ID: 900094933

View in Genome Browser
Species Human (GRCh38)
Location 1:936428-936450
Sequence CCGGTCGGTCCCGCCTTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900094920_900094933 7 Left 900094920 1:936398-936420 CCTCCTAGGGCTCCTGGACGGAG 0: 2
1: 3
2: 1
3: 10
4: 178
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094923_900094933 4 Left 900094923 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG 0: 2
1: 3
2: 1
3: 39
4: 259
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094914_900094933 17 Left 900094914 1:936388-936410 CCCGGTCCCGCCTCCTAGGGCTC 0: 4
1: 0
2: 0
3: 9
4: 223
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094918_900094933 10 Left 900094918 1:936395-936417 CCGCCTCCTAGGGCTCCTGGACG 0: 5
1: 1
2: 0
3: 33
4: 385
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094927_900094933 -5 Left 900094927 1:936410-936432 CCTGGACGGAGGGGGTCCCCGGT 0: 2
1: 3
2: 0
3: 18
4: 210
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094917_900094933 11 Left 900094917 1:936394-936416 CCCGCCTCCTAGGGCTCCTGGAC 0: 5
1: 0
2: 1
3: 37
4: 353
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094915_900094933 16 Left 900094915 1:936389-936411 CCGGTCCCGCCTCCTAGGGCTCC 0: 4
1: 0
2: 1
3: 15
4: 251
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
900094913_900094933 18 Left 900094913 1:936387-936409 CCCCGGTCCCGCCTCCTAGGGCT 0: 4
1: 0
2: 13
3: 26
4: 132
Right 900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900094933 Original CRISPR CCGGTCGGTCCCGCCTTCTA GGG Intronic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
913174455 1:116261506-116261528 ATGCTCGGTCCCGCCTTCTCAGG - Intergenic
1092810424 12:12267043-12267065 ACGGTCGGCACCGCCTCCTAGGG + Intergenic
1115175668 14:30559106-30559128 GCGGTCGGCCCCGCCCTCGAGGG - Exonic
1123707282 15:22959522-22959544 CCGGGCAGTCCCGCCTGCTCAGG + Intronic
926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG + Exonic
1182338822 22:29603398-29603420 CCGCTCCGTCCCGCCTCCTTTGG - Intergenic
1184770697 22:46595017-46595039 CCTGTCGTTCCCGCCTCCTGTGG + Intronic
1185375490 22:50481195-50481217 CCGGGCGGTCCCACCCTCCAGGG - Intergenic
949477737 3:4465174-4465196 CCAGTCTGTCCCTCTTTCTAAGG - Intronic
952883323 3:37998616-37998638 CTGGGCGGTCCCGCTTTCTGAGG + Intronic
999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG + Exonic
1024609569 7:51052990-51053012 CAGCTCGGTCCTGCCTTCTTGGG - Intronic
1034988784 7:155534530-155534552 CCGGTCAGTCCCACATGCTAAGG - Intergenic
1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG + Intergenic
1056764693 9:89437508-89437530 CCTGTCGCTGCCGCCTGCTAGGG - Intronic
1061016045 9:127981178-127981200 GCGGCCGGGCCCGCCTCCTAGGG + Intergenic
1062104028 9:134742932-134742954 CCAGTGAGTCCCGCCTTCCATGG + Intronic
1187473362 X:19588665-19588687 CCGGTCTCTCCGGCCTTCTCGGG + Exonic