ID: 900098108

View in Genome Browser
Species Human (GRCh38)
Location 1:948576-948598
Sequence TCCTGTTGAAGTCGACCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 2, 2: 0, 3: 3, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900098108 Original CRISPR TCCTGTTGAAGTCGACCTGC TGG Exonic