTGG - Intronic
949994279 3:9603848-9603870 AGCAGGTACCCCCTCCCTCCTGG - Intergenic
951346074 3:21547944-21547966 TCCAGGGACCCCCTCCCACCTGG - Intronic
952192880 3:31042686-31042708 TCTGGGGATCCCCTCCCTCCTGG - Intergenic
952485342 3:33804343-33804365 TCCAGGGACCCCCTCCCACCTGG + Intronic
955291127 3:57693113-57693135 GCTGGGGACCCACTCAGTCCGGG + Intergenic
959623433 3:108423249-108423271 TCCAGGGACCCCCTCCCACCTGG + Intronic
961145872 3:124592802-124592824 ACCAGGGTTCCCCTCCTTCCAGG - Intronic
961552336 3:127676578-127676600 ACAGGTGACCCCCTGGGTCCAGG + Exonic
965635495 3:170776215-170776237 CCCAGGAACCCCCTCAGTCCTGG - Intronic
967630321 3:191737682-191737704 TCCAGGGACCCCCTCCAACCTGG + Intergenic
969591095 4:8122321-8122343 CCAGGGGACACCCTCTGTCCTGG + Intronic
971711409 4:30118319-30118341 GCCAGGGACCCCCTCCCACCTGG - Intergenic
975614678 4:76234627-76234649 TCCGGGGACCCCCTCCCACCTGG + Intronic
976826203 4:89263354-89263376 TCCGGGGACCCCCTCCCACCTGG - Intronic
981255421 4:142656033-142656055 TCCAGGGACCCCCTCCCACCTGG - Intronic
988900199 5:35723163-35723185 TCCAGGGACCCCCTCCCACCTGG + Intronic
992662921 5:78979477-78979499 GCCAGGGACCCCCTCCCACCTGG - Intronic
992897050 5:81254555-81254577 AGCGGGGAACCCCTCTCTCCAGG - Intronic
995393899 5:111667075-111667097 TCCAGGGACCCCCTCCCACCTGG + Intronic
995830455 5:116348841-116348863 TCCAGGGACCCCCTCCCACCTGG + Intronic
996553821 5:124757679-124757701 TCCAGGGACCCCCTCCCACCTGG - Intergenic
996575490 5:124973007-124973029 TCCAGGGACCCCCTCCCACCTGG - Intergenic
996661502 5:126009056-126009078 TCCAGGGACCCCCTCCCACCTGG - Intergenic
997265272 5:132491323-132491345 AGGGGTGACCCCCTCCCTCCAGG + Intergenic
1002455870 5:179345144-179345166 CCCCGGGACCCCCGCCGGCCTGG - Intronic
1002474500 5:179456328-179456350 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1002602575 5:180362366-180362388 CCCAGGGAACCCCTCAGTCCTGG + Intergenic
1003196547 6:3920023-3920045 TCCCGGGACCCCCTCCCACCTGG + Intergenic
1005578039 6:27208318-27208340 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1006088642 6:31615123-31615145 ACCAGGCTCCCCCTCCTTCCTGG + Intergenic
1008149556 6:47934106-47934128 GCCTGGGACCCCCTCCCACCTGG - Intronic
1010016018 6:71105467-71105489 ACCGGGGACCCCTTCTATCCTGG - Intergenic
1013410073 6:109876208-109876230 TCCAGGGACCCCCTCCCACCGGG - Intergenic
1014177539 6:118347126-118347148 CCAGGGGAACCCCTCAGTCCTGG - Intergenic
1018239613 6:161760448-161760470 TCCAGGGACCCCCTCCCACCTGG - Intronic
1018740972 6:166728352-166728374 CCCGGGGGACCCCTGCGTCCAGG - Intronic
1019140274 6:169938322-169938344 ACCCGGCAGCCCCTCTGTCCAGG + Intergenic
1019275154 7:172333-172355 CCCCGGGACCCCCACCATCCTGG + Intergenic
1019279306 7:192246-192268 TCCTGGGACCCCCTCCCGCCCGG - Intergenic
1019747384 7:2708528-2708550 GCCGGGGACCCCCATCTTCCAGG - Intronic
1020616427 7:10465803-10465825 CCCGGCCAGCCCCTCCGTCCGGG - Intergenic
1020676642 7:11191962-11191984 TCCAGGGACCCCCTCCCACCTGG - Intergenic
1020677322 7:11197505-11197527 TCCAGGGACCCCCTCCCACCTGG - Intergenic
1021330953 7:19339203-19339225 CCCAGGGACCCCCTCCCACCTGG - Intergenic
1022649149 7:32258977-32258999 ACTGAGGACCTCCTCAGTCCTGG - Intronic
1023718742 7:43071755-43071777 TCTGGGGACCCCCTCCCACCTGG + Intergenic
1025854101 7:65263448-65263470 ACTGGGAACCCCCTTCCTCCTGG + Intergenic
1026880107 7:73902372-73902394 ACCAGGGACCCCCAACTTCCTGG - Intergenic
1028524457 7:91768085-91768107 TCCAGGGACCCCCTCCCACCTGG + Intronic
1029590311 7:101502833-101502855 AACGGGCACTCCCTCCTTCCCGG + Intronic
1030245913 7:107384328-107384350 TCCAGGGACCCCCTCCCACCTGG - Intronic
1030756317 7:113291609-113291631 ACCCGGGACCCTTTCTGTCCAGG - Intergenic
1034372736 7:150614522-150614544 AGAGGGGACCCACTCCCTCCTGG + Intergenic
1035285829 7:157806771-157806793 ACTGAGAACCCCCTCAGTCCAGG + Intronic
1035725720 8:1823965-1823987 CCCCGCGACCCCGTCCGTCCCGG - Exonic
1035758045 8:2048929-2048951 ACAGGGGACCCCCACCATTCTGG + Intronic
1036575328 8:10022587-10022609 CCCGGGAAACCCCTCAGTCCTGG - Intergenic
1038433017 8:27515002-27515024 TCTGGGGACCCCCTCCCACCTGG - Intronic
1046068554 8:109223487-109223509 TCTGGGGACCCCCTCCCACCTGG - Intergenic
1047739268 8:127794191-127794213 ACCGGGGATTCCCTCCGGCCCGG + Intergenic
1049613621 8:143567147-143567169 CCCAGGGAGCCCCTCCGTCAGGG + Exonic
1053594211 9:39543678-39543700 ACTGGGGACCCTCTCCCACCTGG - Intergenic
1053851991 9:42298724-42298746 ACTGGGGACCCTCTCCCACCTGG - Intergenic
1054572042 9:66821279-66821301 ACTGGGGACCCTCTCCCACCTGG + Intergenic
1054771264 9:69086421-69086443 TCCAGGGACCCCCTCCCACCTGG - Intronic
1056126047 9:83537604-83537626 TCCGGAGACGCCCTCAGTCCCGG - Intronic
1056682779 9:88733730-88733752 CCCGGGCACCCCCTGCTTCCTGG - Intergenic
1057498273 9:95577230-95577252 AACTGGGACTCCCTCCCTCCAGG - Intergenic
1059438525 9:114290091-114290113 ACCTGGACCCCCCTCCGGCCTGG - Exonic
1061108849 9:128552720-128552742 CCCGGGGCCCCGCTCCCTCCCGG - Intronic
1061403926 9:130383354-130383376 ACCTGGAACCTCCTCCATCCAGG - Intronic
1185471948 X:389292-389314 CCCGGGGGCCCACTCCGTGCAGG + Intergenic
1188152896 X:26701008-26701030 CCCAGGGAACCCCTCAGTCCTGG + Intergenic
1194402627 X:93457842-93457864 TCCAGGGACCCCCTCCTACCTGG + Intergenic
1195108095 X:101619532-101619554 ACTGGGGAGCCCCTCCCTCTGGG - Intergenic
1195651460 X:107289364-107289386 CCGGGGGAACCCCTCAGTCCTGG - Intergenic
1197749154 X:129953119-129953141 ACCGGGGCCTCCCTCCTCCCCGG + Intergenic
1198187911 X:134272249-134272271 ACCGGGGAGCGCCTCGGCCCAGG - Intergenic
1199234279 X:145472429-145472451 TCCGGGGACCCTCTCCCACCTGG - Intergenic