ID: 900096832

View in Genome Browser
Species Human (GRCh38)
Location 1:943180-943202
Sequence GCACACGACGGTCAGGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 58}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900096819_900096832 2 Left 900096819 1:943155-943177 CCCATCCCCCACCTCAGCAATTG 0: 1
1: 0
2: 3
3: 17
4: 241
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58
900096820_900096832 1 Left 900096820 1:943156-943178 CCATCCCCCACCTCAGCAATTGG 0: 1
1: 2
2: 5
3: 29
4: 323
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58
900096828_900096832 -9 Left 900096828 1:943166-943188 CCTCAGCAATTGGGGCACACGAC 0: 1
1: 0
2: 1
3: 1
4: 44
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58
900096825_900096832 -4 Left 900096825 1:943161-943183 CCCCACCTCAGCAATTGGGGCAC 0: 1
1: 0
2: 0
3: 15
4: 112
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58
900096817_900096832 12 Left 900096817 1:943145-943167 CCCTTAGGCACCCATCCCCCACC 0: 1
1: 0
2: 2
3: 36
4: 333
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58
900096827_900096832 -6 Left 900096827 1:943163-943185 CCACCTCAGCAATTGGGGCACAC 0: 1
1: 0
2: 0
3: 11
4: 172
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58
900096826_900096832 -5 Left 900096826 1:943162-943184 CCCACCTCAGCAATTGGGGCACA 0: 1
1: 0
2: 0
3: 13
4: 206
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58
900096824_900096832 -3 Left 900096824 1:943160-943182 CCCCCACCTCAGCAATTGGGGCA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58
900096816_900096832 13 Left 900096816 1:943144-943166 CCCCTTAGGCACCCATCCCCCAC 0: 1
1: 0
2: 1
3: 38
4: 237
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58
900096818_900096832 11 Left 900096818 1:943146-943168 CCTTAGGCACCCATCCCCCACCT 0: 1
1: 0
2: 2
3: 37
4: 385
Right 900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG 0: 1
1: 0
2: 0
3: 1
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900096832 Original CRISPR GCACACGACGGTCAGGAGAC GGG Intronic
900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG + Intronic
902607500 1:17576728-17576750 GCACAGGACGCTCAGGAAGCAGG + Intronic
904856269 1:33500275-33500297 GCACACGGAGGTGAGGAGAAAGG - Intergenic
906117281 1:43365303-43365325 GTACACGTAGGTCAGGAGAATGG + Exonic
918021327 1:180694752-180694774 GCACACAACAATCAGGAGTCGGG - Intronic
920504852 1:206508290-206508312 GCACGCACCTGTCAGGAGACAGG - Intronic
1070605967 10:77898731-77898753 GCACAGGCCTGTCAGGAGCCAGG - Intronic
1073181628 10:101587213-101587235 GCACACGAGGGTTCTGAGACTGG + Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1084514483 11:69628900-69628922 GGGCACGAGTGTCAGGAGACAGG + Intergenic
1088223024 11:107590155-107590177 GCACAAGACGGTCAGGTAACCGG + Intergenic
1091989472 12:4943244-4943266 GCACAGGTCTGTCTGGAGACAGG + Intergenic
1094130552 12:27069973-27069995 ACAAAAGACGGTCAGGAGATAGG - Intergenic
1102157353 12:110742275-110742297 GCACACGTCGTCCAGGAGGCTGG + Intronic
1104087824 12:125492542-125492564 GCACAGGGCGGACAGGAGCCAGG + Intronic
1113810857 13:113141604-113141626 GCACAGGACAGGCAGGGGACTGG + Intronic
1114411994 14:22509573-22509595 GCACACCACAGTCAGGGGAGGGG + Intergenic
1115550070 14:34496980-34497002 GGACAAGTTGGTCAGGAGACAGG + Intergenic
1133058121 16:3157703-3157725 GCCCACGAGGGTCGGCAGACAGG - Intergenic
1140473217 16:75226271-75226293 GTACACAACGGTCAGGGGAGGGG + Intergenic
1143242787 17:5458118-5458140 ACCCAGGACGGCCAGGAGACTGG + Intronic
1152388109 17:79987114-79987136 GCCCACCAGGGGCAGGAGACTGG + Intronic
1152714783 17:81893621-81893643 GCACAGGACAGTCAGGAGTTTGG - Intronic
1156266172 18:35490300-35490322 GCCCTGGACTGTCAGGAGACTGG + Intronic
1161298501 19:3531807-3531829 GCACGCGTCGGTGAGGAGCCCGG + Exonic
1161471192 19:4457481-4457503 GCACGCGAGGGTCAGGGGAGGGG - Intronic
1161629613 19:5346198-5346220 GCTCACCACGATCAGCAGACAGG - Intergenic
1166670038 19:44704169-44704191 GCACCCGGCCGTCAGGGGACAGG - Exonic
929598175 2:43189012-43189034 GCAGAAGGCCGTCAGGAGACAGG - Intergenic
932298099 2:70643308-70643330 ACACAGGATGGTCAGGACACGGG + Intronic
932316743 2:70789946-70789968 ACACACGAGGGTGAGGAGAAAGG - Intronic
934737050 2:96694937-96694959 GCACAAGACGGTCAGGCCTCTGG + Intergenic
946128529 2:217586007-217586029 GCACAGGAGGGACAGGAGCCTGG + Intronic
946614511 2:221495332-221495354 CCCCACGGCTGTCAGGAGACAGG - Intronic
1176935695 21:14864247-14864269 TCACAGGACAGTCAGGAGATTGG + Intergenic
1177978658 21:27883485-27883507 GATCACGACGATCAGAAGACTGG + Intergenic
1180148893 21:45937643-45937665 GCACACAAGGGTGAGGAGAGAGG + Intronic
1185114089 22:48921256-48921278 CCACACTGCGTTCAGGAGACTGG - Intergenic
968427819 4:534904-534926 GCACAAAACCGCCAGGAGACGGG - Intronic
969634259 4:8357249-8357271 GGACACCAGGGCCAGGAGACGGG + Intergenic
984475125 4:180225550-180225572 GAACACGGCAGACAGGAGACAGG - Intergenic
985599820 5:821524-821546 GCTCACGGCAGACAGGAGACAGG + Intronic
986033751 5:3918284-3918306 GCCCACGTAGGGCAGGAGACAGG - Intergenic
1001090609 5:168737434-168737456 GCACAGCACTGACAGGAGACAGG - Intronic
1019432617 7:1006332-1006354 GCACACGACGGTCACAGCACAGG + Intronic
1023542725 7:41283381-41283403 GCACATGGTGGTCAGGAGAAGGG - Intergenic
1028838146 7:95396853-95396875 AGGCACGAAGGTCAGGAGACAGG - Intergenic
1033285911 7:140040323-140040345 GCCCACGACGGGAGGGAGACAGG + Intronic
1033366840 7:140678472-140678494 GCTCACTTCGGTCAGGAGAAAGG + Intronic
1035388417 7:158489676-158489698 GCGCACGGCGGGCAGGAGAGGGG + Intronic
1041704422 8:60830799-60830821 GCACAGGGAGGTCAGGAGAAAGG - Intronic
1041905873 8:63032793-63032815 GAACACGACTGTCAGCATACAGG - Intronic
1044819555 8:96146173-96146195 GCACACGCCGGTCAGGTAAGTGG + Intronic
1044845322 8:96374621-96374643 GCACAGGAAGGTCAAGAGAGAGG - Intergenic
1052866342 9:33466717-33466739 GGAGAAGACGGTCAGGAGGCTGG + Intronic
1053196356 9:36122082-36122104 GCACACAGCTCTCAGGAGACTGG - Intronic
1056126106 9:83537844-83537866 GCACGCGAGGGGAAGGAGACTGG + Intronic
1061289256 9:129641606-129641628 GCACAGGACAGGCAGGCGACAGG + Intronic
1185563252 X:1076822-1076844 GAACACGAAGGAAAGGAGACGGG - Intergenic
1189730458 X:44014953-44014975 GCACACCACAGCCAGGAGATGGG - Intergenic