ID: 900098362

View in Genome Browser
Species Human (GRCh38)
Location 1:949693-949715
Sequence CTGGAGCTGGGCAGCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 707
Summary {0: 1, 1: 0, 2: 12, 3: 72, 4: 622}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900098357_900098362 16 Left 900098357 1:949654-949676 CCAAGGAGATTGGACAAGGGAAA 0: 1
1: 0
2: 1
3: 22
4: 261
Right 900098362 1:949693-949715 CTGGAGCTGGGCAGCAGAGCTGG 0: 1
1: 0
2: 12
3: 72
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900098362 Original CRISPR CTGGAGCTGGGCAGCAGAGC TGG Intronic
900098362 1:949693-949715 CTGGAGCTGGGCAGCAGAGCTGG + Intronic
900184583 1:1327121-1327143 CTGGAAACGGGCAGCAAAGCTGG - Intronic
900372397 1:2337777-2337799 CTGGAGGTCGGCACCAGAGCTGG + Intronic
900631476 1:3638446-3638468 CTTGACCTTGGCGGCAGAGCTGG - Intronic
901145470 1:7061810-7061832 AGGGAGCTGGGAAGAAGAGCAGG + Intronic
901536344 1:9884845-9884867 AGGGAGTTGGGGAGCAGAGCTGG + Intronic
901914009 1:12483964-12483986 CTCCAGCTGGGCAACAGAGTGGG + Intronic
902036674 1:13463013-13463035 CTGAAGCTGGAAAGCTGAGCAGG - Intergenic
902622911 1:17660726-17660748 CTGGCGCTGGCCACAAGAGCTGG + Intronic
903220979 1:21869592-21869614 TTGGGGTTGGGCAGCAAAGCTGG + Intronic
903278135 1:22234247-22234269 AAAGAGCTGGGGAGCAGAGCGGG - Intergenic
904040573 1:27582099-27582121 ATGGAGCTGCGCTGGAGAGCAGG - Intronic
904181644 1:28669928-28669950 CTTGACCTAGACAGCAGAGCAGG + Intronic
904657858 1:32062742-32062764 CTGGGGCCTGGCAGCAGAGCTGG + Intergenic
904781527 1:32952996-32953018 CAGAAGCTGGGCAACAGAGTGGG - Intronic
905352685 1:37358534-37358556 CTGCCGCAGGGCACCAGAGCTGG - Intergenic
905812522 1:40923148-40923170 CTGGAGCTGGGGAGCTGAGCTGG + Intergenic
906157046 1:43619919-43619941 GTGGGGGTGGGCAGCAGAGTAGG + Intronic
906167942 1:43701516-43701538 GTGGTGCTGCGCAACAGAGCAGG - Intronic
907176823 1:52531925-52531947 CTCCAGCTTGGCAGCAGAGTGGG - Intronic
907500068 1:54872488-54872510 ATGCAGCAGGGCAGGAGAGCTGG + Intronic
907914751 1:58858457-58858479 CTGGGGGAAGGCAGCAGAGCAGG - Intergenic
908775395 1:67634527-67634549 CTGGAACTGGGCCCCAGGGCAGG + Intergenic
909278375 1:73718189-73718211 CAGAAACTGGGCAGCACAGCAGG + Intergenic
909592427 1:77365742-77365764 CTGGAACTGGGCTGCACAGCAGG - Intronic
910569660 1:88684875-88684897 CTGCAGCAGGGCTGCAGAGATGG - Intronic
911102845 1:94107618-94107640 CAGGAGCTGGGCACCAGGGTGGG - Intronic
911326398 1:96474168-96474190 CAGGAGCTGGGCACCAGGGAAGG + Intergenic
912273332 1:108231687-108231709 TAGGAACTGGGCCGCAGAGCAGG - Intronic
912294888 1:108462635-108462657 TAGGAACTGGGCCGCAGAGCAGG + Intronic
912385951 1:109271251-109271273 CTGCCGCTGGGCAGCACAGGAGG - Exonic
912777323 1:112513849-112513871 GTGGAGCTGGGCTGTTGAGCTGG + Intronic
914194686 1:145439653-145439675 CAGGAGCTGGTCAGCAGTCCAGG + Intergenic
914313901 1:146490305-146490327 CAGGAGCTGGTCAGCAGTGCAGG + Intergenic
914475960 1:148022218-148022240 CAGGAGCTGGTCAGCAGTCCAGG + Intergenic
914500448 1:148243075-148243097 CAGGAGCTGGTCAGCAGTGCAGG - Intergenic
915261687 1:154681418-154681440 CTGGAAGTGGCCAGCACAGCTGG - Intergenic
915321254 1:155057599-155057621 CGGGGGCCGGGCATCAGAGCAGG - Intronic
915963302 1:160284852-160284874 CTGGAGCTGGGGAGCTCACCTGG - Intronic
916653349 1:166850595-166850617 CAGGAACTGGGCTGCACAGCAGG + Exonic
918243896 1:182642626-182642648 CTTGAGCTGAGCAGCTCAGCTGG - Intergenic
918248866 1:182684356-182684378 CTGGCGGTGGGCAGCGCAGCTGG + Intronic
918942292 1:191016079-191016101 CTGGAGCTGGGCAGAAAGGAAGG + Intergenic
919477097 1:198042441-198042463 CCTGAGCTGGGCTGCTGAGCGGG - Intergenic
919746414 1:201011747-201011769 CTGGTGCTAGCCAGCAGAGCTGG - Intronic
919802348 1:201361458-201361480 CTGGAGGTGGGAAGGAGGGCTGG - Intronic
919804744 1:201374963-201374985 CAGGAGGTGGGCAGCAGGGGAGG - Intronic
919923583 1:202180470-202180492 CTGGAGATGGGGAGGAGAGCTGG + Intergenic
920296468 1:204960348-204960370 GTGGAGTTGGGCTACAGAGCTGG + Intronic
920557393 1:206914149-206914171 CTGGAGCTGGGAAGTAGATGGGG - Intronic
920943912 1:210510505-210510527 CTGGAGCAGGGCAGCCATGCTGG + Intronic
921641103 1:217555722-217555744 ATGGAGCTGATCAGCAGAGGAGG - Intronic
921712991 1:218391364-218391386 CTGGAGTTGAGCAGCACAGTGGG + Intronic
921715052 1:218409190-218409212 CAGGAGCCGGGCCGCACAGCAGG - Intronic
921992044 1:221377426-221377448 CTGGAGAAGGGTAGTAGAGCTGG - Intergenic
922602892 1:226870628-226870650 CTGGAGCGCGGCGGCAGAGCAGG + Exonic
922862933 1:228834804-228834826 CTGGAGCTGGGCAGACCAGAAGG + Intergenic
922936524 1:229426963-229426985 CTGGAGCTGGGGAGAGAAGCAGG + Intergenic
922960870 1:229644630-229644652 CTGTAGGTGGGCAGGAGAGTGGG + Intronic
924655176 1:245968220-245968242 ATGGAGCTGGTGAGCAGAGGGGG - Intronic
924693235 1:246372698-246372720 CTGCAGCTGGCCAGTAGAGATGG - Intronic
1062806498 10:424139-424161 CTGGAGCTGCTCACCTGAGCTGG - Intronic
1062978760 10:1704571-1704593 TAGGAGCTGGGCTGCACAGCAGG - Intronic
1063002678 10:1939530-1939552 CTGGGGTTGGGGAGGAGAGCAGG - Intergenic
1063114785 10:3066439-3066461 GTGGAGCTGGCCAGTGGAGCCGG + Intronic
1064084504 10:12335071-12335093 CTGGAGCAGGACAGCACAGCGGG + Intergenic
1064138204 10:12768449-12768471 CTGGGGCGGGGGAGGAGAGCTGG + Intronic
1065845162 10:29737123-29737145 CTGCCTCCGGGCAGCAGAGCCGG - Intergenic
1066179326 10:32944314-32944336 CTGGGCCTGGGCGGCAGAGAAGG + Intronic
1067011770 10:42720813-42720835 TTGAAGCTGGGCAGTATAGCAGG + Intergenic
1067462263 10:46466496-46466518 CTCCTGCTGGGCACCAGAGCTGG + Intergenic
1067624934 10:47918141-47918163 CTCCTGCTGGGCACCAGAGCTGG - Intergenic
1067773666 10:49145649-49145671 AAGGAGTTGGGCAGAAGAGCTGG - Intergenic
1067957346 10:50806831-50806853 CTTGAGCTGGGCTGCAGACACGG + Exonic
1067957600 10:50809693-50809715 ATCAAGCTGGGCAGCAGAGTGGG - Intronic
1068869214 10:61925720-61925742 CTGGAGATGGTCAGGGGAGCAGG + Intronic
1069054533 10:63831031-63831053 TGGGAGCTGGACAGCATAGCCGG - Intergenic
1069104775 10:64370052-64370074 TTGAAGCTGGGCAGCAGGGATGG - Intergenic
1069720201 10:70544898-70544920 CTGGTGCTGGGCACCCCAGCAGG - Intronic
1070079960 10:73176332-73176354 TAGGAACTGGGCTGCAGAGCAGG - Intronic
1070813343 10:79309334-79309356 CTTGAGCTGGGCTGCACAGCTGG + Intronic
1071563580 10:86660381-86660403 CTGGAGATGGGCAGCACCTCTGG - Intronic
1071976829 10:90964136-90964158 CCTGAGCTGGGCAGCAGGGTTGG - Intergenic
1072724216 10:97801626-97801648 CCGGAGCTAGCCAGCAGTGCAGG + Intergenic
1073243971 10:102076481-102076503 CTGAAGCTGGGCGACAGAGCTGG - Intergenic
1073480591 10:103784026-103784048 CTGCAGCTGGGCACCAGGGTGGG - Intronic
1074679800 10:115893698-115893720 CTGCGGCTGGGCAGCAGAGGTGG + Intronic
1074716769 10:116227024-116227046 TAGGAACTGGGCTGCAGAGCAGG - Intronic
1075311152 10:121414622-121414644 CTGGTGCTGAGCAGCTGAGCAGG - Intergenic
1075518511 10:123129247-123129269 CTGGAGATGGGGAACAGAGCTGG - Intergenic
1075788354 10:125065671-125065693 CTGGGGCTGGCCACAAGAGCTGG - Intronic
1076250216 10:128979180-128979202 CAGGAGCTGTACAGCACAGCTGG + Intergenic
1076507516 10:130987683-130987705 CTGGCCCTGGGCCTCAGAGCTGG - Intergenic
1077097306 11:804565-804587 CTGGGCCTGGGCTGCAGAGTGGG + Intronic
1077145686 11:1043262-1043284 CGGCCGCTGGGCAGCAGATCAGG - Intergenic
1077194774 11:1273856-1273878 CGGGGGTTGGGCAGCAGAGAGGG + Intergenic
1077286271 11:1767404-1767426 CAGGAGCTGGGAAGCTGAGCGGG - Intergenic
1077297968 11:1834873-1834895 CTGGGCCTGGGCAGCTAAGCTGG + Intronic
1077369750 11:2175966-2175988 CTGGTGCTGGGGAGCAGGCCTGG - Intergenic
1077377972 11:2214536-2214558 CTGGGGAGGAGCAGCAGAGCGGG - Intergenic
1077532490 11:3103753-3103775 CTGGAAGGGGGCTGCAGAGCTGG - Intronic
1077963152 11:7096873-7096895 CAGGAACTGGGCTGCACAGCAGG + Intergenic
1078144819 11:8715557-8715579 CTGGAGCCGGGCAGGTGGGCGGG - Intronic
1079518618 11:21298426-21298448 CTGGAGCTGAGCACCAAAGAAGG - Intronic
1079808969 11:24971409-24971431 TAGGAACTGGGCAGCACAGCAGG - Intronic
1080308150 11:30858923-30858945 CTGAAGGTAGGAAGCAGAGCAGG - Intronic
1081524603 11:43917685-43917707 ATGGAGCTGGGCTGCAGTGAGGG + Intronic
1081552535 11:44127332-44127354 TTGGAGCCGGGCTGCACAGCAGG + Intronic
1081695299 11:45105432-45105454 CTGAGGCTGCACAGCAGAGCTGG + Intronic
1082795728 11:57376622-57376644 GCGGCGCTGGGCGGCAGAGCGGG - Intergenic
1083035697 11:59635442-59635464 CAGGTAATGGGCAGCAGAGCAGG - Intergenic
1083490178 11:63009908-63009930 CTGGATCTGAGCAGAAGAGGAGG + Intronic
1083651578 11:64207599-64207621 CGGGAGCTGAGCAGCAGGGATGG - Intronic
1083814030 11:65121980-65122002 CTGGAGCAGGGCCACGGAGCAGG + Intronic
1083962145 11:66020528-66020550 GTGGTGCTGGGCAGCAGAGCAGG + Intronic
1083987778 11:66227985-66228007 CTGGAGCTGCCCAGGAGTGCAGG + Intronic
1084014234 11:66369270-66369292 CTGGGGCTGGGCAGTAGGGCTGG + Intronic
1084155685 11:67311373-67311395 AAGGAGCGGGGCAGCAGGGCTGG + Intronic
1084617029 11:70243281-70243303 CTGGGGGTCTGCAGCAGAGCAGG + Intergenic
1084952497 11:72674357-72674379 GAGCAGCGGGGCAGCAGAGCTGG - Exonic
1084974607 11:72789957-72789979 CTGGAGGAGGGGAGCAAAGCAGG - Intronic
1085388222 11:76169208-76169230 CTGGGGCTGGGCTGGAGAGGGGG + Intergenic
1085805259 11:79629997-79630019 CTTGAGCTGGGCAGCATGGAAGG + Intergenic
1086155959 11:83666325-83666347 CAGGAACTGGGCCGCACAGCAGG + Intronic
1087557949 11:99746480-99746502 TAGGAACTGGGCAGCACAGCAGG + Intronic
1088485018 11:110332350-110332372 TGGGAACTGGGCAGCACAGCAGG - Intergenic
1088547243 11:110971974-110971996 CTCCAGCTGGGCATCACAGCTGG + Intergenic
1088917965 11:114241369-114241391 GAGGAGCTGGGCTGCACAGCAGG + Intronic
1089248171 11:117137596-117137618 CTGGAACTGGGAAGCACAGCTGG - Intergenic
1089258541 11:117206965-117206987 CTGGAACTGGGAAGCACAGCTGG + Intronic
1089307950 11:117538497-117538519 CAGGAGCTGGGTTGGAGAGCAGG + Intronic
1089318308 11:117607101-117607123 CTGGGGGAGGGCAGCAGGGCAGG + Intronic
1089396606 11:118140282-118140304 CTGGGGCTGGGGAGCAGGGGAGG - Intronic
1089499280 11:118923075-118923097 CTGGAGGAGGGCTGCAGAGCTGG + Intronic
1089571688 11:119415559-119415581 CTGGAGGTGCCCAGCAGTGCAGG - Intergenic
1089661973 11:119991773-119991795 CTGGACCTGGGCAGGGCAGCAGG - Intergenic
1090441642 11:126729614-126729636 CTGGAGCACGGAAGCAGTGCTGG + Intronic
1090771307 11:129921862-129921884 GTGGAGCTGGCCAGCAGGGCTGG - Intronic
1091004840 11:131943373-131943395 GTGCTGCAGGGCAGCAGAGCCGG - Intronic
1091261197 11:134235582-134235604 CTGCAGCTGTGTGGCAGAGCCGG - Intronic
1091321869 11:134657524-134657546 CTGGAGATGGGCAGCAGAGGTGG - Intergenic
1091386468 12:99164-99186 CGGCGGCTGGGCAGCAGAACTGG - Exonic
1091588262 12:1828152-1828174 CTGGCGCCGGGCAGCAGCCCTGG + Exonic
1092099494 12:5871464-5871486 CAGGAACTGGGCTGCATAGCAGG + Intronic
1092160425 12:6312557-6312579 CAGCAGCTGGGCAGGAGAGGCGG + Intronic
1092256267 12:6928136-6928158 GGGGAGGTGGGGAGCAGAGCGGG + Intronic
1092745996 12:11673096-11673118 CTGGAGCTGGGTAACTGTGCAGG + Intronic
1092879570 12:12877550-12877572 GTGGAACTGGGGAGGAGAGCAGG + Intergenic
1094368314 12:29707438-29707460 CTGGAGCTGAAGAGCAGAGGCGG - Intronic
1094447287 12:30545812-30545834 CTGGAGCTGGGCAGACTTGCTGG - Intergenic
1095941399 12:47729444-47729466 TAGGAGCTGGACAGCTGAGCAGG - Intergenic
1095944224 12:47745031-47745053 CTGGAGCTGGGGAGAATGGCTGG - Intronic
1095957895 12:47817158-47817180 CTGGGGGTGGGCAACACAGCAGG - Intronic
1096479655 12:51930218-51930240 CTCCAGCTGGGCAACACAGCAGG + Intergenic
1096492537 12:52020665-52020687 CTTGGGCTGGGCAGCAGAAGGGG - Intergenic
1096650943 12:53061722-53061744 ATGGAGCTTGGCAGCAGAGGAGG + Intronic
1096972929 12:55681977-55681999 CTGGAGCTGGGCTGCGGAACCGG + Exonic
1097279451 12:57835584-57835606 CTGCATCTGGGCAGAAGAGGAGG - Intronic
1097938659 12:65279427-65279449 CAGCAGCGGGGCAGCAGCGCAGG - Intronic
1100329647 12:93571550-93571572 CTGGAGGTGGGAAGGAGAGAGGG - Intronic
1101125694 12:101631654-101631676 ATGGACCTGGCCAGCAAAGCCGG + Exonic
1101242510 12:102852197-102852219 CTGGAGGTGGACAGCAGTGAGGG + Intronic
1101375538 12:104168169-104168191 CAGGAGCCGAGCAGCACAGCAGG + Intergenic
1102060244 12:109926175-109926197 CTGCAGCAGGGAAGCACAGCTGG + Intronic
1102339178 12:112108481-112108503 CAGCAGCTGGTCGGCAGAGCTGG - Intronic
1102988563 12:117298401-117298423 TAGGAGCTGGGCTGCACAGCAGG - Intronic
1103322332 12:120099388-120099410 CAGCCCCTGGGCAGCAGAGCAGG + Intronic
1103464263 12:121129153-121129175 CTGGAACTGGGCAGGGGATCTGG + Intergenic
1103516111 12:121509527-121509549 CTGGGGCTGGGCGGCCGAGGAGG - Intronic
1103606292 12:122088184-122088206 CTGGAGAGGGACAGCAGAGGGGG - Intronic
1103749604 12:123150320-123150342 CTGGAGGCGGGAAGCAGAGAAGG + Intergenic
1104346186 12:128001245-128001267 CTGGGGCAGCTCAGCAGAGCAGG + Intergenic
1104424815 12:128667435-128667457 CTGGAGCTGGGCTGCAATCCAGG - Intronic
1105069607 12:133226687-133226709 CAGGAGCTGGGCTGGAGAGGAGG - Intronic
1105806300 13:23953499-23953521 GTGGTGGTGGGCAGCAGAGGTGG - Intergenic
1105996626 13:25678586-25678608 CAGGAGCTGTGTTGCAGAGCTGG - Intronic
1106571852 13:30934654-30934676 CTGCAGCAGGGAAGCACAGCTGG + Intronic
1107789767 13:43990031-43990053 ATGGAGCCGGGTAGCAGAGATGG - Intergenic
1109928696 13:69183776-69183798 CAGGAACTGGGCCGCACAGCAGG - Intergenic
1110517280 13:76429171-76429193 GTGGAACTGGGGAGGAGAGCAGG + Intergenic
1110625663 13:77652978-77653000 CTGGAAAGGGGAAGCAGAGCTGG - Intergenic
1110786235 13:79530398-79530420 CTGGAGCTGGGCACAGCAGCTGG - Intronic
1112104216 13:96223224-96223246 TTGGAGCAGGGAAGCAGAGTGGG + Intronic
1112298721 13:98211226-98211248 CAGGAACTGGGCCGCACAGCAGG + Intronic
1112402592 13:99088304-99088326 GTGGAGCTGGGTGACAGAGCAGG + Intergenic
1113463217 13:110496108-110496130 CGGGAGCTGGGCAGCACACCTGG + Intronic
1113494926 13:110719441-110719463 CAGGAGCTGGGCGACACAGCGGG + Exonic
1113568881 13:111339335-111339357 AGGGAGCTGGGGAGCACAGCAGG + Intronic
1113740572 13:112710036-112710058 CTGGAGCTGGGCATCAGCCATGG + Intronic
1113778669 13:112963350-112963372 CTGGGGCCTGGCATCAGAGCGGG + Intronic
1115308571 14:31957048-31957070 CTGGAACTGGGCTGCACAGCAGG + Intergenic
1116003450 14:39267641-39267663 CGGGAGCCGGGCAGCAGACGAGG - Intronic
1117493605 14:56277180-56277202 TTGGAACTGGGCCGCACAGCAGG + Intronic
1117510720 14:56448426-56448448 CTGGAGCTGGGCAGACTTGCTGG - Intergenic
1119508999 14:75196592-75196614 TGGGAGGTGGGCAGCAGAGGGGG - Intergenic
1119725391 14:76919126-76919148 CTGGAACTGGCCAGCACAGGCGG + Intergenic
1119726506 14:76924809-76924831 CGGGGGGTGGGCAGCAGAGAGGG - Intergenic
1119890573 14:78179207-78179229 CTGTATCTAGGCAGCAGACCTGG - Intergenic
1121527341 14:94628343-94628365 CAGGAGCTGGGCAGGTGGGCAGG - Intergenic
1121827881 14:97025858-97025880 TTGCACCTGGGCAGCCGAGCGGG - Intergenic
1122065973 14:99174797-99174819 CCGGGGCTGGGCAGCGGCGCGGG + Exonic
1122259078 14:100501926-100501948 CTGGAGCTGTGCAGCAGACAAGG + Intronic
1122743606 14:103885629-103885651 CTGGAGCAGGCCAGCAGAGGCGG - Intergenic
1122770353 14:104095047-104095069 CTGGACCTGGGCGGCCGGGCAGG - Intronic
1123059385 14:105587591-105587613 CTCGGGGTGGGCAGCAGTGCAGG + Intergenic
1123216307 14:106812684-106812706 GCAGAGCAGGGCAGCAGAGCTGG + Intergenic
1123996891 15:25725037-25725059 TAGGAACTGGGCAGCACAGCTGG + Intronic
1124250639 15:28104653-28104675 CTGCAGCTGGGCAGGTGGGCAGG - Intergenic
1124379119 15:29149779-29149801 CTCAAGCCCGGCAGCAGAGCCGG + Intronic
1125318174 15:38454414-38454436 GTGGAGCAGGGCCGGAGAGCTGG + Intronic
1125452767 15:39826249-39826271 CTGGAGCAGGGCAGCAGATGAGG + Intronic
1125884021 15:43215025-43215047 CTGGAGCTGGGGTGCAGCTCTGG - Intronic
1126029822 15:44485623-44485645 TAGGAACTGGGCCGCAGAGCAGG - Intronic
1127165229 15:56238863-56238885 CTCCAGCTGGGCGACAGAGCAGG - Intronic
1127331375 15:57943390-57943412 CTGGAGCTGGACATGAGTGCGGG - Intergenic
1128219603 15:65958900-65958922 CCAGAGCTGGGCTCCAGAGCAGG - Intronic
1128249022 15:66152007-66152029 CTGGAGCTGGGCAGGTGGGAGGG - Intronic
1129229909 15:74191335-74191357 CTGGCACTGGGCAGCATGGCAGG - Intronic
1129293469 15:74586151-74586173 GTGGAGCTGGGCCACACAGCAGG + Intronic
1129960018 15:79675698-79675720 CTGAAGTTGGGCAGGAGAGAAGG - Intergenic
1131019971 15:89089132-89089154 CTAGAGCTGTCCAGCAGCGCAGG + Intronic
1131888652 15:96948028-96948050 CGAGAGCCGGGCAGCAGCGCGGG - Intergenic
1132033355 15:98457520-98457542 TAGGAGCTGGGCTGCACAGCAGG - Intronic
1132348571 15:101123038-101123060 CTGGGGCTGGGCAGCTGGGAAGG + Intergenic
1132389839 15:101430294-101430316 CTGGAGATGGGTAGCAGCGATGG - Intronic
1132647689 16:1006711-1006733 CTGGAGCTGCGCAGGGGACCTGG + Intergenic
1132657464 16:1047223-1047245 CCAGAGCTGGGCAGGAGAGATGG + Intergenic
1132797990 16:1734637-1734659 CTGTTGCTGGGCAGTTGAGCTGG + Intronic
1133022788 16:2974198-2974220 CCGGGGCTGGGGAGCAGGGCAGG + Intronic
1133415320 16:5602079-5602101 CTGTAGCAGGGCTGCTGAGCTGG + Intergenic
1133601337 16:7343002-7343024 CTGGAGCTGGGTTGCAGGACGGG + Intronic
1134668744 16:16038863-16038885 CTGGAGCTTGTCAGGAGAGCAGG + Intronic
1134787266 16:16955910-16955932 TAGGAGCTGGGCTGCACAGCAGG + Intergenic
1135196532 16:20399439-20399461 CTGCAGCTTGGCAGCAGCCCTGG + Intronic
1135613942 16:23893351-23893373 ATGGTGCTTGGCAGCACAGCTGG - Intronic
1135642543 16:24133576-24133598 GTGCAGCTGGGCAGTAGAGTTGG - Intronic
1136120667 16:28131406-28131428 CAGGGGCTGCGCACCAGAGCCGG + Intronic
1136184665 16:28580097-28580119 CAGGATATTGGCAGCAGAGCAGG + Intronic
1136400121 16:30012271-30012293 CTGGAGCTGAGGGGCAGTGCGGG - Intronic
1136544461 16:30947770-30947792 CTGGAGGTGGGGATGAGAGCAGG + Exonic
1137062008 16:35799276-35799298 CTAGAGCTGGAGAGCTGAGCAGG - Intergenic
1137448788 16:48551307-48551329 GTGGACCTGTCCAGCAGAGCAGG + Intronic
1137517841 16:49164059-49164081 TTGGAACTGTGCAACAGAGCAGG + Intergenic
1137567886 16:49544889-49544911 CTGGTGATGTGCAGCAGAACAGG + Intronic
1137571263 16:49567802-49567824 CAGGAGCTGGCCATCAGAGAGGG - Intronic
1137582280 16:49640747-49640769 CTTGAGCTGGGCTGGGGAGCTGG - Intronic
1138498844 16:57425985-57426007 TTGGACCTGGGAGGCAGAGCTGG - Intergenic
1138556156 16:57772345-57772367 CTGGTGCTGGGCAGGAGGCCTGG - Intronic
1139190224 16:64854835-64854857 CAGGAGCCAGGAAGCAGAGCTGG + Intergenic
1139444894 16:66991557-66991579 CTGCCTCTGGGTAGCAGAGCTGG + Intronic
1139758665 16:69166354-69166376 CTGGGTGTGGGAAGCAGAGCTGG + Intronic
1139941477 16:70608835-70608857 GGGAAGCTGGGAAGCAGAGCTGG + Intronic
1139964321 16:70737166-70737188 CCGGAGGTGGGCGGAAGAGCAGG - Intronic
1140196363 16:72858865-72858887 CTGAAGCTGAGCAGGAGACCCGG - Intronic
1140374195 16:74431665-74431687 CTGGAGCACAGCAGCAGAGTGGG - Intergenic
1141424087 16:83934392-83934414 CTGGGGCTGGGAGGAAGAGCAGG - Intronic
1141429081 16:83961687-83961709 GTGGGGGTGAGCAGCAGAGCTGG + Intronic
1141609767 16:85174771-85174793 CAGGAGCTGGGAATGAGAGCTGG + Intronic
1141784922 16:86193188-86193210 CGGAGGCTGGGCAGCACAGCTGG - Intergenic
1142192378 16:88723797-88723819 CTGGACCAGGGCAGCATAGAGGG - Intronic
1142455346 16:90218062-90218084 CTCGTGATGGCCAGCAGAGCCGG - Intergenic
1142851570 17:2707240-2707262 CTGGGGCTGAGCTGGAGAGCTGG - Intronic
1143243470 17:5463735-5463757 CTGGGGCTCGGCACCAGGGCTGG + Intronic
1143269943 17:5668042-5668064 CTGGAGCTGGGCACCCTAGTAGG + Intergenic
1143328720 17:6118800-6118822 TTGGTGGTGAGCAGCAGAGCTGG + Intronic
1143496592 17:7315996-7316018 CTGGAGCTTGGCAGCCGCGCAGG - Exonic
1144223395 17:13120605-13120627 CTGGAGTTTGGCAGCTCAGCTGG + Intergenic
1144672871 17:17142774-17142796 CTGGGGCTGGGCAGCACCTCAGG + Intronic
1144724783 17:17496430-17496452 CCGGGGCGGGGCAGCCGAGCAGG - Intergenic
1144858217 17:18282653-18282675 CAGGTGCTGGGGAGCAGAGGTGG + Intronic
1145019400 17:19417713-19417735 GGGGAGCTGGGGAGCAGGGCTGG - Intergenic
1145057803 17:19714686-19714708 CTGGAGCTGGGCAGGAAGCCAGG - Intronic
1145079625 17:19883970-19883992 CTGGAGCTGGCCAACAGTGCTGG - Intergenic
1145397367 17:22506449-22506471 CTGCAGGTGGGAAACAGAGCCGG - Intergenic
1145934235 17:28705637-28705659 ATTGAGCTGAGCAGCAGAGGTGG - Intronic
1146256456 17:31393700-31393722 ATGGAGCTGGGAAGGAGAGAAGG - Intronic
1146400180 17:32495417-32495439 CTGGAGCTGGGCCGCTTGGCTGG + Intronic
1146576339 17:33995163-33995185 CTGGAGCTGTGAAGCATGGCAGG + Intronic
1146775144 17:35607616-35607638 CTGGAGTTAAGCAGCAGAGAAGG - Intronic
1146891126 17:36507098-36507120 CTGGAGCTGGGCTGCGCTGCTGG + Exonic
1146953259 17:36921092-36921114 AGGGAGGTGGGCAGCAGGGCTGG - Intergenic
1147000397 17:37358663-37358685 CTGGAGCTGGGCAAGAGGGGTGG + Intronic
1147050046 17:37787371-37787393 CAGGACCTGGGGAGCAGACCGGG + Intergenic
1147357959 17:39912297-39912319 TTGGAGTTGGGCAGCAGGGAAGG - Intronic
1147401053 17:40180173-40180195 CTGAAGCTGGGGGTCAGAGCTGG + Intronic
1147557434 17:41488459-41488481 CTGCAGCTGGACAGTAGGGCAGG - Intronic
1147614774 17:41821536-41821558 CTGGGGCTGGGCTGGAGAGTGGG - Intronic
1147887862 17:43696766-43696788 CTGGAGCAGGGTGGCAAAGCTGG + Intergenic
1147961035 17:44167737-44167759 CTGGATGTGGGCTCCAGAGCAGG - Intergenic
1148022490 17:44562636-44562658 CTGGGGGAGGGCAGAAGAGCAGG - Intergenic
1148369039 17:47080895-47080917 ATGGAGATGGGCTGCAGACCGGG - Intergenic
1148455224 17:47807821-47807843 CTGGAGATGGGCAGAAGGGGAGG + Exonic
1148561093 17:48606615-48606637 CTGGATCTGGGCTGCAGCCCAGG - Intergenic
1149492618 17:57096092-57096114 ATGGATTTGGCCAGCAGAGCAGG + Intronic
1149995069 17:61402002-61402024 CTGCAGCTGAGCAGGAGAGCAGG + Intronic
1150007395 17:61478393-61478415 CTGGAGCTGGGCATTAGTGCTGG + Intronic
1150435444 17:65150656-65150678 CTAGAGCTGGGCAGGAGAGAAGG - Intronic
1151542147 17:74770068-74770090 CAAGAGCTAGGCTGCAGAGCCGG + Intergenic
1151703972 17:75757208-75757230 CCGCAGCTGGGCAGCCGTGCCGG + Exonic
1151733284 17:75923390-75923412 CTGGAGGGGGGCAGCCCAGCTGG + Exonic
1151809745 17:76431692-76431714 CAGGAGCTGGGAAGCCCAGCGGG + Intronic
1151978606 17:77496445-77496467 CTGGAGGTGGGGAGCCGGGCAGG - Intronic
1152200603 17:78943692-78943714 CTGGTGCTGGGCATCTGAGTGGG + Intergenic
1152508811 17:80771565-80771587 CTGGGGCTGGGAAGGAGAGGGGG - Intronic
1152575536 17:81139218-81139240 CTGGAGCAGGGCAGTGGAGCTGG - Intronic
1152739797 17:82013845-82013867 CTGGCCCTGGGCATCAGGGCTGG + Intronic
1152798129 17:82317837-82317859 CTGGAAGTGAGCGGCAGAGCTGG + Intergenic
1152927440 17:83093787-83093809 TTGGAGGTGGGGTGCAGAGCCGG - Intronic
1153810293 18:8746677-8746699 CAGGAGATGGGGAGCAGTGCAGG - Intronic
1155997321 18:32343891-32343913 CAGGTGTGGGGCAGCAGAGCTGG - Intronic
1156444447 18:37224819-37224841 CAGGAGTTGGGCAGCAGGGTGGG - Exonic
1156781234 18:40853166-40853188 CTGAATCTGGGCAGCACTGCTGG + Intergenic
1157392885 18:47317570-47317592 CTGGGGATGGGAAGGAGAGCTGG - Intergenic
1157521060 18:48345758-48345780 CAGGAACTGGGCAGCAGGGCTGG - Intronic
1157800468 18:50616289-50616311 CAGAAGCTAGGCAGCAGAGCTGG - Intronic
1158133868 18:54184222-54184244 TGGGAGCTGGGCGGCACAGCAGG + Intronic
1158591940 18:58785261-58785283 CTGCAGCAGGGGAGCAAAGCCGG - Intergenic
1158699766 18:59735430-59735452 TTGGAGCTGGGCAGGAGTTCAGG + Intergenic
1160608154 18:80067463-80067485 CTGGAGCTGGCAAGCATGGCAGG + Intronic
1162037453 19:7949421-7949443 TAGGAACTGGGCCGCAGAGCAGG - Intergenic
1162392920 19:10400314-10400336 CTGTCTCTGGGCAGGAGAGCCGG + Intronic
1162533221 19:11247693-11247715 CTGGATCCCAGCAGCAGAGCAGG + Intronic
1162937970 19:13991167-13991189 CAGGAGCTGGGCAGGAGAAGGGG + Intronic
1163132672 19:15285429-15285451 CTGGAGCTGGGCAGAGTAGCTGG - Intronic
1163237326 19:16037327-16037349 CTGGAGCTGGGCGGGTGGGCCGG + Intergenic
1163290607 19:16376967-16376989 GTGGACCTGGGCAGCTGGGCCGG + Intronic
1163389905 19:17024414-17024436 CTGGAGCTGGACAGGACACCTGG - Intronic
1163602538 19:18257688-18257710 GTGGAGCTGGGCAGCCGGGCCGG - Exonic
1163636279 19:18438436-18438458 GTGGAGCTGGGCAGGGAAGCTGG + Intergenic
1163816890 19:19471869-19471891 CTGGAGCTGGCAGGCAGAGGAGG + Intronic
1163856324 19:19705033-19705055 TGGCTGCTGGGCAGCAGAGCAGG + Intergenic
1164708043 19:30334994-30335016 TAGGAACTGGGCCGCAGAGCAGG - Intronic
1165139594 19:33690711-33690733 CAGCAGGTGCGCAGCAGAGCCGG + Intronic
1165762470 19:38329737-38329759 CTGGAGAGGTGGAGCAGAGCGGG + Intergenic
1166292456 19:41871833-41871855 CTGGGCCTGGGCTGCAGAGGTGG + Exonic
1166541323 19:43607829-43607851 CTGTAGCAGGGCAGCAGAGCCGG + Exonic
1166555257 19:43695241-43695263 CTGAAGCTAGGCAGCAAAGTGGG - Intergenic
1166658145 19:44627255-44627277 CTGGACTAGGGCAGGAGAGCAGG + Intronic
1166943375 19:46382249-46382271 CTGGTGCGAGGCAGCAGGGCGGG - Intronic
1167048486 19:47065436-47065458 CCGGGGCTGGGCTGCAGTGCAGG + Exonic
1167272932 19:48516648-48516670 CTGGGGGTGGGGAGCTGAGCAGG + Intergenic
1167597705 19:50436095-50436117 CTGGAGCTGGGCAGCAAGAGTGG + Exonic
1168266642 19:55227226-55227248 GAGGAGCTGGGCAGCATAGTAGG + Exonic
925007129 2:452334-452356 CAGGAACTGGGCTGCAGAGCAGG - Intergenic
925114884 2:1370056-1370078 CTGGAGCTGGCCAGGAGCCCAGG + Intergenic
925327527 2:3035174-3035196 CAGGAGCTGAGCAGAAGTGCTGG - Intergenic
925822729 2:7816224-7816246 CTGGGGCTGGAAAGAAGAGCAGG + Intergenic
926914973 2:17882487-17882509 CTGGAGCTAGAGAGCAGAACAGG + Intronic
927174968 2:20399459-20399481 CTGGAGGTGGGAGGCAGAGTGGG + Intergenic
928074776 2:28254215-28254237 TTGAACCTGGGCAGCAGGGCTGG - Intronic
928220423 2:29398664-29398686 ATGGAGCTGGGCAGGAGAGCAGG + Intronic
929775602 2:44929146-44929168 CAGGGGCTGGGCAGCCGCGCAGG + Intergenic
929818746 2:45257101-45257123 ATGGAGCAGGGCAGCTGGGCTGG + Intergenic
931046758 2:58362667-58362689 CTGGAGCTGGGAGGCAGCACAGG - Intergenic
931401792 2:61938068-61938090 CATGAGCTGGGCAGGAGAGAGGG + Intronic
932355435 2:71064626-71064648 GTGGAGGTGGGGGGCAGAGCTGG - Intronic
932755722 2:74407931-74407953 CTTGAGCTTGGCAGAGGAGCCGG - Intergenic
932813265 2:74841894-74841916 CTTGAGCTGGGGAGCAGAGGAGG + Intronic
933412213 2:81940612-81940634 TTGGAACTAGGCAGCAGAGGAGG - Intergenic
935602614 2:104938519-104938541 CTGTAGCTGAGCAGCGGTGCAGG - Intergenic
936253395 2:110886796-110886818 CTGGAGCTGAACAGCAGTTCTGG - Intronic
938043458 2:128095547-128095569 CTGCATCTGGGCAACAGAGCGGG - Intronic
938128287 2:128690234-128690256 CCGGAGCTGGGGGGCAGAGAGGG + Intergenic
938383161 2:130847936-130847958 TTGGAGCTGGGCCGCTGGGCTGG + Intronic
938407129 2:131038916-131038938 CAGGAGCTGGGCTTCAAAGCTGG + Exonic
939542132 2:143507457-143507479 CTGAAGATGGGGAGAAGAGCAGG - Intronic
941309920 2:163914457-163914479 CTGGAGAAGGGCACCCGAGCAGG - Intergenic
942717185 2:178906671-178906693 CAGGAGCTGACCAGTAGAGCAGG + Intronic
943081819 2:183265381-183265403 CTCCAGCTTGGCAACAGAGCGGG + Intergenic
943294352 2:186117818-186117840 TAGGAACTGGGCAGCACAGCAGG - Intergenic
944011880 2:194983376-194983398 CAGGGGCTGGGCAGCTGTGCTGG - Intergenic
945884182 2:215357305-215357327 CTGAAGCTACCCAGCAGAGCAGG - Intergenic
945955342 2:216081605-216081627 CTGGAGCTGGGTACGTGAGCGGG - Exonic
945989289 2:216380272-216380294 CTGGGGGTGGGTAGCAGGGCCGG - Intergenic
946084212 2:217154840-217154862 CAAGTGCTGGGCAGCAGTGCTGG - Intergenic
947543850 2:230996642-230996664 CTGGAGCTGTGCTGTAGAGTGGG + Intronic
947770417 2:232666052-232666074 CTGGAGGTCTGCAGCAGAACTGG + Intronic
947794761 2:232887333-232887355 CTAGAGGTTTGCAGCAGAGCAGG - Intronic
948152439 2:235755013-235755035 CTTGACCTGGGCAGCTGAGCCGG + Intronic
948265648 2:236633465-236633487 CTGGAGCTGGGATGGAGAACAGG + Intergenic
948364840 2:237448249-237448271 CTGGAGCTGGGGTGCAGGGGAGG - Intergenic
948449513 2:238060653-238060675 CTGGACCTGAGGAGCAGAGGCGG - Intronic
948603756 2:239121897-239121919 CTGGGGCTGCACTGCAGAGCTGG + Intronic
948754376 2:240150531-240150553 TAGGAGCTGGGCAACAGACCTGG - Intergenic
948834768 2:240620612-240620634 CAGGAGCTGGGCACCACCGCAGG - Intronic
948908821 2:240992884-240992906 CTTCTGCTGGGCTGCAGAGCGGG - Intronic
948935036 2:241158387-241158409 CTGGAAGTGGGCAGCAGTGGGGG - Intronic
1168964108 20:1888700-1888722 CTGGTGCTGGGCACCTGAGAAGG + Intergenic
1170251472 20:14288482-14288504 CTGGGGCTGGCCAGCAGAGGAGG - Intronic
1170533205 20:17315168-17315190 TTTGTGCTGGGCATCAGAGCGGG - Intronic
1170626942 20:18037285-18037307 GTGGAGCTGGGAACCAGAACTGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172117948 20:32583254-32583276 CGGGAGCCGGGGAGCAGATCCGG - Intronic
1172239079 20:33400173-33400195 CAGGAGGTGAGCAGCAAAGCTGG - Intronic
1172622000 20:36323915-36323937 TAGGAACTGGGCTGCAGAGCAGG - Intronic
1172742701 20:37181498-37181520 CTTGATCTGGGAAGCAGAGTGGG - Intronic
1173060070 20:39652150-39652172 CTGGACCTGGGCCCCAGAGCTGG + Intergenic
1173201767 20:40959982-40960004 GTGGAGCTGGGCTGCTGACCAGG - Intergenic
1173248557 20:41352509-41352531 CAGGAGGTGAGCAGCAGAGTGGG + Intronic
1173304553 20:41835815-41835837 CTGAAGCTGGGCAGCAACACAGG + Intergenic
1174042429 20:47709355-47709377 CTGCCCCTGGGCAGCAGGGCTGG + Intronic
1174292946 20:49521824-49521846 CTGGAGCTGTGCAGCATGGAAGG + Intronic
1174558491 20:51413124-51413146 CCGGTGCTGGGCAGCACTGCTGG + Intronic
1174679006 20:52386347-52386369 TGGGAACTGGGCTGCAGAGCAGG + Intergenic
1175404491 20:58717543-58717565 CTGGAGGTGATGAGCAGAGCAGG + Intronic
1175484387 20:59334807-59334829 CTGCAGCTGGGCAGCAGCTGTGG + Intergenic
1175649096 20:60701726-60701748 CTGGAGCTGGGAATCAGAGCTGG + Intergenic
1175801827 20:61805378-61805400 ATGGAGGTGGGCAGCATGGCTGG + Intronic
1175893443 20:62325386-62325408 CTGGAGGTGGCCAGCCCAGCAGG - Exonic
1175987104 20:62769657-62769679 CTGCAGCTGGGCAAAAGGGCAGG + Intergenic
1176458017 21:6929541-6929563 CTGGGGCTGGGCAGCCAAGCCGG - Intergenic
1176836189 21:13794625-13794647 CTGGGGCTGGGCAGCCAAGCCGG - Intergenic
1177243347 21:18490187-18490209 TAGGAACTGGGCTGCAGAGCAGG - Intergenic
1178373067 21:32044024-32044046 GTGGAGCAGTGCAGCGGAGCAGG + Intronic
1179630917 21:42678247-42678269 TAGGAGCTGGGCAGAAGGGCTGG - Intronic
1179772940 21:43637389-43637411 CTGGGGCTGTGCAAGAGAGCAGG + Intronic
1179820452 21:43934170-43934192 CTGGTGCTCGGCAGGGGAGCTGG - Intronic
1179902305 21:44400517-44400539 ATGGGGGTGGGAAGCAGAGCAGG + Intronic
1179996897 21:44978271-44978293 CTGGGGCTGGGCAGCCAAGCTGG - Intergenic
1180162750 21:46005658-46005680 CTGGAGGAGGGCAGCAGGGATGG + Intergenic
1180612284 22:17105769-17105791 CTGGGGCTGGGGAGCAGGGCTGG + Intronic
1180705784 22:17808965-17808987 CTGAAGCAGGGCTGGAGAGCCGG - Intronic
1180728320 22:17962434-17962456 TTAGAGCCGGGCAGGAGAGCTGG + Intronic
1180855175 22:19040974-19040996 CTGCAGCTGGGCAAGAGTGCTGG + Intronic
1180961341 22:19763707-19763729 CTGGAGCTGGGCCGGAAAGGTGG + Intronic
1181050889 22:20237726-20237748 CAGGGGCTGGGCTGCAGGGCAGG + Intergenic
1181333523 22:22112972-22112994 CTGGAGCTGGTCAGTGGAGCTGG - Intergenic
1181480622 22:23196868-23196890 TAGGAACTGGGCCGCAGAGCTGG - Intronic
1181510778 22:23387912-23387934 CTGGAGCCGGGCTGCAGCGCAGG - Intergenic
1181589911 22:23877643-23877665 GTGTAGGTGGGCAGGAGAGCAGG + Intronic
1182363510 22:29762383-29762405 CAGGAGCTGGGCCGCACAGCAGG + Intronic
1182443355 22:30376708-30376730 CTGGGGCTGGTGTGCAGAGCTGG - Exonic
1182475280 22:30573735-30573757 CTGGCTCTGGGCAGCTGGGCGGG + Intronic
1182934248 22:34206286-34206308 CAGGAGCTTGGGACCAGAGCTGG - Intergenic
1182942063 22:34286374-34286396 CTGGAGCTGCCCAGGAGAGATGG - Intergenic
1183102461 22:35592414-35592436 GAGCAGTTGGGCAGCAGAGCTGG - Intergenic
1183291411 22:37003965-37003987 ATGGAGCTGGGCCACGGAGCAGG - Exonic
1183380905 22:37490075-37490097 CTGGAGCAGGGCACCAAAACTGG - Intergenic
1183429121 22:37755215-37755237 CTGGTGGTGGGCAGCATGGCTGG + Intronic
1183603117 22:38851399-38851421 CTGCAGGGGGGCAGCAGGGCTGG + Intergenic
1183666856 22:39250981-39251003 ATGGAGCTGGGAAGCAGAGACGG + Intergenic
1183697919 22:39433662-39433684 CAGGAGCGGAGCTGCAGAGCAGG + Intronic
1184130891 22:42515757-42515779 CTGCAGGTGGCCAGCAGAGACGG + Intronic
1184141067 22:42577587-42577609 CTGCAGGTGGCCAGCAGAGACGG + Intergenic
1184214513 22:43057835-43057857 CCGGAGCTGGGAAGTAGAACAGG - Intronic
1184259572 22:43306918-43306940 TTGGAGCTGGGTAGAAGCGCTGG - Intronic
1184328703 22:43812051-43812073 CTGGGGGTGGGCAGCAGCGCCGG + Intronic
1184409946 22:44320673-44320695 CTGGAGCTGGGCCAAAGAGGGGG - Intergenic
1184532857 22:45067554-45067576 CTGGAGCTAGGCAGCCCATCAGG - Intergenic
1184634329 22:45814684-45814706 CTGGTACTGGGCAGCACAGCTGG + Intronic
1185148351 22:49151146-49151168 CTGGAGCTGGGAACTGGAGCTGG - Intergenic
1185344140 22:50304099-50304121 CAGGATCTGGGCTGCAGAGGCGG + Intronic
949765596 3:7522480-7522502 CTGGAGGTGGGGAGGAGGGCAGG - Intronic
949917070 3:8973389-8973411 ATGGAGAAGGGAAGCAGAGCTGG + Intergenic
950093293 3:10312552-10312574 GCTGAGCTTGGCAGCAGAGCGGG - Intronic
950415249 3:12865633-12865655 CTGAGGCTGCCCAGCAGAGCAGG + Intronic
950583691 3:13879000-13879022 CTGGAACTGGGCAGCAGAGGCGG - Intronic
950615143 3:14152268-14152290 CTGTAGCTGAGCGGGAGAGCTGG - Intronic
950728373 3:14934655-14934677 CTAGAGCTGTTGAGCAGAGCAGG + Intergenic
952162978 3:30714280-30714302 TAGGAACTGGGCAGCACAGCAGG + Intergenic
952764118 3:36940417-36940439 GTGAACCTGGGAAGCAGAGCTGG + Intronic
953233444 3:41085023-41085045 CTGGAGCTCCTCAGCACAGCAGG - Intergenic
954036634 3:47854423-47854445 CTGGCACTGGGGAGCAGAGATGG + Intronic
954390993 3:50267824-50267846 CAGGAGCTGGGCAGGAGTGTGGG + Intronic
954452082 3:50577127-50577149 CTGGAGGTGGGCTGCGGATCAGG + Exonic
954731392 3:52665530-52665552 TTGGAACTGGGCCGCACAGCAGG + Intronic
955408884 3:58643099-58643121 TGGGAGCTGGGATGCAGAGCTGG - Intronic
956213826 3:66827899-66827921 CTGGAACTGGGCTGCCCAGCAGG - Intergenic
957482044 3:80810839-80810861 TAGGAACTGGGCAGCACAGCAGG + Intergenic
959142594 3:102504628-102504650 CTCAAGCTGGGCAGAAGAGTAGG + Intergenic
960086116 3:113593278-113593300 TAGGAGCTGGGCTGCACAGCAGG + Intronic
961281100 3:125766471-125766493 GCGGAGCTGGGCATCAGGGCGGG - Intergenic
961349773 3:126292386-126292408 CAGGAGCTGGGCAGGCGAGATGG - Intergenic
961391575 3:126555438-126555460 ATGGAACTGGGCCGCACAGCAGG + Intronic
961450807 3:127001485-127001507 CTGGGGCTGGGCTTCACAGCGGG + Intronic
961508694 3:127388259-127388281 GTGGAGCTGGGGAGCAGGGATGG - Intergenic
961532400 3:127547583-127547605 CCGGGGCTGGGCAGCAGGGCAGG + Intergenic
961780075 3:129316039-129316061 CTGGGGCCGGGCGGCAGGGCTGG + Exonic
961789685 3:129366589-129366611 CTGAAGCCAGGCAGCACAGCTGG - Intergenic
961825837 3:129598590-129598612 CTGGGGCTGGGCAGCTCTGCAGG + Intronic
962134844 3:132722492-132722514 ATGGAGCGGGGCCGGAGAGCAGG + Intergenic
963042445 3:141079619-141079641 CGGAAGCTGGGCAGCAGTGGTGG + Intronic
963066189 3:141266326-141266348 CAGGAGCCGGGCAGCTGAGTCGG + Intronic
963732951 3:148990517-148990539 CTGGGGATGGGGAGCAGAGAAGG + Intergenic
963752546 3:149197865-149197887 CAGGAACTGGGCTGCACAGCAGG - Intronic
963798700 3:149657005-149657027 CTGCAGCTGGGCACCGGCGCGGG - Exonic
964494308 3:157271750-157271772 ATGGAGCTGGGCAGGAGAGATGG + Intronic
968768156 4:2485638-2485660 CTGGGGATGGTCAGGAGAGCCGG - Intronic
968840668 4:3003001-3003023 CTGGAGATGGGCTGCAGAACAGG - Intronic
968878743 4:3287982-3288004 CTGACGCTGGGAAGCAGGGCAGG - Intergenic
968966704 4:3772519-3772541 CTAGAGCTGAGGAGCAGAGGAGG + Intergenic
969094686 4:4723465-4723487 CAGGAGCTGGGCTGCAGAGCAGG - Intergenic
969277882 4:6149124-6149146 CTGGGGCTGGACAGCTGGGCAGG + Intronic
969310295 4:6349044-6349066 CTGCTGCTGGGCAGCAGGGAAGG - Intronic
969385783 4:6846353-6846375 TAGGAGCTGGGCTGCACAGCAGG + Intronic
969704110 4:8782770-8782792 ATGGAGGTGGGCAGAAGAGATGG + Intergenic
969704691 4:8785355-8785377 CAGGAGCTGGGGAGGAGAGCTGG + Intergenic
969870006 4:10098711-10098733 CTGCAGGTGGGCATGAGAGCTGG + Intronic
969893894 4:10285042-10285064 CGGGAGGTGGACAGCAAAGCAGG - Intergenic
970008882 4:11436871-11436893 CAGGACCTGGGCAGAACAGCAGG - Intergenic
970133410 4:12895717-12895739 CGAGAGCTGGGCAGAAGACCTGG - Intergenic
971310971 4:25525504-25525526 CTGGAGCTGAGGAGGAGAGAGGG - Intergenic
971448472 4:26778022-26778044 CTCAACCTGGGCAACAGAGCAGG + Intergenic
971643419 4:29164949-29164971 CTGGACCTGAGTAGCATAGCAGG - Intergenic
972049643 4:34713070-34713092 TAGGAACTGGGCAGCACAGCAGG - Intergenic
972075134 4:35078687-35078709 CTGCAGCTGGGAGGCACAGCTGG + Intergenic
973701779 4:53544623-53544645 ATGGTACTGGGCAGCAGTGCTGG - Intronic
973773387 4:54226115-54226137 GTGGAGCTGGGGGGCAGAGGAGG + Intronic
974260364 4:59518303-59518325 GAGAAGCTGGGCAGCAGGGCAGG + Intergenic
975169039 4:71212417-71212439 CTGGAGCTGGGCAGAAGGTGGGG + Intronic
976342371 4:83959470-83959492 CAGGAACTGGGCCGCACAGCAGG - Intergenic
976705500 4:88015209-88015231 TAGGAACTGGGCCGCAGAGCAGG + Intronic
976811068 4:89101817-89101839 CAGGAACTGGGCCGCACAGCAGG + Intronic
977229414 4:94434110-94434132 CTGGAGCCAGGCCGCAGAGCAGG + Intergenic
978419441 4:108514526-108514548 TAGGAACTGGGCAGCACAGCAGG - Intergenic
978751952 4:112259744-112259766 CTGGAGTGGGGCAGGAGAGATGG + Intronic
980628851 4:135408421-135408443 GTGGAGCTGGAGAGCTGAGCAGG - Intergenic
980992620 4:139751069-139751091 CTGGATCTGGCCTGCAGAGTAGG + Intronic
981582243 4:146261361-146261383 TTGGAGAGAGGCAGCAGAGCAGG - Intronic
985731351 5:1550781-1550803 CTGGGGCTGAGGAGCACAGCTGG + Intergenic
986130955 5:4929457-4929479 CTGGAGCTGTGCATCAGAGAGGG - Intergenic
986180666 5:5390402-5390424 CTGGAGAGGGGCTCCAGAGCTGG + Intergenic
986429865 5:7670854-7670876 TAGGAACTGGGCCGCAGAGCAGG - Intronic
987348522 5:16999944-16999966 CTGGAGCTGGGTGACAGAGCAGG + Intergenic
987689483 5:21248412-21248434 CGGGAACGGGGCAGCACAGCAGG + Intergenic
987707471 5:21474135-21474157 CTGGAGAGGGGCTCCAGAGCTGG - Intergenic
987982968 5:25112143-25112165 CTGAACCTGGGAGGCAGAGCTGG + Intergenic
988907312 5:35802738-35802760 CTAGGGCTAGCCAGCAGAGCTGG + Intronic
989309476 5:39997840-39997862 CTCCAGCTAGGCAGCAGAGTAGG + Intergenic
990748596 5:58986456-58986478 CAGGAACTGGGCTGCACAGCAGG + Intronic
992042367 5:72848539-72848561 CGGGGGCTGGGCCGCAGCGCGGG - Intronic
992407392 5:76472490-76472512 CTGGATTTGGGCAGCAGAGGAGG + Intronic
992529679 5:77642322-77642344 CTGGAACTGGACGGCAAAGCAGG - Intergenic
993057742 5:83001842-83001864 GTAAAGCTGGGCAGCAGCGCTGG + Intergenic
993307240 5:86288394-86288416 TAGGAACTGGGCCGCAGAGCAGG + Intergenic
993833380 5:92787200-92787222 TAGGAACTGGGCAGCATAGCAGG - Intergenic
994067093 5:95555334-95555356 CCGGAGCAGGGGAGCAGAGGCGG + Exonic
994851079 5:105056681-105056703 CTGCAGCTGGGTGGCACAGCTGG + Intergenic
995492904 5:112711114-112711136 TAGGAACTGGGCAGCATAGCAGG + Intronic
995750787 5:115451570-115451592 CTCTAGCTGTGCAGCTGAGCAGG + Intergenic
996378067 5:122836244-122836266 CTGGGGCTGAGCATCAGAGGTGG + Intergenic
996393440 5:122988222-122988244 CTGGGGCTGGGCAGAAGCTCAGG - Intronic
996802085 5:127415443-127415465 GTGGAGATGGGCAGCACAGTTGG + Intronic
997228751 5:132228151-132228173 CAGGGGCTGGGCAGGAGGGCGGG - Intronic
998079007 5:139259334-139259356 CTGGGGCTGGGCAGCTCTGCAGG + Intronic
998082724 5:139290475-139290497 CTCCAGCTAGGCAACAGAGCAGG - Intronic
998151170 5:139758395-139758417 CTGGAGGTGGGGAGAAGGGCAGG + Intergenic
998940933 5:147280989-147281011 CTGGAGCTGGGTAGGCTAGCTGG + Intronic
999322545 5:150624564-150624586 CTGGAGATGGGAGGCTGAGCGGG + Intronic
999383906 5:151140901-151140923 CTGGAGCTGGAGAGCAGAGCGGG - Intronic
999432511 5:151536482-151536504 GTGGAGATGGGCAGCACAGAAGG - Intronic
1000058688 5:157633142-157633164 CTTGAACAGGGGAGCAGAGCAGG + Intronic
1000393005 5:160744927-160744949 GAGGAGCTGAGCAGCAGGGCAGG + Intronic
1000524893 5:162345547-162345569 CTGGGCCTGGGCAACAGAGCGGG - Intergenic
1000993880 5:167939399-167939421 CAGGAACTGGGCAGCATAGTAGG - Intronic
1001492514 5:172165496-172165518 CTGGGGCTGGGGAGCAGTGGGGG + Intronic
1001494037 5:172175431-172175453 CTGGGTCTTGTCAGCAGAGCAGG - Intronic
1001534614 5:172489866-172489888 CTGGAGCGGGCCAGCTCAGCTGG + Intergenic
1001936517 5:175709546-175709568 AGGGACCTGGGGAGCAGAGCAGG - Intergenic
1001974003 5:175981878-175981900 CTCCAGCTGGGCAACAGAGTGGG + Intronic
1002132460 5:177089916-177089938 CCTAAGCTGGGCTGCAGAGCTGG + Intronic
1002171815 5:177378909-177378931 CCGGACCTGGACACCAGAGCCGG + Intergenic
1002243429 5:177861901-177861923 CTCCAGCTGGGCAACAGAGTGGG - Intergenic
1002292508 5:178209525-178209547 CTGGTGCTGTGCAGCAGGGGTGG + Intronic
1002399651 5:178984551-178984573 CTGAGGCTGGGGAGGAGAGCTGG + Intronic
1002650648 5:180690644-180690666 TTGGAACTGGGCTGCACAGCAGG + Intergenic
1002914568 6:1518679-1518701 CTGGAGCTGGGAATCAGACCTGG + Intergenic
1003310262 6:4964198-4964220 CTGGAGCTGGCGCTCAGAGCTGG + Intergenic
1003411341 6:5865522-5865544 CTGGAGCTTAGCAGCAAGGCTGG + Intergenic
1003415981 6:5908363-5908385 CTGGGGCTGGGCATAACAGCAGG - Intergenic
1004160877 6:13211817-13211839 GTGGGGATGGGCTGCAGAGCAGG - Intronic
1004597547 6:17114756-17114778 TAGGAACTGGGCTGCAGAGCGGG - Intronic
1006297434 6:33176160-33176182 CGGGAGCTGGACGGCAGTGCGGG + Intronic
1006419697 6:33925404-33925426 CTGGAGCTGGGCCTGGGAGCCGG - Intergenic
1007048775 6:38804488-38804510 CAGCAGCTGGGGAGAAGAGCAGG - Intronic
1007725823 6:43915041-43915063 CAGGAGCAGGGCAGGCGAGCGGG + Intergenic
1009020754 6:57946377-57946399 CTGGAGAGGGGCTCCAGAGCTGG + Intergenic
1011128729 6:84033683-84033705 CCGGAGCAGGGCTGCAGCGCGGG - Intergenic
1013160915 6:107543813-107543835 CTGGTGCTGGGTAGAAGAGGTGG - Intronic
1014147198 6:118011711-118011733 TTGGAATTGGGCAGCACAGCAGG - Intronic
1016441109 6:144084534-144084556 TAGGAACTGGGCAGCACAGCAGG + Intergenic
1016651750 6:146469842-146469864 ATGGACCAGGGAAGCAGAGCAGG + Intergenic
1017119416 6:151009612-151009634 CTGGCGGTGGGAAGCAGAGGAGG + Intronic
1017394955 6:153987971-153987993 TTTGAGCTTGGAAGCAGAGCAGG - Intergenic
1017949735 6:159126660-159126682 CTGGAGCTGGGCAGGTGTGGAGG + Intergenic
1017966441 6:159271026-159271048 CTGGAGCTGGGGACCAGCTCAGG - Intronic
1018050070 6:160001114-160001136 TAGGAGCTGGGCTGCACAGCAGG + Intronic
1018190378 6:161304997-161305019 CTGCCTCTGGGCTGCAGAGCAGG + Intergenic
1018798394 6:167204501-167204523 CTGCAGATGGGCAACAGATCTGG + Intergenic
1018814320 6:167319675-167319697 CTGCAGATGGGCAACAGATCTGG - Intergenic
1018963601 6:168466402-168466424 CTGGAGCAGGGCACGAGAGCAGG - Intronic
1019154967 6:170032571-170032593 CTGGAGAGAGGCAACAGAGCAGG + Intergenic
1019432693 7:1006845-1006867 TGGGAGCTGTGCAGCAGGGCTGG - Intronic
1019641427 7:2105828-2105850 CTGGAGCTGGGGAGCGGGGTGGG - Intronic
1019917015 7:4140154-4140176 GTGGAGCGGGGCGGCAGAGAAGG - Intronic
1020014763 7:4824480-4824502 CCCCAGCTGGGCAGCCGAGCAGG + Intronic
1021652620 7:22846558-22846580 CAGGAACCGGGCAGCACAGCAGG - Intergenic
1022446686 7:30476820-30476842 CCTGAGCGGGGCAGCAGGGCAGG + Intronic
1022798405 7:33751623-33751645 GTGGAGCTGGGCGGGATAGCAGG + Intergenic
1023118456 7:36885491-36885513 CTCTAGCTGGGCAGCAGCGGAGG + Intronic
1023729134 7:43173711-43173733 TTGGAACTGGGCTGCACAGCGGG - Intronic
1023861208 7:44218568-44218590 CTGCTGCTGGCCAGCAGAGAAGG + Exonic
1024269518 7:47631975-47631997 CTGGCTCGGGGCAGCTGAGCAGG + Intergenic
1024983652 7:55178060-55178082 CTGGGAATGGGGAGCAGAGCGGG - Intronic
1025738701 7:64178346-64178368 CTGAAACTGCCCAGCAGAGCTGG + Intronic
1026205452 7:68253857-68253879 CTGGAGCTGGGCTGGAGTGAGGG + Intergenic
1026465065 7:70646789-70646811 CTGGCTCAGGGCAGCAGGGCTGG + Intronic
1026486941 7:70829982-70830004 CTGGCTCTTGGCAGCACAGCTGG - Intergenic
1026840385 7:73667635-73667657 CCGGTGCTGGGGCGCAGAGCAGG + Intergenic
1029110537 7:98211333-98211355 CGGGCGCTGGGCAGCAGTGGCGG - Intergenic
1029711470 7:102302342-102302364 CTGGAGTCTGGCAGCTGAGCTGG - Intronic
1029715773 7:102324625-102324647 CCAGGGCAGGGCAGCAGAGCAGG + Intergenic
1030479305 7:110082283-110082305 TAGGAACTGGGCAGCACAGCAGG - Intergenic
1031135800 7:117882773-117882795 TAGGAACTGGGCAGCACAGCAGG - Intergenic
1031253822 7:119421736-119421758 TTGGTGCTGAGCTGCAGAGCTGG + Intergenic
1032108540 7:129055238-129055260 CAGGAGCCGGGAAGAAGAGCCGG + Intergenic
1032293554 7:130613325-130613347 CAGGAACTGGGCTGCACAGCAGG - Intronic
1032669975 7:134073825-134073847 CTGAAGCAGGTCAGGAGAGCGGG + Intergenic
1033588699 7:142792884-142792906 TTGGAGCTGGGCAGTAGGGAGGG + Intergenic
1033740736 7:144273932-144273954 ATGGGGCTGGGCAGAGGAGCTGG - Intergenic
1033753170 7:144375681-144375703 ATGGGGCTGGGCAGAGGAGCTGG + Intronic
1034455778 7:151168877-151168899 CTGGAGCTGGGGAGCCAATCAGG - Intronic
1034562532 7:151890478-151890500 GAGGCTCTGGGCAGCAGAGCAGG + Intergenic
1035049844 7:155992376-155992398 CTGGAGCTGGGGAGAAGGGTGGG + Intergenic
1035747269 8:1971343-1971365 CTGGAACAGGGCAGCAGAGCTGG + Intergenic
1035791716 8:2312185-2312207 GAGGAACTGGGCTGCAGAGCAGG - Intergenic
1035801089 8:2409520-2409542 GAGGAACTGGGCTGCAGAGCAGG + Intergenic
1036221754 8:6926862-6926884 CTGGAGCAGAGCTGCAGGGCTGG - Intergenic
1037330073 8:17735606-17735628 CAGGAGCTTGCCAGCAGAGGAGG - Intronic
1038033000 8:23661343-23661365 CTGCCGCTGGGCTGCACAGCAGG - Intergenic
1038244006 8:25837317-25837339 ACTGAGCTGGGCCGCAGAGCTGG + Intergenic
1038398862 8:27267833-27267855 GTGAAGCTGAGCAGCTGAGCTGG + Intergenic
1038729780 8:30116576-30116598 TAGGAACTGGGCAGCAGAGCAGG - Intronic
1039617725 8:38969670-38969692 CGGGAGCTGGGCAGCACCCCAGG - Exonic
1040060631 8:43100296-43100318 AGGGAAGTGGGCAGCAGAGCGGG + Intronic
1040598887 8:48865234-48865256 CTCAGGCAGGGCAGCAGAGCTGG - Intergenic
1041830225 8:62144793-62144815 CTGGAGCTGCTCAGCAGACGTGG + Intergenic
1045023525 8:98064553-98064575 AGGGAGCCGGGCTGCAGAGCTGG + Exonic
1045743125 8:105385929-105385951 ATGGAGGTGGGCTGCAGAACTGG - Intronic
1046543273 8:115614186-115614208 CTTGAGATGGTTAGCAGAGCAGG + Intronic
1046871241 8:119208173-119208195 CTGGCGCTGGCCAGCGGAGCAGG + Intronic
1048553231 8:135453406-135453428 CTGGGGCTGGGCAGCTGAGCAGG + Intergenic
1049202320 8:141346375-141346397 CTGGGGCTGGGCAGCTGTGTAGG - Intergenic
1049252966 8:141598982-141599004 CAGGGGCTGGGCGGGAGAGCAGG - Intergenic
1049317423 8:141976787-141976809 CTGGAGCTGGGGAGAGGACCAGG + Intergenic
1049492431 8:142912484-142912506 CGGGACCTGGGCAGCAGAGGCGG - Intronic
1049605831 8:143528804-143528826 CTGGACCTGGGCAGAAGGGAGGG - Intronic
1049655218 8:143794197-143794219 CTGGAGCTTTGCAGGAGAGATGG + Intronic
1050377075 9:4984839-4984861 CTGGAGCTAGGCGCCAGCGCTGG - Intergenic
1051199148 9:14597783-14597805 CTGGTGGTGGTGAGCAGAGCAGG - Intergenic
1053139431 9:35673602-35673624 CTGGAGCTGGGAAGCAGGCCAGG + Intronic
1053200893 9:36150976-36150998 CTGGCCCTGGGCAGCAATGCAGG + Intronic
1053362183 9:37496232-37496254 CTGGGGCTGGGAACTAGAGCTGG + Intronic
1053414850 9:37940860-37940882 CGGAAGATGGGCAGGAGAGCTGG + Intronic
1053455986 9:38233478-38233500 TTAGAGTTGGGCAGCAGAGATGG - Intergenic
1054766231 9:69044764-69044786 CCCCAGCTGGTCAGCAGAGCTGG + Intronic
1055314657 9:75022302-75022324 TTGAAGCTGGGAGGCAGAGCTGG - Intronic
1056718535 9:89053934-89053956 CTGATGCTGGACAGCAGGGCCGG - Intronic
1056720271 9:89065199-89065221 CTGAAGCTGGGCAGGAGGACAGG + Intronic
1057344654 9:94238752-94238774 CAGCAGCTGGGAAGGAGAGCTGG - Intergenic
1057604245 9:96487929-96487951 CTGGCCCTGGGCTGCAGAGCTGG - Intronic
1057723089 9:97548490-97548512 GTGGGGATGGGCAGCAGACCTGG + Intronic
1057746927 9:97759863-97759885 CAGGGGCTGGGAAGCAGAGATGG + Intergenic
1057920781 9:99094958-99094980 CAGGATCTGGGCAGCAGTGGTGG - Intergenic
1058552644 9:106132036-106132058 CAGCTGATGGGCAGCAGAGCAGG + Intergenic
1058738337 9:107917657-107917679 CTGGACCTAGGCACCAGCGCAGG + Intergenic
1058942035 9:109822327-109822349 CAGGAGCTGGGAAGGAGAGAAGG - Intronic
1059151728 9:111955274-111955296 TAGGAGCTGGGCAGCACAGGAGG - Intergenic
1059320132 9:113463012-113463034 CTGGTGCGGGGAGGCAGAGCTGG - Intronic
1059764065 9:117366697-117366719 CTGGAGCAGGGCGGCACAGTGGG - Intronic
1060422988 9:123482860-123482882 CTGGAACAGGACAGCAGAGGGGG + Intronic
1060589960 9:124810430-124810452 CCGGAGAGGGGCAGCAGTGCGGG + Exonic
1060760632 9:126245292-126245314 CTGGAACATGGCAGCAGGGCAGG + Intergenic
1060804116 9:126564133-126564155 CTGGAGCCGGATAGCAGAGGAGG + Intergenic
1061058946 9:128240849-128240871 CTGGTGCAGGGCTGCAGAGAGGG + Intronic
1061945325 9:133905531-133905553 CTGGAGCTGGGGAGAAGGGATGG - Intronic
1062264767 9:135681908-135681930 CTGGATCTAGTCTGCAGAGCTGG - Intergenic
1062339281 9:136086757-136086779 CTGGAGCTGGCCAGCTGCACTGG + Intronic
1062577277 9:137214605-137214627 CTGGACATGGGCAGCCGAGTTGG - Exonic
1062614866 9:137391665-137391687 CTGCAGCTGGGCACCAGGGCCGG - Intronic
1062699641 9:137892191-137892213 CTGGAGCAAAGCAGCACAGCCGG + Intronic
1187131711 X:16509418-16509440 CTGGAACTGGGCCCCACAGCAGG - Intergenic
1188293401 X:28416459-28416481 GTGAACCTGGGAAGCAGAGCTGG + Intergenic
1188334606 X:28915233-28915255 TAGGAACTGGGCTGCAGAGCAGG - Intronic
1188363714 X:29288304-29288326 CTGGGGCTGGGCAGGTGGGCTGG - Intronic
1189483886 X:41414276-41414298 TAGGAGCTGGGCAGCATAGGAGG + Intergenic
1189889442 X:45583918-45583940 CTTGAGGTGGGCAGGAGTGCAGG + Intergenic
1190115995 X:47626704-47626726 CAGGAGCTGGGCAGCAGAGAAGG + Intronic
1191714606 X:64185659-64185681 CTGGAGCAGGGCAGGGGAGGGGG + Exonic
1192179873 X:68909785-68909807 CAGGAGCTGGGGAGGAGAGGGGG - Intergenic
1192198108 X:69045885-69045907 CTGAGGCTGGGGAGCAGACCAGG + Intergenic
1192321936 X:70096939-70096961 CTGAAGCTGGGCAGAAGTGGAGG + Intergenic
1192322132 X:70098533-70098555 CTAGAGCTGGGCAGAAGTGGAGG + Intergenic
1192548665 X:72035872-72035894 TTGGAACCGGGCAGCACAGCAGG + Intergenic
1192630017 X:72769965-72769987 CTGGACCTGGACAGCATAGAGGG - Intergenic
1192651693 X:72950839-72950861 CTGGACCTGGACAGCATAGAGGG + Intergenic
1194359816 X:92935957-92935979 CTGTAGTTGGGCATTAGAGCAGG + Intergenic
1195922375 X:109996383-109996405 TAGGAACTGGGCAGCACAGCAGG - Intergenic
1196032712 X:111108439-111108461 TAGGAACTGGGCAGCACAGCAGG + Intronic
1198174385 X:134141164-134141186 GTGGAGATGGGGAGCAGAGTTGG + Intergenic
1198894052 X:141431019-141431041 CTGGACCTGGGTTGCAGAGGAGG - Intergenic
1199622981 X:149715551-149715573 ATGCAGCTGGACATCAGAGCAGG - Intronic
1199851608 X:151727909-151727931 CTGGAGCCAGGCAGCAGGCCTGG + Intergenic
1200065748 X:153503405-153503427 CTGGAGATGGGGAGCCCAGCTGG - Intronic
1200157375 X:153984439-153984461 CTGGAACTGGGCACCTGGGCTGG + Intergenic
1200886793 Y:8279540-8279562 CTGGGGAAGGGCAGCAGAGGTGG + Intergenic
1201893382 Y:18967626-18967648 GTGGATCTGGGCAACAGAGCTGG - Intergenic