ID: 900097938

View in Genome Browser
Species Human (GRCh38)
Location 1:947931-947953
Sequence CATTCAGGAGGTTTGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 375}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900097938_900097957 20 Left 900097938 1:947931-947953 CCTGCCCCCAAACCTCCTGAATG 0: 1
1: 0
2: 0
3: 38
4: 375
Right 900097957 1:947974-947996 CCCTCCAAGGGGGCCTCACGGGG 0: 1
1: 0
2: 1
3: 6
4: 101
900097938_900097950 9 Left 900097938 1:947931-947953 CCTGCCCCCAAACCTCCTGAATG 0: 1
1: 0
2: 0
3: 38
4: 375
Right 900097950 1:947963-947985 CCCTCATCAGCCCCTCCAAGGGG 0: 1
1: 0
2: 0
3: 33
4: 321
900097938_900097953 18 Left 900097938 1:947931-947953 CCTGCCCCCAAACCTCCTGAATG 0: 1
1: 0
2: 0
3: 38
4: 375
Right 900097953 1:947972-947994 GCCCCTCCAAGGGGGCCTCACGG 0: 1
1: 1
2: 1
3: 23
4: 203
900097938_900097952 10 Left 900097938 1:947931-947953 CCTGCCCCCAAACCTCCTGAATG 0: 1
1: 0
2: 0
3: 38
4: 375
Right 900097952 1:947964-947986 CCTCATCAGCCCCTCCAAGGGGG 0: 1
1: 0
2: 3
3: 26
4: 187
900097938_900097948 8 Left 900097938 1:947931-947953 CCTGCCCCCAAACCTCCTGAATG 0: 1
1: 0
2: 0
3: 38
4: 375
Right 900097948 1:947962-947984 CCCCTCATCAGCCCCTCCAAGGG 0: 1
1: 0
2: 1
3: 29
4: 251
900097938_900097946 7 Left 900097938 1:947931-947953 CCTGCCCCCAAACCTCCTGAATG 0: 1
1: 0
2: 0
3: 38
4: 375
Right 900097946 1:947961-947983 ACCCCTCATCAGCCCCTCCAAGG 0: 1
1: 0
2: 3
3: 21
4: 241
900097938_900097955 19 Left 900097938 1:947931-947953 CCTGCCCCCAAACCTCCTGAATG 0: 1
1: 0
2: 0
3: 38
4: 375
Right 900097955 1:947973-947995 CCCCTCCAAGGGGGCCTCACGGG 0: 1
1: 0
2: 2
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900097938 Original CRISPR CATTCAGGAGGTTTGGGGGC AGG (reversed) Intronic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
900162086 1:1228604-1228626 CGTTCAGGTGGTCTGGGGGCAGG + Exonic
901055160 1:6445837-6445859 CCTACAGGAGGCTTGGGAGCTGG - Exonic
901261558 1:7875430-7875452 CCTTCAGGAGGCCTGGGGACCGG + Intergenic
902212553 1:14914149-14914171 GATTCAGGAGGTCTGGGGTGGGG + Intronic
902673736 1:17993940-17993962 CATCCAGGAAGTTGGGGAGCTGG - Intergenic
902954634 1:19917107-19917129 GATTCAGCAGGTCTGGGGTCAGG + Intergenic
903479825 1:23645091-23645113 CATGGAGGAGCTGTGGGGGCAGG - Intergenic
903732058 1:25503848-25503870 CATTCATGAGGTCTGGGGGTGGG + Intergenic
904912084 1:33942637-33942659 GATTCAGCAGGTTTAGGGACAGG - Intronic
905884380 1:41484019-41484041 CATCCATGGGGATTGGGGGCAGG - Intronic
906127235 1:43434392-43434414 GATTCGGGAGGATGGGGGGCCGG + Exonic
906395506 1:45460177-45460199 GATTCAGGAGGTATGTGTGCAGG - Intronic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
907870965 1:58442324-58442346 CATTCTGGAGGTTTTGGAGCGGG - Intronic
908048064 1:60194139-60194161 CATTCAGAATGTTTGCTGGCTGG - Intergenic
909975508 1:82042063-82042085 GATTTGAGAGGTTTGGGGGCTGG - Intergenic
911793171 1:102044962-102044984 CAATAAGAAGGCTTGGGGGCTGG + Intergenic
914956446 1:152166989-152167011 ATTTCAGGAGGTTTGGGAGATGG + Intergenic
915741434 1:158121490-158121512 CATTCGGGAGATTCGGGGGGTGG + Intergenic
916292417 1:163181104-163181126 CATTCAGGAGGTCTGAGGTGGGG + Intronic
916825327 1:168436925-168436947 GATTCAGGAGGTTTGGGGTAGGG + Intergenic
917682700 1:177384362-177384384 CAGTCAGGAGGTGTGGGATCCGG + Intergenic
918858025 1:189783657-189783679 GATTCAGTAGGTTTGGGGATGGG + Intergenic
919268253 1:195303332-195303354 CATTCAGGAAGTCTGGGTTCAGG - Intergenic
920074034 1:203324065-203324087 GATTCAGGAGGTTGCGGGGAGGG + Intergenic
920411894 1:205768492-205768514 GATTCAGTAGGTTTGAGGTCGGG + Exonic
920498480 1:206471605-206471627 CAGCCAGCAGGTCTGGGGGCTGG - Intronic
921530745 1:216279577-216279599 CATTCAGGAAGTTTGGGGTTGGG - Intronic
923099213 1:230798855-230798877 CATTCAGCAGGTCTGGGGCAGGG - Intronic
924589658 1:245391493-245391515 CATTAAAGAGATTTGTGGGCTGG + Intronic
1065596203 10:27314282-27314304 AAGTCAGAAGGATTGGGGGCGGG + Intergenic
1067238716 10:44472738-44472760 GATTCTACAGGTTTGGGGGCGGG - Intergenic
1068428209 10:56895320-56895342 CATGCAGGAGATATGGAGGCAGG - Intergenic
1068519755 10:58065163-58065185 CACCCAGGAGGTTGGGGGTCAGG - Intergenic
1068990197 10:63142261-63142283 GATTCAGGAGGTTTGGAGTACGG - Intronic
1069434087 10:68364838-68364860 AATTTAGGAGTTTTGGTGGCAGG - Intronic
1069731937 10:70622719-70622741 CTTTGAGGAGGTCTGGGAGCAGG + Intergenic
1070480583 10:76878717-76878739 GAGTCAGGGCGTTTGGGGGCTGG + Intronic
1070742299 10:78911111-78911133 CATTCAGGAAGGGTGTGGGCTGG - Intergenic
1071115956 10:82220520-82220542 TTTTCTTGAGGTTTGGGGGCAGG + Intronic
1071393782 10:85201307-85201329 GATTCAAGAAGTTTGGGGACGGG + Intergenic
1072617206 10:97057881-97057903 CATCCAGGAGGTTTGGGGAGGGG + Intronic
1073850582 10:107612665-107612687 TATTCAGGAGGGTTTGGGGGAGG + Intergenic
1074095176 10:110305163-110305185 GATTCAGGAGGTCTGGGGTGGGG - Intergenic
1074103370 10:110371221-110371243 CTGTCAGGAGGTTGGGGGCCAGG + Intergenic
1074159129 10:110822578-110822600 CCATCAGGGGGTTTGGGGGGAGG + Intronic
1075052705 10:119194680-119194702 CATTCAAGAGGTGAGGGAGCTGG - Intergenic
1075596947 10:123738845-123738867 GATTCAGGAGGTGTTGGGGTGGG - Intronic
1076439026 10:130466810-130466832 GACTCAGGAGGGCTGGGGGCAGG - Intergenic
1078252504 11:9627942-9627964 CATTCAAGAGTGTTGGGGGTAGG - Intergenic
1078268722 11:9774925-9774947 GATTCAGTAGGTTTGGGGTGGGG - Intergenic
1078334007 11:10450171-10450193 CATTCAGGACTTTGAGGGGCAGG + Intronic
1079442673 11:20531081-20531103 AATTCAGCAGGTTTGGGGTGGGG + Intergenic
1080758912 11:35228835-35228857 GATTCAGCAGGTTTGGGGTGGGG + Intronic
1080970883 11:37275545-37275567 CATTCTGGAGGTTGGGGGTTAGG - Intergenic
1081673542 11:44955211-44955233 CACTCTGGAGGGGTGGGGGCAGG - Intergenic
1081856025 11:46304592-46304614 CCTTCATGGGGTTTGGGGGGAGG - Intronic
1082181693 11:49127710-49127732 CATTCAGTAGGTCTGGGGTGGGG + Intergenic
1083266555 11:61549700-61549722 CACTCAGCAGCTTCGGGGGCAGG + Intronic
1084514536 11:69629355-69629377 CCTTCAGGAGGCTGTGGGGCGGG - Intergenic
1086683803 11:89707131-89707153 CATTCAGTAGGTCTGGGGTGGGG - Intergenic
1088230743 11:107671312-107671334 CATTCAGTAGGTCTGGGGAGGGG - Intergenic
1088581745 11:111323255-111323277 CACTCGGGAGGTCTGGGGTCGGG + Intergenic
1090185569 11:124737222-124737244 CCTTCAGTAGCTATGGGGGCTGG + Intergenic
1090187560 11:124748280-124748302 CATTCAGTGTGTTTAGGGGCAGG - Intronic
1090422189 11:126583113-126583135 CACACAGGAGGTATGGGGCCCGG - Intronic
1090793293 11:130111147-130111169 CATTCTGAAGGGTTTGGGGCTGG + Intronic
1091292362 11:134448330-134448352 CATTCTGCAAGTTTTGGGGCTGG - Intergenic
1091313807 11:134596592-134596614 CTTTGAGGAGGTTTTGGGCCAGG + Intergenic
1092887043 12:12933951-12933973 TATTCAGCAGGTTTGGGGAAAGG + Intergenic
1093130343 12:15384191-15384213 CATTCAGTTGGTTGGGGGCCAGG + Intronic
1093135124 12:15440272-15440294 CCTTCCGGAGGTTGGGGGTCAGG - Intronic
1093186826 12:16029675-16029697 CTTTCTGGACGTTTAGGGGCAGG - Intronic
1093982229 12:25487801-25487823 CCTTCAGGAGCTTTTAGGGCAGG + Intronic
1094169738 12:27479381-27479403 CCTTCAGGAGGCCTGGGGACTGG - Intronic
1094607163 12:31959111-31959133 GATTCAGTAGGTTTGGGGTGGGG - Intergenic
1095659233 12:44709707-44709729 GATTCAGTAGGTCTGGGGTCAGG - Intronic
1096399888 12:51297254-51297276 CATTTAGGAGCCTTGGTGGCTGG - Intronic
1096657614 12:53101459-53101481 GATTCAGGAGGTGTGGGGTGGGG + Intronic
1097187193 12:57202241-57202263 CTATAAGGAGGTTTGGGGACAGG - Intronic
1098943016 12:76559361-76559383 CATTCCTGAGGTTGGGGTGCTGG - Intronic
1100175133 12:92021838-92021860 TAGTCAGGAGGTAGGGGGGCTGG - Intronic
1100192647 12:92209318-92209340 AATTCAGGAGGTCTGGGGTGGGG + Intergenic
1100436212 12:94573676-94573698 CATTCAGGAGGAATGGAGGCAGG - Intronic
1101213325 12:102556532-102556554 CAATCAGTAGATTTGGGGGTCGG + Intergenic
1101305171 12:103520914-103520936 CCTTCTGGAGTTTTGGGGGAAGG - Intergenic
1101400046 12:104379305-104379327 CATTCAGTAGGTCTGGGGTGGGG + Intergenic
1103959647 12:124600961-124600983 GATTCAGCAGGTTTGGGGTGGGG + Intergenic
1104727910 12:131088937-131088959 CATTCAGGGGGTCTGGGGTGGGG + Intronic
1105910697 13:24863436-24863458 CATTCAGGAGAGGTAGGGGCCGG + Intronic
1106563259 13:30864448-30864470 CATTCAGGAAAGCTGGGGGCAGG - Intergenic
1107261342 13:38494984-38495006 GATTCAGTAGGTTTGGGGTGAGG - Intergenic
1107418844 13:40226524-40226546 CACTTAAGAGGTTTGGGGGCTGG + Intergenic
1107574248 13:41699928-41699950 GCTTCAGGAGGTTTGGGGTGGGG + Intronic
1107942555 13:45387738-45387760 CTTTCAGGAAATTTGTGGGCCGG - Intergenic
1108117557 13:47146092-47146114 GATTCAGTAGGTCTGGGGGGTGG + Intergenic
1108363201 13:49686336-49686358 CCTGCAGGAGGTTTGGTGGTGGG - Intronic
1108446722 13:50516804-50516826 CATTAAGAAGGTTTGGCTGCAGG - Intronic
1108601199 13:51996687-51996709 CAGTCAGGAGTTCTTGGGGCAGG - Intronic
1108674946 13:52728446-52728468 CATTCAGTAGGTCTGGGGTGGGG + Intronic
1110507483 13:76304981-76305003 AATTCAGCAGGTCTGGGGGATGG - Intergenic
1110528145 13:76563709-76563731 AATTCAGTAGGTTTGGGGTGTGG - Intergenic
1110686391 13:78380179-78380201 GATTCAGGAGGTATGTGTGCTGG - Intergenic
1111884677 13:94005066-94005088 CATTCAGATATTTTGGGGGCTGG - Intronic
1112290461 13:98141648-98141670 GATTCAGTAGGTTTGGGGTGGGG - Intergenic
1112547866 13:100389240-100389262 TACACAGGAGGTTTGGGGGAGGG + Intronic
1112702139 13:102022087-102022109 CATTCTGGAAGTTTGTGGGAGGG - Intronic
1112943616 13:104896900-104896922 CATTAAACAGATTTGGGGGCAGG + Intergenic
1113452334 13:110420066-110420088 GATTCAGGAGTTCTGGGGCCAGG + Intronic
1114271455 14:21102770-21102792 GCTGCAGGAGGTATGGGGGCAGG + Exonic
1114636126 14:24187886-24187908 CTTTCAGGAGGTGTGGGCACAGG + Intronic
1114794366 14:25695793-25695815 CATTCAGTAGCTTTGGGGTGGGG + Intergenic
1119737846 14:76995366-76995388 CATTCAGCAGGTTGGGGGTGGGG + Intergenic
1120022605 14:79547684-79547706 CAGTAAGGAGGTTGGGGAGCTGG + Intronic
1120493031 14:85200835-85200857 CATTCACCAGGGTGGGGGGCAGG + Intergenic
1120895908 14:89532061-89532083 GATTCAGGAGGTCTGGGGAAGGG - Intronic
1120917596 14:89723448-89723470 CTATCAGGAGGATTTGGGGCAGG - Intergenic
1122009136 14:98731365-98731387 GATACAGCAGGTTTGGAGGCAGG - Intergenic
1122048706 14:99040992-99041014 CACTGAGGTGGTTTGGGGGTGGG - Intergenic
1125152354 15:36547159-36547181 CTTTCAGGAGGGGTGGGAGCGGG + Intergenic
1126048698 15:44668138-44668160 CATTCAGTAGGTCTGGGGTGGGG - Intronic
1128788239 15:70414078-70414100 GATTCAGGAGGTCTGGGGACAGG - Intergenic
1128870431 15:71151238-71151260 CATTCAGGGGGACTTGGGGCAGG - Intronic
1132206208 15:99987839-99987861 CACCCAGGAGAGTTGGGGGCTGG - Intronic
1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG + Intronic
1133443052 16:5836638-5836660 CACTGTGGACGTTTGGGGGCTGG + Intergenic
1133770694 16:8865916-8865938 CATTCAGCAGGTGTGGGGTGGGG + Intronic
1133814164 16:9183806-9183828 CAATCAGCAGGATTGGGGGGGGG - Intergenic
1134687531 16:16169346-16169368 CTGTCTGGAGGTTTGGGGGCAGG + Intronic
1134816747 16:17212147-17212169 GATTCAGAAGGTTTGGGGTTGGG - Intronic
1135874080 16:26181110-26181132 GATTCAGGAGGTTTAAGGGGAGG + Intergenic
1136172712 16:28498213-28498235 TCCTCAGGAGGGTTGGGGGCTGG - Exonic
1136346012 16:29676560-29676582 AACTCAGGAGGCTTGGGGCCAGG + Intronic
1136643461 16:31588496-31588518 CAGTCAGGAGGGTTGGGATCTGG + Intergenic
1137238906 16:46638349-46638371 AATCCAGGAGGTTTCTGGGCAGG - Intergenic
1137734604 16:50714369-50714391 CATTCAGTAGGTTTGGGGTGGGG + Intronic
1138463383 16:57167746-57167768 CATTCAGTAGGTTTGGGGCAGGG - Intronic
1138652081 16:58466383-58466405 CATCCAGGCCCTTTGGGGGCAGG - Intronic
1138748934 16:59395599-59395621 GATTTAGTAGGTTTGGTGGCAGG + Intergenic
1140603475 16:76506318-76506340 GATTCAGGGGGTGTGGGGGTAGG + Intronic
1140824803 16:78695970-78695992 CATTCAGGAGGTCTGGGGCGGGG - Intronic
1142147859 16:88499959-88499981 CATCCTGGTGGTTGGGGGGCGGG + Intronic
1142192302 16:88723510-88723532 CATTCAGGAGTTGGGTGGGCTGG + Intronic
1142560640 17:807121-807143 CATCCATGAGGCTCGGGGGCTGG + Intronic
1143017184 17:3897182-3897204 GGTTCAGGAGGTCTGGGGGTGGG + Exonic
1143606171 17:7987584-7987606 CATTCACCAGGGATGGGGGCGGG - Intergenic
1144078029 17:11736484-11736506 CTTTCAGGATGCTTGGAGGCAGG - Intronic
1146555157 17:33816828-33816850 GATTCAGCAGATTTGGGGACTGG - Intronic
1146820369 17:35979863-35979885 CACTCTGAAGGTTTGGGGGCTGG - Intronic
1146825874 17:36022995-36023017 CAGTCAGGAGGCATGGGGGCAGG + Intergenic
1148793606 17:50186957-50186979 CATCCAAGTGCTTTGGGGGCTGG + Intronic
1150999617 17:70359424-70359446 CATTTAGGAGGTATGGAGGTAGG - Intergenic
1152993708 18:386449-386471 GATTCAGTAGGTCTGGGGACAGG - Intronic
1157454016 18:47810265-47810287 GGCTCAGGAGGTTTGGGGACAGG - Exonic
1158558290 18:58492984-58493006 CATTAAGGAAGTTTGGAGGCTGG - Intronic
1159372944 18:67552271-67552293 CATTCAGAAGGCCTGGGGTCGGG + Intergenic
1162776818 19:12984827-12984849 TATTCATGAGGTGGGGGGGCTGG + Intergenic
1163234428 19:16022569-16022591 GAATGGGGAGGTTTGGGGGCAGG + Intergenic
1164912544 19:32024803-32024825 TCTCCAGTAGGTTTGGGGGCAGG - Intergenic
1166848447 19:45745115-45745137 CAGACAGGAGGTTTGCGGGTTGG + Intronic
1166899125 19:46044670-46044692 CAGTCAGGAGGAATGGGGTCAGG - Intronic
1167502693 19:49856677-49856699 CAGTCAGGAGGGCTGGCGGCAGG + Intronic
1168091678 19:54089655-54089677 CACACAAGAGGATTGGGGGCTGG - Intergenic
1168445568 19:56409427-56409449 GATTCAGGAGGTCTGGGGTGGGG - Intronic
1168584244 19:57579680-57579702 CATTCAGATGGTTGGGGGGCTGG + Intronic
925328135 2:3038655-3038677 CATGTAGGAGGTTTGAGGGTTGG + Intergenic
925385228 2:3457408-3457430 GATTCAGGAGGTATGTGTGCAGG - Intronic
926976936 2:18524920-18524942 GATTCAGCAGGTCTGGGGACTGG - Intergenic
927062858 2:19440781-19440803 GAGGCAGGGGGTTTGGGGGCTGG - Intergenic
927069042 2:19506381-19506403 CATTTAGGTGGGTTGGGGGAAGG - Intergenic
927280306 2:21298990-21299012 CATGCAGTAGGCTTGGGGGAGGG + Intergenic
927473397 2:23393809-23393831 CACACAGGAGGTTTGGGGTGTGG + Intronic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
928714743 2:34047354-34047376 GATTCAGTAGGTTTGGGGTGGGG + Intergenic
930208172 2:48609102-48609124 CCTTGAGGAGGTGTGGGGGAAGG - Intronic
931836192 2:66100361-66100383 GATTCAGTAGGTTTGGGGCTGGG + Intergenic
932896295 2:75643845-75643867 AATTCAGTAAGTCTGGGGGCGGG + Intergenic
937468392 2:122154763-122154785 CACTCAGGTGGTTTGGGGCCTGG + Intergenic
938568043 2:132538508-132538530 CAGTCAGGAGGCATGGGGTCAGG + Intronic
938922450 2:136007767-136007789 CATTCAGGAGTTTTGGGGTGGGG + Intergenic
939118485 2:138088544-138088566 CAGCCAGGAGGTTTGGGGCACGG - Intergenic
942717988 2:178915931-178915953 CACTCAGGGGGATTTGGGGCTGG + Intronic
944035557 2:195290691-195290713 CATTCAGGAGGCATGGGATCAGG - Intergenic
944100665 2:196022906-196022928 GATTCAGGGGGTTTAGGTGCAGG + Intronic
945070284 2:205982380-205982402 CATTAAGAATGTTTGGGGCCGGG - Intergenic
946154569 2:217799024-217799046 AATTCAGAAAGTTTGGGGGTGGG - Intergenic
947391511 2:229644094-229644116 CATTTGGGAAATTTGGGGGCAGG - Intronic
948029836 2:234808327-234808349 CATTCAGGAGATCTGGGGTGGGG + Intergenic
948163843 2:235845820-235845842 CATGCATGTGGTTTGGGGCCTGG + Intronic
948176886 2:235950469-235950491 TACTCCTGAGGTTTGGGGGCTGG + Intronic
948473281 2:238200350-238200372 CATTTAAGAGGTTTAGGGGTGGG + Intronic
948584236 2:239009079-239009101 AATGCAGGAGGCTTGGGGGTCGG - Intergenic
1169973205 20:11293737-11293759 GATTCAGTCGGTTTGGGGGTGGG + Intergenic
1169983031 20:11408341-11408363 CATTCTTGAGGTTTGTGGGATGG - Intergenic
1170003851 20:11645304-11645326 TATTCAGGAGGTCTGGGGCGGGG - Intergenic
1170303390 20:14911167-14911189 CATTCAATAGGTCTGGGGGAGGG - Intronic
1170393745 20:15903567-15903589 GATTCAGTAGGTTTGGGGGTGGG + Intronic
1171375778 20:24693429-24693451 AATTCAGTAGGTTTGGGGGTGGG + Intergenic
1171957850 20:31473642-31473664 AATTCAGTAGGTTTGGGGTAGGG - Intronic
1173135940 20:40438961-40438983 AATTCTGGAAGTTTGGTGGCTGG - Intergenic
1174062811 20:47844490-47844512 CATTCAGCAGGCTTGGGGATAGG - Intergenic
1174082256 20:47978939-47978961 CACTCATGAGGCTGGGGGGCAGG - Intergenic
1174151166 20:48487486-48487508 CATTCAGCAGGCTTGGGGATAGG - Intergenic
1174794860 20:53513584-53513606 CATTCAGTAGGTCTGGGGCAGGG - Intergenic
1175525656 20:59631749-59631771 CAGTGAGGTGTTTTGGGGGCTGG - Intronic
1176091160 20:63319228-63319250 CAGTCAGGAGGAGTAGGGGCAGG + Intronic
1177659471 21:24064163-24064185 CTGTCAGGGGGGTTGGGGGCAGG + Intergenic
1178193818 21:30319555-30319577 AAGTGAGGAGGTTTTGGGGCTGG + Exonic
1178513124 21:33223657-33223679 CATTCAGATGGTTGGGGGGAGGG + Intergenic
1178791957 21:35708742-35708764 CAATCAGGTTGTTTGGGGGTTGG - Intronic
1179249956 21:39664308-39664330 GAGTACGGAGGTTTGGGGGCTGG - Exonic
1180164802 21:46019492-46019514 AAATCAGGAGGTTTGGGGAAAGG - Intergenic
1180979872 22:19873391-19873413 CACTCAGGGGTGTTGGGGGCAGG + Intergenic
1181782774 22:25205094-25205116 CCTGCAGCAGGTTTGGGGGTGGG + Intronic
1182572483 22:31249399-31249421 GACTGAGGAGGTGTGGGGGCTGG - Intronic
1183505039 22:38203947-38203969 GAGTCAGGAGGGTTGGGGCCAGG + Intronic
1183597710 22:38822450-38822472 CATTCTGGAGGTGTGGGTACAGG + Exonic
1184719039 22:46298601-46298623 CATTGAGGATGCTTGGGGCCAGG - Intronic
949488703 3:4566674-4566696 CATTCAGGAGGTTAGGAACCTGG - Intronic
950437563 3:12989717-12989739 CACTCAGGAGGGTTGAGGGCGGG - Intronic
950586218 3:13894563-13894585 CCTTCAGGAGGTTGGGTCGCAGG - Intergenic
951094322 3:18610235-18610257 CATTCAGTAGATTTGGGGCAGGG - Intergenic
951503599 3:23417508-23417530 CAGTCAGGAGGCATGGGGGTTGG + Intronic
952735785 3:36690349-36690371 CAGCAAGGAGGTTTGGGGGACGG + Intergenic
953286710 3:41617301-41617323 CAGTCAGGAGGCTTGGGGTCAGG - Intronic
953524522 3:43677652-43677674 CATTCAGGTGGTGGGCGGGCTGG + Intronic
953742861 3:45552160-45552182 AATTCAGGAGGTTCAAGGGCTGG - Intergenic
954304900 3:49720465-49720487 CAGTCAGAAGGCTTGGGGCCTGG - Exonic
955005139 3:54961630-54961652 CATTGAGAAGTTTTGTGGGCAGG + Intronic
955456767 3:59130104-59130126 GATTCTGTAGGTTTGGGTGCTGG + Intergenic
955722637 3:61899700-61899722 AATTCAGTAGATTTGGGGGCAGG + Intronic
955816050 3:62844510-62844532 CATTCATGAGGGTTGGGGAGTGG - Intronic
956227642 3:66977663-66977685 CATTCAAGAGGCTTAAGGGCTGG + Intergenic
957282563 3:78172444-78172466 CTTTCAGGAAGTTTTGAGGCAGG - Intergenic
958027804 3:88069454-88069476 CATTCAAGTGGGTTGGGGGGTGG - Intronic
958110405 3:89135204-89135226 CATTTAGGAGGTGGTGGGGCAGG - Intronic
958433735 3:94072590-94072612 TATTCAGGGAGGTTGGGGGCCGG + Intronic
958515715 3:95112653-95112675 CAGTCAGGAGGCATGGGGTCAGG + Intergenic
958902872 3:99908442-99908464 CATTCAGTATGTTTGGGGTTGGG + Intronic
959558445 3:107750968-107750990 CAGTCAGAAGCTTTGGTGGCGGG - Intronic
961002861 3:123385595-123385617 CATGCAGGAGTTCTGGGAGCTGG - Intronic
961106767 3:124249248-124249270 CCTTCAGGAGGTTTGTGGTCTGG + Intronic
961211552 3:125129596-125129618 CTGTCAGGAGGATGGGGGGCTGG + Intronic
961402797 3:126658813-126658835 CATCCAGGTGGTTTTGGAGCTGG - Intergenic
961489204 3:127240826-127240848 CACCCAGGAGGTTGGGGGGTGGG + Intergenic
961629234 3:128284122-128284144 CATTCAGGTTGTGTGGGGGGTGG - Intronic
961909618 3:130301252-130301274 GATTCAAGAGGGGTGGGGGCTGG + Intergenic
962131276 3:132680048-132680070 CATTCAGTAGGTTTGGGGAGAGG + Intronic
962581862 3:136805243-136805265 CATTTAGGAAATTTGGTGGCAGG + Intergenic
962990407 3:140572669-140572691 CATTCAGTAGGTCTGGGGTGGGG - Exonic
963140273 3:141941197-141941219 CATTCAGATGGTTGGGGGGTGGG - Intergenic
964154575 3:153569415-153569437 GCTTAAGGAGTTTTGGGGGCAGG - Intergenic
964621179 3:158721378-158721400 GATTCAGGAGGTCTGGGGTGGGG + Intronic
965368287 3:167826895-167826917 CATTCAGTAGGTCTAGGGGGTGG + Intergenic
966427452 3:179794556-179794578 CATTCAGGAAGAAGGGGGGCTGG - Intergenic
966572951 3:181467536-181467558 CATTCAGTATGATTGAGGGCTGG + Intergenic
966586744 3:181634718-181634740 CCTTCAGGAGTCTTGGGGGAAGG + Intergenic
966673082 3:182551487-182551509 CTGTCAGGGGGTTTGGGGGAGGG - Intergenic
967037707 3:185660371-185660393 CCTTCAGGAGATTCGGGGGATGG - Intronic
969108167 4:4823692-4823714 CAGTCAGGAGGTGTGGGCCCTGG - Intergenic
969952573 4:10853577-10853599 CAGTCAGGAGGTATGGGGTCAGG + Intergenic
970295325 4:14623757-14623779 CATTTTGGGGGTTGGGGGGCTGG - Intergenic
972159269 4:36203169-36203191 AAAACAGGAGGTTTTGGGGCTGG + Intronic
972303207 4:37805896-37805918 CATTCAGATGGTTGGGGGGCGGG - Intergenic
973159193 4:46994068-46994090 CATTCAGGTGTTATGGGGGGCGG + Exonic
974771324 4:66417960-66417982 GATTCAGGAGGTTCGGTGGATGG - Intergenic
974814620 4:66988907-66988929 CAATCAGGAGGCATGGGGTCAGG + Intergenic
975273413 4:72465623-72465645 CCTTCATGAAGTTTGGGTGCAGG + Intronic
975577342 4:75876286-75876308 CACTCAGGAGGAGTGGAGGCAGG - Exonic
976531606 4:86160519-86160541 CATTTAGGAGATTTGTGGGCAGG + Intronic
977291290 4:95167603-95167625 CAGTCAGGAAGGCTGGGGGCAGG + Exonic
977959810 4:103072906-103072928 CATTCATGAGGGTTGAGTGCTGG - Intronic
978409813 4:108415178-108415200 CTCCCAGGAGATTTGGGGGCAGG + Intergenic
980855290 4:138432082-138432104 CAGTCAGGAGGCATGGGGTCAGG - Intergenic
981938209 4:150256152-150256174 GATTCCGGAGGGGTGGGGGCCGG - Exonic
983953862 4:173674674-173674696 GATTCTGGGGGGTTGGGGGCGGG - Intergenic
984447075 4:179850090-179850112 CATAGAGGTGGTATGGGGGCAGG - Intergenic
986576567 5:9219441-9219463 CATTCTGGAGTACTGGGGGCTGG - Intronic
986694637 5:10340699-10340721 CACTCAGGAGGTGTGAGGCCTGG + Intergenic
987051271 5:14148554-14148576 AATTGAGGAGGAATGGGGGCAGG - Intronic
989352048 5:40497785-40497807 CATTCAGGAGATTTGAGTGCAGG + Intergenic
990542171 5:56784450-56784472 GATTCAGGAGGTCTGGGGTGGGG + Intergenic
990619406 5:57543583-57543605 CATTCAGTAGGTCTGGGACCAGG - Intergenic
990731367 5:58812368-58812390 GATTCAGGAGGTCTGGGGTGGGG - Intronic
992172653 5:74119728-74119750 GATTCTGGAGGGTTGGGTGCTGG - Intergenic
992204773 5:74420929-74420951 GATTCAGTAGGTTTGGGGTGGGG - Intergenic
992440825 5:76796265-76796287 GATTCAGGAGGTCTGGGGTGAGG + Intergenic
992599326 5:78382122-78382144 CATTCAGTAGGTCTGGGGTGGGG - Intronic
992940754 5:81758959-81758981 TAATCAGGAGGTTTAGGGGCCGG - Intergenic
993884621 5:93401103-93401125 GATTCAGGAGGCTTTGGGGTGGG + Intergenic
995741317 5:115358880-115358902 CATTCAGATGGTTTGGGGTGGGG - Intergenic
996245960 5:121263971-121263993 GATTCCGGAGGTTTTGGTGCGGG - Intergenic
997040230 5:130244155-130244177 AATTCAGGAGGTTTGGAGAGGGG - Intergenic
997206808 5:132054930-132054952 GATTCAGGGGGTGTGGGGGTTGG + Intergenic
997629128 5:135353387-135353409 CATTGCTGAGGGTTGGGGGCTGG + Intronic
997762335 5:136461902-136461924 CATTCAGGAGGTCTGGGCTGGGG + Intergenic
997957630 5:138292229-138292251 AATTCAGTAGGTTTGGGGTGTGG - Intronic
998390026 5:141781239-141781261 GATTCAGTAGGTTTGGGGAGGGG + Intergenic
998465887 5:142343557-142343579 CATCCAGGAGTGCTGGGGGCAGG + Intergenic
998482292 5:142472997-142473019 CATTCAGGAGGTATGGGATGGGG - Intergenic
998489100 5:142530416-142530438 CCTTCAGGAGGTGAGGTGGCAGG - Intergenic
998985786 5:147754937-147754959 CATCAAGGAGCTTTGGGGGTAGG + Intronic
999186483 5:149714373-149714395 CATTGAGGGGGTATGGGGGCGGG - Intergenic
999496762 5:152106799-152106821 GATTCAGTAGGTCTGGGGGATGG - Intergenic
1000798762 5:165697778-165697800 CCTGTAGGAGGTTTGGGGGTGGG + Intergenic
1001263639 5:170255779-170255801 AATTCAGGAGGTCTGGGGTGAGG - Intronic
1001546744 5:172575099-172575121 CTTTCAAGGGGTTTGGGGGGTGG - Intergenic
1002068381 5:176664100-176664122 CATGCAGGAGGTTTCTAGGCAGG + Intergenic
1002098528 5:176846022-176846044 CATTCAGCAGGTTTCTGGCCAGG + Intronic
1002168849 5:177364165-177364187 CATTCAGGAGGGTGGGGGTTGGG + Intronic
1003893023 6:10580312-10580334 CATTGAGGAGGATTGGGTGGGGG - Intronic
1005715897 6:28548038-28548060 GACTCAGGAGGTGTGGGGGGAGG + Intergenic
1006293206 6:33156835-33156857 CATCCAGGAGATTGGGTGGCAGG + Intergenic
1006505731 6:34487519-34487541 GATGCAGGAGGTTTGGATGCAGG + Intronic
1008589835 6:52983078-52983100 CATGCAGGAGGCTTGGGGAGGGG + Intronic
1009060095 6:58387967-58387989 CAGTCAGGAGGGATGGGGTCAGG - Intergenic
1009230821 6:61059425-61059447 CAGTCAGGAGGGATGGGGTCAGG + Intergenic
1009403021 6:63278362-63278384 CATTCTGGAGGTTTCAGGACAGG + Intronic
1011184096 6:84655093-84655115 CATTCAGTAGGATTGGGGTGAGG + Intergenic
1012343405 6:98156606-98156628 CAGTCAGGAGGCATGGGGTCAGG + Intergenic
1013950077 6:115769538-115769560 CATCCAAGAGGTCTGAGGGCTGG - Intergenic
1013987608 6:116214585-116214607 GATTCAGTAGGTTTGGGGTGGGG - Intronic
1015093964 6:129392368-129392390 GATTCAGGAGGTCTGGGAGGGGG - Intronic
1015891194 6:137971195-137971217 CATTGAGGAGGCTGGGGGGTGGG + Intergenic
1016502584 6:144738370-144738392 CCCTCTGGAGGTTTGGGGGTAGG - Intronic
1017795070 6:157836549-157836571 GATTCAGGAGGTCTGGGGTGGGG + Intronic
1019352533 7:561749-561771 CATCCATGAGGTCTGGGGCCCGG + Intronic
1019895851 7:3982542-3982564 CATTAAGAATGTTTGTGGGCTGG + Intronic
1021606325 7:22412827-22412849 GATTCAGGAGGTCTGGGGTGGGG + Intergenic
1021749282 7:23779298-23779320 CAGTCAGGAGGATGGGGGTCAGG + Intronic
1023591029 7:41780731-41780753 CAGACAGGTGGTTTGGGGGATGG - Intergenic
1024445966 7:49479406-49479428 CATTCTTGAGGGTGGGGGGCTGG + Intergenic
1025231586 7:57206421-57206443 CATTCAGCAGGCTTGGGGATAGG + Intergenic
1025716482 7:63961990-63962012 CATTCAGTAGGCTTGGGCTCTGG - Intergenic
1025872482 7:65447955-65447977 AATTCAGCAGGTTAAGGGGCTGG + Intergenic
1025986084 7:66453448-66453470 GATTCAGGAGGACTGGGAGCTGG - Intergenic
1026028927 7:66772049-66772071 GATTCAGGAGGACTGGGAGCTGG + Exonic
1026260631 7:68752390-68752412 CATTGACAAGGTTGGGGGGCAGG - Intergenic
1026375593 7:69747135-69747157 GATTCAGGAGGTTTAGGGCAGGG + Intronic
1026916002 7:74120809-74120831 CATCCAGGTGGTTTGAGGGCAGG - Intronic
1027209300 7:76131995-76132017 GATTCAGGAGGACTGGGAGCTGG - Intergenic
1028135906 7:87222649-87222671 CATTCAGTAGGTTTGGGGTGAGG - Intergenic
1029465841 7:100724012-100724034 CTTTTGGGAGTTTTGGGGGCTGG + Intergenic
1031526197 7:122823542-122823564 AATTCAGTAGGCTTGGGGGTGGG + Intronic
1031874274 7:127120495-127120517 CATTCAGTAGGTCTGGGGTGGGG - Intronic
1031969690 7:128055176-128055198 CAGTCAGGGGGTTGGGAGGCAGG + Intronic
1032229223 7:130059838-130059860 CATGCAGGAGGTTTTTGGGGAGG - Intergenic
1032268260 7:130383228-130383250 CACTCAGGTGGGTTTGGGGCTGG - Intronic
1032762852 7:134960611-134960633 CTTACAGAAGGTTTGGGAGCAGG - Exonic
1034066430 7:148141074-148141096 GATTCAGTAGGTTTGGGGTGGGG - Intronic
1035000463 7:155608693-155608715 GATTCAGGAGGTCTTGGGTCAGG - Intergenic
1035243677 7:157548667-157548689 CATTCACTAGATTTGGGGGTGGG - Intronic
1035835073 8:2741444-2741466 CATTCAGGTGGTTGGGGGAGGGG - Intergenic
1036459537 8:8939570-8939592 GATTCAGTAGGTTTGGGGCTAGG - Intergenic
1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG + Intergenic
1037824625 8:22153972-22153994 CATTCAGGATGTCCAGGGGCCGG + Exonic
1039897993 8:41729867-41729889 CATTCAGGGAGTTGAGGGGCAGG + Intronic
1040424390 8:47270528-47270550 GACCAAGGAGGTTTGGGGGCGGG - Intronic
1042549263 8:69979935-69979957 TGTTCAGGAGGTTTGCAGGCAGG + Intergenic
1043343171 8:79266814-79266836 AATGCTGGAGGTTTGGGGGGTGG + Intergenic
1044271784 8:90253243-90253265 CTTGCAGGAGGTTGGGGGGTGGG - Intergenic
1044558685 8:93591474-93591496 CAGCCAGTGGGTTTGGGGGCTGG - Intergenic
1044804502 8:95991395-95991417 CATTCAGTAGGTTTGAGGCAGGG + Intergenic
1044953805 8:97459281-97459303 CATTCAGTAGGTGGGGTGGCGGG + Intergenic
1045750500 8:105478190-105478212 CATTCAGAAAGTATCGGGGCTGG - Intronic
1046917673 8:119694189-119694211 CATTCAAGAGGTCTGTAGGCAGG - Intergenic
1048232659 8:132659111-132659133 GATTCAGTAGGTCTGGGGACGGG + Intronic
1048831239 8:138479326-138479348 CATCCTGGAGGTTGGGAGGCCGG + Intronic
1048960611 8:139573739-139573761 GATTCAGTAGGTTTGGGGTGAGG - Intergenic
1050624070 9:7485151-7485173 GATTCAGGAGGTCTGGTGTCAGG - Intergenic
1051585380 9:18721615-18721637 ACTTCAGGAGCTGTGGGGGCCGG - Exonic
1052391850 9:27888549-27888571 GATTCAGGAGGTCTGGAGTCAGG - Intergenic
1052487642 9:29122974-29122996 CATTCAGCAGTTCTGGGGGTAGG + Intergenic
1052515271 9:29472229-29472251 CAGTCAGGAGGAATGGGGTCAGG + Intergenic
1053007922 9:34616274-34616296 CATCCAGGAGAGTTGGGGGCAGG - Intronic
1055651111 9:78408011-78408033 CCTTCAGGAGTTCAGGGGGCCGG + Intergenic
1056658112 9:88525224-88525246 CATTCATGGGGTTTGGAAGCTGG + Intergenic
1058745770 9:107989176-107989198 CACTCTGGAGGGTTGGGGGTTGG + Intergenic
1059070430 9:111130170-111130192 TATTCAGGAGGTTTAGGGAGAGG - Intergenic
1059352794 9:113677412-113677434 CATGCAGCAGGTCTGGGGTCTGG - Intergenic
1059485303 9:114622391-114622413 CAGCCAGGAGGTCTGGGGGGTGG - Intronic
1059902111 9:118939454-118939476 CATTCAGGGGGTATGGGTGTGGG + Intergenic
1060516732 9:124270666-124270688 CAGGCAGGAGGGTCGGGGGCAGG - Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061943898 9:133897846-133897868 CATTCTGGAGGCCTGGGGGCGGG - Intronic
1186731900 X:12419165-12419187 AAATCAATAGGTTTGGGGGCAGG - Intronic
1186894668 X:13993879-13993901 CATTCAGTAGGTCTGGGGTGGGG - Intergenic
1187442938 X:19336188-19336210 TATTCAGGAGGTTTGGGATGGGG + Intergenic
1187510530 X:19913586-19913608 GATTCAGGAGGTCTGGGGTGGGG + Exonic
1187671019 X:21665915-21665937 GATTCAGCAGGTTTGGGGTGAGG - Intergenic
1187869232 X:23750713-23750735 CATGAAGGAGGTGTGGGAGCAGG - Intronic
1188357969 X:29215887-29215909 CTTTCAGGAGATTGGGGGCCAGG - Intronic
1189096893 X:38150103-38150125 AATTCAGTAGGTTTGGGGTTGGG - Intronic
1189271821 X:39757468-39757490 GATTTAGCAGGTCTGGGGGCAGG + Intergenic
1189406734 X:40732220-40732242 CATCAAGAAGGTTTGGAGGCTGG + Intronic
1191011114 X:55760377-55760399 GATTCAGCAGGTTTGGGGTGAGG + Intergenic
1191190514 X:57661800-57661822 TCTTCTGGATGTTTGGGGGCTGG + Intergenic
1191202963 X:57804214-57804236 TATTCAGAAGGTTGGGGGGTGGG + Intergenic
1192741078 X:73893197-73893219 CAGTCAGGAGTTATGGGGGCAGG - Intergenic
1192958113 X:76095303-76095325 CAGTCAGGAGGCATGGGGTCAGG + Intergenic
1193394047 X:80963033-80963055 CCTTCAGGAGCTTTTAGGGCAGG + Intergenic
1194783070 X:98048812-98048834 CAGTCAGGAGGCATGGGGGTTGG + Intergenic
1195229461 X:102831616-102831638 CATTCATGACATTTGGGGTCAGG - Intergenic
1195260010 X:103122619-103122641 CATTCATGGCGTTTGGGGTCAGG + Intergenic
1196467118 X:115983668-115983690 CAATCAGGAGGCATGGGGGTCGG - Intergenic
1196832874 X:119790114-119790136 CATTGAGAAGATTTTGGGGCTGG - Intronic
1197319172 X:125006548-125006570 CAATCAGGAGGCATGGGGCCAGG - Intergenic
1198160719 X:134005216-134005238 AATTCAGCAGGTTAAGGGGCTGG - Intergenic
1198559137 X:137829805-137829827 GATTCAGTAGGTTTGGGGTGGGG - Intergenic
1198821875 X:140656805-140656827 CATTTAGCAGGTGTGGCGGCGGG + Intergenic
1199819070 X:151426765-151426787 AATTCAGTAGGTTTGGAGTCAGG + Intergenic
1201611236 Y:15845238-15845260 CATGCAGGTGGTTTGGGAGAAGG + Intergenic
1201917586 Y:19198918-19198940 GATTCTGGGGGGTTGGGGGCAGG + Intergenic