ID: 900098053

View in Genome Browser
Species Human (GRCh38)
Location 1:948363-948385
Sequence CCAGCCCTGGGAGACCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900098041_900098053 13 Left 900098041 1:948327-948349 CCAGGGCACGGACTGCAAGGAAG 0: 1
1: 0
2: 1
3: 15
4: 143
Right 900098053 1:948363-948385 CCAGCCCTGGGAGACCATGAAGG 0: 1
1: 0
2: 3
3: 33
4: 341
900098039_900098053 19 Left 900098039 1:948321-948343 CCATCTCCAGGGCACGGACTGCA 0: 1
1: 0
2: 2
3: 11
4: 177
Right 900098053 1:948363-948385 CCAGCCCTGGGAGACCATGAAGG 0: 1
1: 0
2: 3
3: 33
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900098053 Original CRISPR CCAGCCCTGGGAGACCATGA AGG Intronic
900098053 1:948363-948385 CCAGCCCTGGGAGACCATGAAGG + Intronic
900129624 1:1081878-1081900 CCAGGTCCCGGAGACCATGATGG + Exonic
901325878 1:8364877-8364899 CCAGCCTTGGCTGAGCATGATGG - Intronic
902902741 1:19530985-19531007 CCAGCACTGGGAGGCCAAGGCGG - Intergenic
903393792 1:22983832-22983854 CCAGCTATGGGAGACCTTGTTGG - Intergenic
903672736 1:25046159-25046181 CCAGCCCCGGGAGACAAAGGAGG + Intergenic
903788464 1:25876201-25876223 CCAGCCCTGGGAGCACCTGAAGG + Intergenic
903789787 1:25885040-25885062 CCAGCCCTGGGGAACCAGCATGG - Intronic
904543266 1:31248416-31248438 CCAGCCTTTGGAAACCATGTGGG + Intergenic
905033754 1:34904361-34904383 CCGGCCCTGGCTGACCATCATGG + Exonic
905341537 1:37281788-37281810 CAGGGCCTGGGAGGCCATGATGG - Intergenic
905512661 1:38534962-38534984 CCAGGCGCGGGAGACCAAGAGGG - Intergenic
906670825 1:47653330-47653352 CCAGCACTGGGAGGCCAAGGTGG - Intergenic
909651106 1:77977256-77977278 CCAGCTTTGGGAGGCCAAGACGG + Intronic
912643439 1:111369150-111369172 GAAGCCCTGGGAGAGAATGAAGG + Intergenic
913108721 1:115639698-115639720 CTAGCCAAGGGAAACCATGAGGG - Intergenic
914850607 1:151311200-151311222 CCTGCCCTGGTAGACCATGTTGG - Intronic
915469679 1:156118383-156118405 CCAGGCCTGGGACACCAGGCGGG + Intronic
916074194 1:161190947-161190969 CCTGCCCTGGGAGGCAGTGATGG - Exonic
916215060 1:162387016-162387038 CCAGCCAGGGGAGCCAATGATGG - Intergenic
916545127 1:165796887-165796909 CCAACACTGGGAGGCCAAGATGG + Intronic
916878784 1:168998793-168998815 CTAGCCAAGGGAAACCATGAGGG - Intergenic
917863562 1:179171758-179171780 CCAGCACTGGGAGGCCAAGGTGG - Intronic
919471908 1:197989239-197989261 CCGGCCCTGGGGGACCATGGGGG + Intergenic
920382512 1:205543595-205543617 CCAGCTCTGGGAGCGCATGCGGG + Intergenic
921962172 1:221047349-221047371 CTAGCCATGGGAGGCCATGAGGG + Intergenic
922360048 1:224812780-224812802 TCATCCATGGGAGGCCATGAAGG - Intergenic
922601780 1:226861485-226861507 ACAGCTCTGGGATACCTTGATGG - Intergenic
922751690 1:228073126-228073148 ACAGCGCTGGGAGACCCGGATGG + Intergenic
924952376 1:248896856-248896878 CCAGGCCAGGGAGGCCGTGAGGG + Intergenic
1063024793 10:2167197-2167219 CCAGCCCTGGGTGACAGAGAAGG - Intergenic
1063262728 10:4408515-4408537 TCAGCCCAGGGAGACCCTGAGGG + Intergenic
1063807320 10:9660350-9660372 CCAGCCTTGGGAGGCCGAGATGG + Intergenic
1065496354 10:26332728-26332750 CCAGCCAGGAGAGACCAGGACGG + Intergenic
1068016322 10:51521039-51521061 CCAGCACTGGGAGGCCAAGGCGG + Intronic
1069380532 10:67839679-67839701 CCAGCACTGGGAGACCGAGGCGG + Intergenic
1070213108 10:74347348-74347370 CCAGCCAAGGGAAGCCATGAGGG + Intronic
1070493745 10:77001783-77001805 ACAGCCTTGGGAGACGATAAAGG - Intronic
1070650072 10:78228912-78228934 CCAGCTCTGGGAGTAAATGATGG - Intergenic
1070683382 10:78464814-78464836 CCAGCCCTGGGAGACACTCCGGG + Intergenic
1071686725 10:87765778-87765800 CCAGCCTTGGGAGGCCAAGGCGG + Intronic
1071732908 10:88267013-88267035 CCTGCACTGGGAGACAAAGAAGG - Intergenic
1071761832 10:88616644-88616666 CCAGGCCTGGAAGACTCTGACGG + Intergenic
1072232826 10:93427283-93427305 CCAGCACTGGGAGGCCAAGGTGG + Intronic
1072620241 10:97074827-97074849 CCAGCCCTGGGAGAGGATGGGGG - Intronic
1072725101 10:97807712-97807734 CCAGCCCTTGGAGAGCATACTGG - Intergenic
1073021480 10:100448345-100448367 CCAGCACTGGGAGGCCAAGGCGG - Intergenic
1074469114 10:113711133-113711155 CCACCCCTGGGAGAACCTGCTGG + Intronic
1075488597 10:122847516-122847538 CCAGCCATGGGTGACAAAGAGGG - Intronic
1075634449 10:124020668-124020690 CCAGCCCAGGGAGCCCAGCATGG + Intronic
1076132114 10:128020681-128020703 CCACCACTGGGACACCAGGAGGG - Intronic
1076222705 10:128747347-128747369 CCAGCCCTCTGGGACCATGGAGG - Intergenic
1076708151 10:132313565-132313587 CCAGTCCTGACAGAGCATGAGGG + Intronic
1076823363 10:132953338-132953360 ACAGCCCCAGGAGACCCTGAGGG + Intergenic
1077465094 11:2730157-2730179 ACAGACCTGGCAGACCAGGAGGG + Intronic
1077914223 11:6600826-6600848 CCAGCACTGAGATACCAGGATGG + Intronic
1078360579 11:10664638-10664660 CCAGCCCTGGGATGCCAGGAAGG - Intronic
1080214607 11:29826933-29826955 TCAGCCAAGGGAGACCATGTGGG + Intergenic
1080436792 11:32252320-32252342 CCAGCACTGGGAGGCCAGGGTGG - Intergenic
1083164084 11:60872949-60872971 CCATCCCAGGGAGACCAGGTGGG + Intronic
1083535103 11:63460061-63460083 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1083540933 11:63511118-63511140 CCAGCCCTGACAGAGCAGGAGGG - Intronic
1084085933 11:66855270-66855292 CCAGCACTGGGTGGCCATGGTGG + Intronic
1084868742 11:72081171-72081193 CCAACACTGGGAGACCAAGGCGG + Intronic
1085280613 11:75327834-75327856 CCAGCACTGGGAGGCCAAGGTGG - Intronic
1085531867 11:77196720-77196742 CCACCCATGAGAGCCCATGAGGG - Intronic
1086114157 11:83229740-83229762 CTAGCCCTAGGAGTCCTTGATGG - Intronic
1086947876 11:92861240-92861262 CCAGCCCTGTTAGAGCATGAAGG - Intronic
1088652370 11:111969178-111969200 CCAGCACTGGGAGGCCAAGGCGG + Intronic
1089144393 11:116313964-116313986 CCATACCTGAGAGAACATGAGGG - Intergenic
1089769910 11:120795353-120795375 CCAGCCCCGGGGGACCCTGGAGG + Intronic
1090158159 11:124463520-124463542 CCAGCCCAGGGAGAGCATCCTGG + Intergenic
1090307428 11:125703360-125703382 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1090475254 11:127014340-127014362 CCAGCCCATGGAGTCTATGATGG - Intergenic
1090725154 11:129518325-129518347 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1090957587 11:131527140-131527162 TCAGCTCTGGGAGACCAGGGGGG - Intronic
1091638094 12:2213418-2213440 CCAGCCCTGGAAGACCACATGGG - Intronic
1092629010 12:10358755-10358777 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1093664536 12:21795779-21795801 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1095930871 12:47624070-47624092 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1096144751 12:49270731-49270753 CCAGCACTGGGAGGCCAAGGTGG + Intronic
1096853408 12:54458617-54458639 CCAGCACGGGGAGACCAAGGCGG - Intronic
1097006051 12:55918618-55918640 CCAGCACTGGGAGGCCAAGGCGG + Intronic
1097412069 12:59267836-59267858 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1097654497 12:62343621-62343643 CCAGCCAAGGGAAGCCATGAGGG - Intronic
1097693684 12:62757158-62757180 CCAGCCCTACGAGAGCATGAGGG - Intronic
1101042148 12:100767501-100767523 CAAGCACTGTGATACCATGATGG + Intronic
1101514326 12:105420203-105420225 CCAGCCATGAGTGAGCATGAGGG - Intergenic
1101912073 12:108867387-108867409 CCAGCACTGGGAGGCCAAGGTGG + Intronic
1102586990 12:113930502-113930524 CCAGCCCAGGAAGAACAAGAGGG + Intronic
1102954896 12:117052968-117052990 GCAGGCCTGGGAGACCAGGTGGG - Intronic
1103631835 12:122267782-122267804 CCAGCACTGGGAGGCCGAGACGG - Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1103956135 12:124577931-124577953 CAAGCAATGGGAGACCCTGATGG + Intergenic
1104692899 12:130839681-130839703 CCAGCCCTGGGATACCATTCTGG + Intergenic
1105470739 13:20692477-20692499 CCAGCTCTGGGAGGCCAAGGTGG - Intergenic
1108753544 13:53473445-53473467 CCTGGCCTGGGAGGTCATGATGG + Intergenic
1110128640 13:71979144-71979166 TCAGCCCTGGGAGACCAAGATGG - Intergenic
1110860926 13:80343353-80343375 GCAGCGCTGGGAGACCAGCAAGG - Intergenic
1112913945 13:104523008-104523030 CCAGCCAAGGGAGGCCATGAGGG - Intergenic
1114191795 14:20445048-20445070 CCAGCACTGGGAGGCCAAGGCGG - Intergenic
1115339022 14:32272642-32272664 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1115742173 14:36399832-36399854 GCAGCCCTGGGGCACCATGCTGG + Intergenic
1116781705 14:49244017-49244039 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1117172330 14:53113658-53113680 CCAGCCAAGGGAAGCCATGAGGG + Intronic
1117698909 14:58394466-58394488 CCAGCACTGGGAGACCGAGGTGG - Intergenic
1118072797 14:62264297-62264319 CCAGCACTGGGAGGCCAAGGCGG - Intergenic
1118143547 14:63111533-63111555 CCAGCTCTGGGAGACAATCTAGG - Intergenic
1118619359 14:67600484-67600506 CCAGCACTGGGAGGCCAAGGCGG + Intergenic
1118905535 14:70020688-70020710 CCTGCACTGGGAGGCCTTGATGG + Intronic
1119479780 14:74952055-74952077 CCAGCCCTGGCAGTGCCTGAGGG - Intronic
1121108468 14:91296109-91296131 CCAGCCCAGGGAGACGAACATGG + Intronic
1121898931 14:97674535-97674557 CTAGCCAAGGGACACCATGAGGG + Intergenic
1122117403 14:99534779-99534801 CCAGCCCTGGGAAGCCAGCACGG + Intronic
1122255210 14:100471336-100471358 CCAGCCCTGGCAGTCCCTGATGG - Intronic
1122266264 14:100548348-100548370 CCTGCCCTAGGAGCCCAGGATGG - Intronic
1123632192 15:22269251-22269273 CCAGGCCAGGGAGACCAAAAAGG - Intergenic
1123917528 15:25047729-25047751 CCAGCAGTGGGAGGCCATGGTGG - Intergenic
1124645162 15:31433434-31433456 ACAGCCCAGGGAGACCAAGGTGG - Intronic
1125288456 15:38119637-38119659 CTAGCCAAGGGAAACCATGAGGG + Intergenic
1125373091 15:38999734-38999756 CCAGCCAAGGGAGACGGTGAGGG + Intergenic
1125600752 15:40914752-40914774 GCAGCCCTGTGGGACCAGGATGG - Intergenic
1125997599 15:44178743-44178765 CCAGCACTGGGAGGCCAAGGCGG + Intronic
1126111094 15:45175243-45175265 CCAGCCCTGGGAGTGGAAGAAGG - Exonic
1129267414 15:74401457-74401479 TCAACCCTGGGACACCAGGAAGG + Intergenic
1129465601 15:75722641-75722663 TCAGCACTGGGATACCATCAGGG + Intergenic
1129526579 15:76220313-76220335 CCAGCACTGGGAGGCCAAGGTGG - Intronic
1129542733 15:76364243-76364265 GCAGCCTTGGCAGACCATGTGGG + Intronic
1129606735 15:77028671-77028693 CCAGCCCTGGGCGACCCACACGG - Intronic
1130009278 15:80135874-80135896 CCAGCACTGGGAGGCCAAGGTGG + Intronic
1130367617 15:83254424-83254446 TGAGCCCAGGGAGATCATGATGG + Intergenic
1132599385 16:767206-767228 CCAGGCGTGGGAGACCCTGGAGG - Intronic
1132756258 16:1486948-1486970 TGAGCCCTGGGAGACCGTGTTGG - Intronic
1132826535 16:1908125-1908147 ACAGCCCTGGGAGTCCAGGAAGG - Intergenic
1133133567 16:3693514-3693536 CCAGCCCTGGGGGCACAGGAGGG + Intronic
1133433065 16:5755392-5755414 CCAAGACTGGGAGACCAGGAAGG + Intergenic
1133805256 16:9121804-9121826 CCAGCACTGGGAGGCCAAGGCGG + Intergenic
1134325306 16:13202025-13202047 CCATCACTGGGAGATAATGATGG - Intronic
1136522322 16:30805217-30805239 CCAGCACTGGGAGGCCAAGGCGG - Intergenic
1136652270 16:31683079-31683101 CCAGCCCTGGCAGTGCATCAGGG + Intergenic
1137810174 16:51345077-51345099 CCAGTCCTGGCAAACCAGGATGG - Intergenic
1137895513 16:52207711-52207733 TCTGCCCTGGGAGCCCATGCTGG + Intergenic
1139632408 16:68238548-68238570 CCAGCACTGGGAGACCGAGGCGG - Intergenic
1139825490 16:69754050-69754072 CCAGCACTGGGAGACCGAGGCGG - Intronic
1141718470 16:85741143-85741165 CCTGCCCTGGGAGACCATGGTGG - Intronic
1141970784 16:87481118-87481140 CCAGGCCAGGGAGACCAAAAAGG + Intronic
1143389048 17:6549411-6549433 CCAGCCCTAGGAGAGCCTGGAGG + Intronic
1143872312 17:9965833-9965855 TCAGCCCTTGGAGACCTGGATGG - Intronic
1146267091 17:31459879-31459901 CAAGCCCTGGGACCCCAGGAGGG - Intronic
1147260912 17:39209566-39209588 CCAGCCCTGGGAGTGGAAGAAGG - Intergenic
1148546475 17:48522964-48522986 CCATTCCTGGGAGAACATGGAGG - Intergenic
1148919351 17:51016657-51016679 CCAGCACTGGGAGGCCAAGGCGG + Intronic
1151269043 17:72978876-72978898 TCAGCCCTGGGATACAAAGAAGG + Intronic
1151465874 17:74284941-74284963 CCAGCCCTGGGAGCCCCCGTGGG + Intronic
1151929399 17:77222090-77222112 CCATCGCTGGGAGACCAGGGTGG + Intergenic
1152114752 17:78378725-78378747 CCAGCCCTGGGCGGCCAGGCAGG - Exonic
1154073529 18:11177378-11177400 ACAGCCCTGGGAGGCCAAGGCGG - Intergenic
1154374754 18:13799623-13799645 GCAGCGTTGTGAGACCATGACGG - Intergenic
1156048033 18:32898771-32898793 CCAACCATGGGAGAAGATGAAGG - Intergenic
1157426538 18:47589036-47589058 CCAAACCTGGGAGACAAAGAGGG + Intergenic
1158599512 18:58845355-58845377 GAAGCCCTGGGAGAACATGGGGG - Intergenic
1160913689 19:1487060-1487082 GCGGCCCTGGGAAACCAGGAGGG + Exonic
1160955245 19:1688307-1688329 CCAGCCCTGTGGGACCAGAATGG + Intergenic
1161343215 19:3753914-3753936 CCCGCCCCAGGAGGCCATGATGG - Exonic
1161710351 19:5844134-5844156 CCTGCCCAAGGGGACCATGATGG - Exonic
1161714353 19:5866981-5867003 CCTGCCCAAGGGGACCATGATGG - Exonic
1161817413 19:6508178-6508200 CCAGCACTGGGAGGCCAAGGTGG - Intergenic
1162139782 19:8578790-8578812 CCGACCCTGGGAGACCCTGGGGG + Intergenic
1162297399 19:9822745-9822767 CCAACACTGGGAGACCAAGGTGG - Intronic
1163174968 19:15557967-15557989 CCAGCACTGGGAGGCCAAGGTGG - Intergenic
1163450216 19:17372813-17372835 CCAGCACTGGGAGGCCAAGGCGG + Intronic
1164501476 19:28823882-28823904 ACACCCCGGGGAGACCCTGAAGG + Intergenic
1165123973 19:33581096-33581118 GGAGCCCAGGGAGACCATGGTGG - Intergenic
1165248680 19:34513165-34513187 CCAGCCCTGGGAGGCCCAGAGGG - Intergenic
1165256231 19:34578539-34578561 CCAGCCCTGGGAGGCCCAGAGGG - Intergenic
1165258949 19:34597011-34597033 CAAGCCCTGGGAGGCCCAGAGGG - Intronic
1165266335 19:34665790-34665812 CCAGCCCTGGGAGGCCCAGAGGG + Intronic
1165978120 19:39694706-39694728 CCTGCTCTGGGAGCCCATGGAGG - Intergenic
1166324068 19:42038386-42038408 CCAGCTCTGGGCCACCCTGATGG + Intronic
1166665035 19:44674415-44674437 CCAGCACTGGGAGGCCAAGGTGG - Intronic
925593009 2:5528646-5528668 CCTGGCCTGAGAGACCATGCTGG + Intergenic
926826353 2:16909199-16909221 CCAGCCTTGGGAGACTTTTATGG - Intergenic
927707973 2:25308711-25308733 CCAGCCCTAAGTGACCATGTGGG + Intronic
930238596 2:48911835-48911857 CCAGCACTGGGAGGCCAAGGTGG + Intergenic
930782295 2:55234447-55234469 CCAGCGCTGGGAGGCCACGGTGG - Intronic
933317814 2:80736628-80736650 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
933899886 2:86841870-86841892 CCAGCCTGGGAAGACCAAGAGGG + Intronic
935780673 2:106507355-106507377 CCAGCCTGGGAAGACCAAGAGGG - Intergenic
936507382 2:113118190-113118212 GCATCCATGGGAGACCATGCAGG + Intronic
937248592 2:120509849-120509871 CCAGCCCTTGGAAACGATGCTGG + Intergenic
937321026 2:120960844-120960866 CCACCACTGGGAGACCAGGGAGG - Intronic
938116149 2:128604084-128604106 CCAGCCCAGCAGGACCATGATGG + Intergenic
938403838 2:131016186-131016208 CCAGGCCTGGGAGATCCTGGTGG - Intronic
938779244 2:134570003-134570025 CAAGCACTGAGATACCATGATGG - Intronic
940400649 2:153244561-153244583 CCAGCCAAGGGAAGCCATGAAGG + Intergenic
942058279 2:172205412-172205434 ACATCCCTGGGAGACCCTGCTGG - Intergenic
943094823 2:183416534-183416556 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
944267841 2:197748163-197748185 CCAGCCAAGGGAAGCCATGAGGG + Intronic
944399095 2:199304858-199304880 CCAGCCCTGGGAGAATGAGACGG - Intronic
945482267 2:210357916-210357938 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
946649117 2:221871965-221871987 CCAGCCAAGGGAAACCATGAGGG + Intergenic
948601047 2:239107680-239107702 GCAGCCCTGGGGGAGCATGGTGG + Intronic
948894330 2:240921320-240921342 GCACCCCTGGGAGCCCCTGAGGG + Intronic
1169196131 20:3682706-3682728 CCAGGCCTGGGAGACCCTTTCGG + Intergenic
1169762403 20:9110552-9110574 CCAGCCCTGGCAAAAGATGAAGG - Intronic
1170727407 20:18942082-18942104 CCAGCCAAGGGAAACCATGAGGG - Intergenic
1171477473 20:25423359-25423381 CCAGCTTTGGGAGACCAAGGTGG - Intronic
1173657501 20:44710492-44710514 CCAGGCCTGGAAGAACATGCAGG + Intergenic
1174406286 20:50305352-50305374 CCACCCCCGGGGGACGATGACGG + Intergenic
1175524771 20:59626005-59626027 CCAGCCCTGGTACCCCAAGATGG - Intronic
1175689892 20:61057628-61057650 CAAGCCCTGAGGGACCATGTTGG + Intergenic
1175691465 20:61068613-61068635 CCAGCCCTGGGAGACCCATGTGG - Intergenic
1178850151 21:36206281-36206303 CCAGCACTGAGAGGCCATGCAGG + Intronic
1179612949 21:42564274-42564296 CCAGCCTTGGGAGGCTAGGATGG + Intronic
1180391842 22:12291131-12291153 TGAGCCCTGGAAGGCCATGAAGG + Intergenic
1180407903 22:12573625-12573647 TGAGCCCTGGAAGGCCATGAAGG - Intergenic
1181510645 22:23387255-23387277 CAGGCCCTGGGAGGACATGAAGG + Intergenic
1182525139 22:30911387-30911409 CCAGCAGTTGGAGACCATCATGG + Intergenic
1182750111 22:32634723-32634745 CCAGCCTGGGGAAACCAAGAAGG - Intronic
1183182776 22:36272105-36272127 CCAGCCAAGGGAAACCATGAGGG - Intergenic
1183694891 22:39416015-39416037 CCATCCCTGGGCGTCCAGGAAGG + Intronic
1183829305 22:40409482-40409504 CCAGTCCTGGGAGAGGCTGAAGG - Exonic
1183864131 22:40690716-40690738 CCAGGCCTGGGAGGGCAGGATGG - Intergenic
1183985700 22:41569019-41569041 CCAGTGCTGGGAGGCCATGGAGG - Intronic
1184274240 22:43401131-43401153 CCTGCCCTGGGACTCCATGCTGG - Intergenic
1185008615 22:48300291-48300313 CCAGGCCTGGCACCCCATGAGGG - Intergenic
1185069486 22:48648243-48648265 CCAGCCCTGGGAGGCCTGGCAGG - Intronic
1185257921 22:49846738-49846760 CCAACACTGGGAGACCGAGATGG - Intergenic
1185266593 22:49907215-49907237 CCAGGCCTGGGAGGCTCTGAGGG - Intronic
950020007 3:9780392-9780414 CCAGGCCTGGAAGACTCTGAAGG - Exonic
950135425 3:10577477-10577499 GCAGCCCTGGGATCCCCTGATGG - Intronic
950184189 3:10934967-10934989 TCAGCCCTGCTAGGCCATGAGGG - Intronic
950467075 3:13161985-13162007 CCAGCCCTGGGGGAGGAGGATGG - Intergenic
950902386 3:16509922-16509944 TCAGCCCTGGGACACCTTGATGG + Intronic
951559661 3:23953087-23953109 CCAGCACTGGGAGGCCAAGGTGG + Intronic
953466768 3:43128644-43128666 CCAGGCCAGGGAGACCATAGGGG + Intergenic
954372596 3:50176593-50176615 CCTGCCCTGGGAGACCTGGCTGG + Intronic
954643833 3:52118571-52118593 GCAGCCCTGTGAGCCTATGATGG - Intronic
955454033 3:59100734-59100756 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
957256680 3:77845601-77845623 CTAGCCATGGGAAGCCATGAGGG - Intergenic
957303968 3:78431894-78431916 CTAGCCCTGGGGGAGAATGAGGG + Intergenic
957695668 3:83635713-83635735 CTAGCCAAGGGAAACCATGAGGG + Intergenic
961464087 3:127070989-127071011 CCAGGCCTGGGAGAACTTGAAGG + Intergenic
961678652 3:128583993-128584015 CCAGCCCTGTGGGATCATGGTGG + Intergenic
963032002 3:140987805-140987827 CTAGCCAAGGGAAACCATGAAGG + Intergenic
965622010 3:170651373-170651395 CCAGCCAAGGGAAGCCATGAGGG - Intronic
966251016 3:177865639-177865661 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
966533365 3:181004733-181004755 CTAGCCAAGGGAAACCATGAAGG - Intergenic
967189908 3:186976038-186976060 CGAGCCCGTGGAGACCCTGAGGG - Intronic
967257916 3:187612063-187612085 AGACCCCTGGGAGTCCATGAGGG - Intergenic
967715522 3:192757972-192757994 CCAGCCAAGGGAAGCCATGAGGG + Intronic
968830402 4:2930729-2930751 CCAGTCCAGGGAGACCCTGTGGG - Exonic
969277672 4:6147833-6147855 CCAGCCCTGTGAGGCCAGGGTGG - Intronic
969700845 4:8766754-8766776 CCTTCCCTGGGAGGCCATGAGGG - Intergenic
970214587 4:13745594-13745616 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
970679311 4:18489094-18489116 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
973886490 4:55327454-55327476 CCAGCACTGGGAGGCCAAGGTGG - Intergenic
975762628 4:77633842-77633864 TCAGGCCTGTGAGAGCATGATGG - Intergenic
976761397 4:88553108-88553130 CCAGACTTGGGAGGCCATAATGG + Intronic
979819443 4:125152060-125152082 CTAGCCAGGGGAAACCATGAGGG - Intergenic
980512413 4:133812033-133812055 CCAGCCAAGGGAGACAATGAGGG + Intergenic
981089614 4:140719277-140719299 GCAGCCCTGGGAGACTAGCAGGG - Intronic
981775561 4:148363162-148363184 GAAGCCCTGAGTGACCATGAGGG + Intronic
983485967 4:168331574-168331596 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
985194090 4:187408656-187408678 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
985575971 5:673665-673687 CCAGCCTTGGCTGACCATGAGGG - Intronic
985626790 5:993124-993146 CGAGTCCCGGGACACCATGAAGG + Intergenic
985938564 5:3115389-3115411 CCAGGCCTGGGAGTCCGAGACGG - Intergenic
986315402 5:6583337-6583359 CCAGCCCTGGAACCCCATGGGGG + Intergenic
987392197 5:17386902-17386924 CCAGCCTCTGGAGACCATGTGGG - Intergenic
988112674 5:26843278-26843300 CCAACACTGGGAGACCAAGGAGG + Intergenic
991068892 5:62455270-62455292 CCAGCACTGGGAGGCCGTGGTGG + Intronic
992997256 5:82345787-82345809 ACAGCCCTGGGACATCAGGAAGG - Intronic
993402624 5:87472544-87472566 CCAGCCAAGGGATGCCATGACGG + Intergenic
996233918 5:121104062-121104084 CCAGCCCAGGAAGAACATGTTGG + Intergenic
996597690 5:125224157-125224179 CCATTCCTGGCAGACCATGAAGG + Intergenic
996785993 5:127237245-127237267 CCAGCACTGGGAGGCCAAGGTGG + Intergenic
997406688 5:133654670-133654692 TCAGCCCTGGGAGTCCTTGAAGG - Intergenic
997830156 5:137142716-137142738 CCAGCCTTGGAAGACTCTGAAGG - Intronic
998402172 5:141853658-141853680 CCCGCCCTGGTCGGCCATGAGGG + Exonic
1000023987 5:157343088-157343110 CCAGCCCTGTAAGACCATCGCGG + Exonic
1000547998 5:162625626-162625648 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1000589984 5:163146638-163146660 CTAGCCCAGGGAAGCCATGAGGG + Intergenic
1000639687 5:163686667-163686689 CCAGCACTGGGAGGAAATGAAGG - Intergenic
1000820256 5:165973883-165973905 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1001282416 5:170396285-170396307 CCAGCCTGGGGAGACCCTCAGGG + Intronic
1001381816 5:171310590-171310612 CAAGGCGTGGGAGACCACGATGG - Intronic
1001400565 5:171444034-171444056 CCAGCCCTGGGTGGTCCTGAGGG + Intronic
1001961687 5:175883638-175883660 TCAGGCCTGGGAGACCAGGCTGG - Exonic
1004027929 6:11837104-11837126 CTAGCCAGGGGAAACCATGAGGG + Intergenic
1004304472 6:14487628-14487650 TCAGGCCTGGGAGAGCCTGAAGG + Intergenic
1006638114 6:35474683-35474705 CCACCCTTGGGGGAGCATGATGG - Exonic
1008554994 6:52665355-52665377 CCAACACTGGAAGACCAAGAGGG + Intergenic
1008860409 6:56142491-56142513 CCAGCTTTGGGGGACCATGGAGG - Intronic
1009973304 6:70647185-70647207 CCAGCCCTGGGAGAGAGTCAGGG + Intergenic
1012597187 6:101054374-101054396 CTAGCCAAGGGAGGCCATGAGGG - Intergenic
1014039625 6:116811033-116811055 ACTGCCCTGGGACACAATGATGG + Intronic
1014129155 6:117811207-117811229 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1014922366 6:127228402-127228424 CTAGCCAAGGGAAACCATGAGGG + Intergenic
1015304934 6:131697014-131697036 CCGGCACTGGGAGACCAAGGAGG - Intronic
1016829232 6:148417099-148417121 CCTGCCCTGGGAGAAGACGAGGG + Intronic
1018156099 6:160986639-160986661 CCAGCACTGGGAGGCCAAGGTGG - Intergenic
1018793541 6:167168915-167168937 CCATCCCTGGGAAACCCTGGGGG - Intronic
1018823174 6:167389463-167389485 CCATCCCTGGGAAACCCTGGGGG + Intergenic
1019070080 6:169338284-169338306 CCAGCCAGGAGAGACCAGGATGG - Intergenic
1019203734 6:170341705-170341727 CCAGCCAAGGGAAGCCATGAGGG - Intronic
1019449218 7:1088158-1088180 CCCGCCCTGGGAGCCCGCGAGGG - Intronic
1020128622 7:5546959-5546981 CAGGCCCAGGGACACCATGATGG - Intronic
1020179053 7:5907106-5907128 CCAGCACTGGGAGGCCAAGGTGG - Intronic
1020234852 7:6347804-6347826 CCAGCACTGGGAGGCCAAGATGG + Intronic
1022109850 7:27222031-27222053 CCAGGCCAGGGAGCCCAGGAAGG - Intergenic
1022895839 7:34749627-34749649 CAAGCCCTGGGGGCCCAAGAGGG + Intronic
1024209566 7:47192012-47192034 CCGGCCATGGGACACCATCATGG - Intergenic
1027790330 7:82633312-82633334 CCAGCCCAGGGAAGCCATTAGGG + Intergenic
1028998425 7:97127015-97127037 CCAGCCAAGGGAAGCCATGAGGG - Intronic
1029170613 7:98627100-98627122 CCTGCCCTGGGGGACCCTGAGGG + Intronic
1029365593 7:100114149-100114171 GCTGCCCTCGGAGTCCATGAAGG - Exonic
1030503368 7:110387591-110387613 CCAGCCCTGGAAGCCCAGAAGGG + Intergenic
1031768556 7:125812122-125812144 CCAGCACTGGGAGGCCAAGGTGG - Intergenic
1031976947 7:128100160-128100182 CCAGCACTGGGAGACCAAGGCGG + Intergenic
1034256546 7:149727837-149727859 CCAGCCCTTCCAGACCAGGAAGG - Intronic
1034783682 7:153905304-153905326 CCAGCCTCGGGAGAAAATGAGGG + Intronic
1035174052 7:157037889-157037911 GTAACCCTGGGAGACCATGCAGG + Intergenic
1035535679 8:389407-389429 CCAGCACTGTGAGAACAGGAAGG - Intergenic
1037025643 8:14033296-14033318 CCAGGCCTGGAAGACTGTGAAGG - Intergenic
1037367372 8:18137127-18137149 CCAGCACTGGGAGGCCAAGGCGG - Intergenic
1037548603 8:19948315-19948337 CCAGCCATGGATCACCATGAAGG - Exonic
1037814489 8:22104627-22104649 CCACCCCGGAGACACCATGAGGG + Exonic
1037836856 8:22219781-22219803 CCAGCCCCGGGGGGACATGAGGG + Exonic
1039027121 8:33270318-33270340 CCAGCCCTGGGAGACCATAGAGG + Intergenic
1040520161 8:48169610-48169632 CTAGCCAAGGGAAACCATGAGGG - Intergenic
1041154987 8:54976803-54976825 CTAGCCCAGGGAAGCCATGAGGG + Intergenic
1041419141 8:57647208-57647230 CTAGCCAAGGGAGGCCATGAGGG - Intergenic
1042729190 8:71912359-71912381 CCACTCCTGGGAGATTATGAAGG - Intronic
1045578217 8:103448926-103448948 CCAGACCTGGGAGACACTGAGGG - Intergenic
1046237496 8:111445787-111445809 TCAGCCCTGGGTGTCCATGGAGG + Intergenic
1049079297 8:140429335-140429357 CCAGCACTGGGAGGCCACGGTGG - Intronic
1049206100 8:141364272-141364294 TTAGCCCTGGAAGGCCATGAGGG - Intronic
1049297804 8:141852455-141852477 CGAGCCCTGGGAGGCCCCGAGGG + Intergenic
1049389040 8:142358786-142358808 CCATCGCTGGGAGACCACAAGGG + Intronic
1049607047 8:143534611-143534633 CCAGCTCTGGGAGGCCAGCAGGG - Intronic
1049658296 8:143808544-143808566 GCAGCCCTGGGTGCCCAGGAGGG + Intronic
1049664156 8:143835630-143835652 CCAGCCCCAGGGGACCATGCCGG - Exonic
1051145038 9:14018235-14018257 ACAGCCCTGGCAAACCAAGAGGG - Intergenic
1052052784 9:23866828-23866850 CTAGCCATGGGAAGCCATGAGGG - Intergenic
1057562230 9:96137757-96137779 CCAGCACTGGGTGACCGTGCTGG - Intergenic
1058265735 9:102897345-102897367 CCAGCCTAGGGAAGCCATGAGGG + Intergenic
1059412629 9:114142491-114142513 CCAGCCTGGGGAAACAATGAAGG - Intergenic
1059809936 9:117845037-117845059 ACAACCCTGGGAGACCTTTAAGG + Intergenic
1059933592 9:119285275-119285297 CCAGCCTTCTGAGACCACGATGG - Intronic
1060279664 9:122207272-122207294 CCCTCCCAGGGAGACTATGAAGG + Intronic
1061405259 9:130390281-130390303 CAAGCCCTGTGAGCCCCTGATGG - Intronic
1061789030 9:133048875-133048897 GCAGCCCTGGGAGAAAATGCAGG - Intronic
1061998214 9:134199673-134199695 CCAGCACTGGGAGGCCAAGGTGG + Intergenic
1062130895 9:134892505-134892527 CCAGACCTGGGAGAGGAGGATGG + Intergenic
1062217961 9:135399344-135399366 AGAGCCATGGGAGACCAGGAGGG + Intergenic
1185464019 X:344805-344827 CCAGCCCCGGGAGACGCAGACGG + Intronic
1186774923 X:12854973-12854995 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1187098061 X:16167639-16167661 TCAGCCCTGGGAGACCCAGCAGG + Exonic
1187530152 X:20089028-20089050 CTAGCACTGGGAGACCAAGGCGG - Intronic
1189214291 X:39310117-39310139 CCAGCCCTCAGGGACCAAGATGG - Intergenic
1189392945 X:40592403-40592425 CCAGCTTTGGGAGGCCAAGATGG + Intronic
1190963787 X:55278325-55278347 CCAGCCAAGGGAAGCCATGAGGG - Intronic
1190966478 X:55305922-55305944 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1190982007 X:55464391-55464413 CCAGCCCTGGCAGACTATAGAGG + Intergenic
1190986691 X:55508789-55508811 CCAGCCCTGGCAGACTATAGAGG - Intergenic
1191766963 X:64708521-64708543 CCAGCCTTGGGGGACAATCAAGG + Intergenic
1192759254 X:74078275-74078297 CCAGCCAAGGGAAACCATGAGGG - Intergenic
1193071826 X:77314601-77314623 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1193404418 X:81083853-81083875 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1195105643 X:101599717-101599739 GCAGCCCTGGGAGACCGAGAGGG - Intergenic
1195107239 X:101614050-101614072 GCAGCCCTGGGAGACCGAGAGGG + Intergenic
1195140036 X:101950087-101950109 CCAGCCAAGGGAAGCCATGAAGG + Intergenic
1195826163 X:109003583-109003605 CCAGCCAAGGGATGCCATGAGGG + Intergenic
1196869923 X:120102992-120103014 CCAGCACTGGGAGGCCAAGGTGG - Intergenic
1199745458 X:150769589-150769611 CTGGGCCTGGGAGACCAGGAGGG - Intronic
1200063081 X:153492173-153492195 CCAGCCCTGAGAGGCCAGAAGGG + Intronic
1201590570 Y:15610567-15610589 CCAGCAATGGGAAGCCATGAGGG + Intergenic