ID: 900101546

View in Genome Browser
Species Human (GRCh38)
Location 1:964228-964250
Sequence GTGGGTAAACAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 781
Summary {0: 1, 1: 0, 2: 2, 3: 77, 4: 701}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900101546_900101570 27 Left 900101546 1:964228-964250 CCCTCCTCCCTCTGTTTACCCAC 0: 1
1: 0
2: 2
3: 77
4: 701
Right 900101570 1:964278-964300 TGGAGTCGGGGCTGCGGCAGAGG 0: 1
1: 0
2: 1
3: 37
4: 428
900101546_900101559 7 Left 900101546 1:964228-964250 CCCTCCTCCCTCTGTTTACCCAC 0: 1
1: 0
2: 2
3: 77
4: 701
Right 900101559 1:964258-964280 CCATTCCTGACACCCCACCCTGG 0: 1
1: 0
2: 1
3: 32
4: 310
900101546_900101567 21 Left 900101546 1:964228-964250 CCCTCCTCCCTCTGTTTACCCAC 0: 1
1: 0
2: 2
3: 77
4: 701
Right 900101567 1:964272-964294 CCACCCTGGAGTCGGGGCTGCGG 0: 1
1: 1
2: 2
3: 35
4: 312
900101546_900101571 30 Left 900101546 1:964228-964250 CCCTCCTCCCTCTGTTTACCCAC 0: 1
1: 0
2: 2
3: 77
4: 701
Right 900101571 1:964281-964303 AGTCGGGGCTGCGGCAGAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 390
900101546_900101563 15 Left 900101546 1:964228-964250 CCCTCCTCCCTCTGTTTACCCAC 0: 1
1: 0
2: 2
3: 77
4: 701
Right 900101563 1:964266-964288 GACACCCCACCCTGGAGTCGGGG 0: 1
1: 0
2: 0
3: 12
4: 109
900101546_900101562 14 Left 900101546 1:964228-964250 CCCTCCTCCCTCTGTTTACCCAC 0: 1
1: 0
2: 2
3: 77
4: 701
Right 900101562 1:964265-964287 TGACACCCCACCCTGGAGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 179
900101546_900101561 13 Left 900101546 1:964228-964250 CCCTCCTCCCTCTGTTTACCCAC 0: 1
1: 0
2: 2
3: 77
4: 701
Right 900101561 1:964264-964286 CTGACACCCCACCCTGGAGTCGG 0: 1
1: 0
2: 2
3: 25
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900101546 Original CRISPR GTGGGTAAACAGAGGGAGGA GGG (reversed) Intronic
900038529 1:436011-436033 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
900059964 1:670990-671012 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
900078233 1:835127-835149 GTGGGTGAACAGGGGGTGGAGGG - Intergenic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900279857 1:1859706-1859728 GTGGGAAAGAAGAGGGAGGCAGG + Intronic
900293917 1:1939229-1939251 GGGGGGAGAGAGAGGGAGGATGG + Intronic
900322521 1:2092203-2092225 GTAGGAAAACAGGGGGAGGGCGG - Intronic
901130122 1:6957093-6957115 GTGATTCAACAGAGGGATGATGG + Intronic
902169267 1:14597917-14597939 ATGGGTAAACTGAGGCAGCAGGG + Intergenic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902913017 1:19615053-19615075 GTGGGTCCAGAGAAGGAGGATGG - Intronic
903952695 1:27005421-27005443 TTGGGTAATCACTGGGAGGAGGG - Exonic
904310346 1:29625299-29625321 CTGGGTAAACATAGAGAGAAAGG - Intergenic
904375828 1:30081903-30081925 GTGGGGGAGCAGAGGGAGGGAGG - Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904751465 1:32743242-32743264 GAGGGTAAACACAGGCAGAATGG - Intronic
904988792 1:34574489-34574511 GTGGTTAGAGGGAGGGAGGATGG - Intergenic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905543410 1:38778411-38778433 GTGGGAGAACAGAGGTAGGTAGG - Intergenic
905824109 1:41016295-41016317 GGGGCCAAACTGAGGGAGGAAGG + Intronic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
906674587 1:47684034-47684056 GTGTGCAAACAGTGGGTGGATGG + Intergenic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907960134 1:59271473-59271495 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909469299 1:76008822-76008844 GTGGGAAGAGAGAGGGAGGAAGG - Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
910843736 1:91585933-91585955 GAGCTTAAACACAGGGAGGAGGG + Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911477385 1:98390265-98390287 GTGGCAAACTAGAGGGAGGAAGG + Intergenic
911995696 1:104763182-104763204 GCGGGTTAGAAGAGGGAGGAAGG - Intergenic
912084867 1:105987022-105987044 GAGGGTACACGGTGGGAGGAGGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913501334 1:119475297-119475319 GTGGGTCAACAGTGTGGGGAGGG + Intergenic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
916447012 1:164881645-164881667 GTGGGGAAAAAGAGGAAGGAAGG + Intronic
916812376 1:168316841-168316863 GTTGGTGAACAGAGAGAGTACGG + Intergenic
916812385 1:168316897-168316919 GTTGGTGAACAGAGAGAGTACGG + Intergenic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
917271019 1:173274517-173274539 GTGTGTACACAGTGGGAAGAGGG - Intergenic
917723750 1:177811034-177811056 GGAGGGAAACAGAGGGTGGAGGG + Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918290150 1:183099587-183099609 GGGGGCAGCCAGAGGGAGGAAGG - Intronic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919469211 1:197957998-197958020 GTGGGGAAGCTGTGGGAGGAAGG + Intergenic
919639752 1:200036417-200036439 GTGAGTGCTCAGAGGGAGGAGGG + Intronic
919819140 1:201462013-201462035 GTGGGGAGACCGAGGGAGAAGGG - Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920004768 1:202825063-202825085 GTGGGAAATAAGAGGGAGGAAGG + Intronic
920696383 1:208184203-208184225 GTGGGTTGAGACAGGGAGGAGGG + Intronic
920700584 1:208215517-208215539 GTGGATAAAGAGATGGATGAAGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920775834 1:208936227-208936249 GGGGGTAGACAGCGGGGGGAGGG + Intergenic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
921012362 1:211155102-211155124 GAGGGTAGAGAGCGGGAGGAGGG - Intergenic
921236648 1:213138501-213138523 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
923087291 1:230711296-230711318 GTGGGGACACAGAGAGAAGACGG + Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
924680008 1:246221452-246221474 GTGGGCAAAGAGAAGGAGAAAGG + Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1063655192 10:7981258-7981280 GTGGGTGAATAGATGGAAGAGGG - Intronic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1063951648 10:11228953-11228975 GTGGGTCAACAGAGGAAGAAAGG + Intronic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065438575 10:25726467-25726489 GTGGGAAAATAAAGGGAGGGAGG - Intergenic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065973589 10:30823889-30823911 GTGGGAGAACAGAGGAAAGATGG - Intronic
1067349391 10:45462329-45462351 GGGGGGAAACAGAGTTAGGATGG + Intronic
1067796857 10:49327145-49327167 GTGGGCCAGGAGAGGGAGGAAGG - Exonic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1069746742 10:70719916-70719938 GTGTGTAAACAGAGGCAGTGTGG - Intronic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1069819793 10:71220343-71220365 GTGGGTAAGAAGGGGAAGGATGG + Intronic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072609791 10:97010617-97010639 GTGGGTGGCCAGAGGGAGGGTGG + Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1073175760 10:101556338-101556360 GTGGGGAAACAAAGGTGGGAGGG + Exonic
1073630289 10:105141397-105141419 GTGGGGACAGAGAGGGTGGAGGG + Intronic
1073762383 10:106644036-106644058 GCAGGTAAACACAGGGTGGAAGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073930474 10:108568265-108568287 GTGGGGCAACAGAGTGAAGAAGG - Intergenic
1073959602 10:108911706-108911728 GTGTGTAAACAGATGAAAGATGG - Intergenic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1075629478 10:123992310-123992332 GTGGGGCAACTGAGGGAGGCCGG - Intergenic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1076964734 11:71925-71947 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077150328 11:1070255-1070277 GTGGATAAATGGAGGGAGGGAGG - Intergenic
1077298161 11:1835603-1835625 GTGGGTGAACAGAGGTGAGAAGG + Intronic
1077456369 11:2683709-2683731 CTAGGTAACCAGAGGGAGTAAGG - Intronic
1077898322 11:6470753-6470775 GAGGGTAAAGAGAGAAAGGAGGG + Intronic
1077937689 11:6806419-6806441 GTGGGTTACTAGAGGGAGGAGGG - Intergenic
1078078346 11:8182158-8182180 GTGGGTGAAGGGTGGGAGGAGGG - Intergenic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078860336 11:15240753-15240775 GTGGTAGAACAGAGGGAAGAGGG - Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079651226 11:22932691-22932713 GCAGGGAAAGAGAGGGAGGAAGG - Intergenic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1080881591 11:36326551-36326573 TTGGGTAAAAAGAGGGGAGAGGG - Intronic
1081346466 11:41993250-41993272 GTGGGTAAACTGAGGCAAGTTGG - Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081929429 11:46858516-46858538 GTGGGTAAAGACAGGGATGAAGG - Exonic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083071536 11:59988958-59988980 GTAGGTTGAGAGAGGGAGGAGGG - Intergenic
1083248491 11:61449087-61449109 GTGGCTAGACAAAGAGAGGAAGG + Intronic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083880533 11:65546348-65546370 GTCTGTAAACAGTGGGTGGAAGG - Intronic
1084415366 11:69029264-69029286 TTTAGGAAACAGAGGGAGGAGGG - Intergenic
1084416231 11:69034315-69034337 GTGGGTACAGACAGGGAGGCAGG - Intergenic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1084941467 11:72615492-72615514 GTGGGTAGAGGGAGGGAGGCAGG + Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086068535 11:82772635-82772657 GAGGGTGAACGGTGGGAGGAGGG - Intergenic
1086099784 11:83087043-83087065 GTGGGTAAATAGAGGACAGAGGG - Intergenic
1086393551 11:86390692-86390714 GTGGGTAGGAAGAGGAAGGAAGG + Intronic
1086417889 11:86607357-86607379 GTGGGAAAAGGGAGGGAGAAAGG - Intronic
1086957263 11:92946225-92946247 GTGGGGCAACAGAGGGTAGAAGG + Intergenic
1088181328 11:107115736-107115758 GTGGGTAAAGAGTGGAAGGAAGG + Intergenic
1088442428 11:109886209-109886231 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1089342968 11:117772123-117772145 GGGTGTCAACAGAGAGAGGAGGG + Intronic
1089457514 11:118634181-118634203 GTGGGTACAGAGGGGGTGGACGG - Intronic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090465230 11:126927672-126927694 GGTGGAAGACAGAGGGAGGAGGG - Intronic
1090550332 11:127812583-127812605 ATGGGTAAATAGTGGGAGGGAGG - Intergenic
1091021514 11:132104334-132104356 GGGGGAAAATGGAGGGAGGAAGG - Intronic
1091072445 11:132580740-132580762 GTGAGTAAAGGGAGGTAGGAAGG - Intronic
1091240261 11:134047328-134047350 GTGGGATAACAAAAGGAGGATGG + Intergenic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1091823592 12:3493314-3493336 GTGGGCGATCAGAGGGCGGAGGG - Intronic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1093037210 12:14343593-14343615 GCGGGTGAAGAGTGGGAGGAGGG - Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093838035 12:23860145-23860167 GGGGGGAAACGGTGGGAGGAGGG + Intronic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1096244602 12:49977177-49977199 GTTGGTAATGAGAGGGAGGAGGG + Intronic
1096912092 12:54994695-54994717 GAGGGTAATGAGTGGGAGGAGGG - Intergenic
1097249200 12:57623124-57623146 GTGGGAAAACACAGGTAAGAGGG + Exonic
1097261224 12:57721248-57721270 GTGGGTAGAGAGAGCAAGGAGGG + Exonic
1097722760 12:63041383-63041405 GTGGGGAAACAGAGAGAAGCTGG + Intergenic
1098006579 12:66003716-66003738 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1099680112 12:85816154-85816176 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1099813300 12:87613619-87613641 GAGGGTAAAATGTGGGAGGAGGG - Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100780695 12:98023102-98023124 GTTGGCAAACAGAGAGAGGTTGG - Intergenic
1100872984 12:98931753-98931775 GGGGGTAAACACAGGGATGAAGG - Intronic
1101000736 12:100355206-100355228 GTGGGGAGAAAGAGGGAGGGAGG + Intergenic
1101759104 12:107644720-107644742 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
1101830851 12:108255311-108255333 GTGGGAGACAAGAGGGAGGAAGG + Intergenic
1102720783 12:115014140-115014162 GGGAGTAAAGGGAGGGAGGATGG + Intergenic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1103047927 12:117753662-117753684 GAGGGTAGACGGTGGGAGGAGGG + Intronic
1103732975 12:123041025-123041047 GTGTGTAAACAGACAGAGAAGGG + Intronic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1105296215 13:19089828-19089850 GTGGGAAATGAGAGAGAGGAGGG + Intergenic
1105299491 13:19119208-19119230 GTGGGTAAAAAGTGGGTAGATGG + Intergenic
1106481212 13:30138316-30138338 GAGGGTAAAAAGAGGGAAAAGGG + Intergenic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1107230987 13:38110213-38110235 GAGGGTAAAGAGCGGGAGAAGGG + Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109538423 13:63742864-63742886 GTGGGTTAACAAAGGCAGCAAGG + Intergenic
1109545415 13:63836908-63836930 GTGGGTTAACAAAGGCAGCAAGG - Intergenic
1110442721 13:75543175-75543197 GAGGGTAGAGAGTGGGAGGAAGG + Intronic
1110811548 13:79816799-79816821 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111736476 13:92146657-92146679 TGGGGGAAACAGTGGGAGGAGGG - Intronic
1112219196 13:97470843-97470865 GTGGGGATACAGAGGCAGGTTGG + Intergenic
1112782695 13:102918575-102918597 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1115643049 14:35347568-35347590 GTGGGAGATCAAAGGGAGGAGGG + Intergenic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115940556 14:38603746-38603768 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117948120 14:61053028-61053050 GTGGGTAGAGGGTGGGAGGAGGG - Intronic
1118482343 14:66179835-66179857 GTGAGTACAAAGAGGGAAGATGG - Intergenic
1119643242 14:76330109-76330131 ATGGGTACACAGAGAGAGGGAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121329791 14:93042676-93042698 GTGGGCAAAGAAAGGGAGAAGGG + Intronic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121602995 14:95219952-95219974 GTGGGAAGACAGGGGGATGAGGG - Intronic
1121729165 14:96174334-96174356 GGTTGTAGACAGAGGGAGGAAGG + Intergenic
1122171579 14:99880394-99880416 GTGGGAATACAGAGGAAGAAAGG - Intronic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1123173635 14:106397959-106397981 GTGAGCGAAAAGAGGGAGGACGG - Intergenic
1123181891 14:106479231-106479253 GTGAGAGAAAAGAGGGAGGAAGG - Intergenic
1202945014 14_KI270726v1_random:17498-17520 GTGAGAGAAAAGAGGGAGGAAGG + Intergenic
1124252108 15:28113591-28113613 GCCGGTGAACAGAGAGAGGAGGG + Exonic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1126486546 15:49187752-49187774 TTGGGTAAACAGTGGGAGCCAGG - Intronic
1126694815 15:51317000-51317022 GTGGCAAGACAGAGGGAGCATGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127276007 15:57444753-57444775 GTGGGAACACAGAGCCAGGATGG + Intronic
1127885668 15:63197869-63197891 GTAGGGAAAGAGAGGGAGGGCGG + Intronic
1128085306 15:64882384-64882406 GTGGCTAAACGAAGGGAGGGAGG - Intronic
1128250803 15:66163137-66163159 GTTGGGAAACAGAGGGCAGAGGG + Intronic
1128681841 15:69658089-69658111 GTGGGTCAAGAGATGGAGGCAGG - Intergenic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131514114 15:93066056-93066078 GTGGGGCAACTGAGGGAGGCCGG + Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132443385 15:101891605-101891627 GTAGTCAAACAGAGGGAGGGAGG + Intergenic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1132609382 16:807647-807669 GTGGGGAAACTGAGGTAAGACGG + Intronic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1132855897 16:2044403-2044425 GCGGGGAAGCAGAGGAAGGAAGG + Intronic
1133087125 16:3373545-3373567 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1133202034 16:4209565-4209587 GTGGGTACCCTGAGGGAGAAGGG - Intronic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133671141 16:8022049-8022071 GTGGGTATACTGAGGGTTGAAGG + Intergenic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1136412168 16:30083825-30083847 GTTGGGAAAGAGAGGGAGCAGGG + Intronic
1137236560 16:46623215-46623237 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1137616331 16:49849670-49849692 GGAGGTAAACAGAGGGAGGCAGG + Intronic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138074177 16:54024656-54024678 ATGGGAAAACCGAGGGAGAATGG - Intronic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138575246 16:57903562-57903584 GTGGGTAAAGTGAGGGGGGCAGG + Intronic
1138941265 16:61793402-61793424 GAGGGTAGAGGGAGGGAGGAGGG - Intronic
1139586941 16:67909951-67909973 GTGGGAAAAGTGAGGCAGGAAGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140859391 16:79005934-79005956 GTGGGTAACCAGAGTATGGATGG - Intronic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141048837 16:80742584-80742606 GTGGGTAGATAGGTGGAGGATGG + Intronic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1142955131 17:3516394-3516416 GTGGGTAGAGAGGGGCAGGATGG - Intronic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1143492082 17:7290418-7290440 GTGGGGCAACTGAGGGAGGCCGG + Exonic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144611774 17:16725621-16725643 GTGGGGAAAGAGTGGGAGGGGGG + Intronic
1144782911 17:17816830-17816852 GTGGCTAGGCACAGGGAGGACGG + Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1144900965 17:18589765-18589787 GTGGGGAAAGAGTGGGAGGGGGG - Intergenic
1145131541 17:20356302-20356324 GTGGGGAAAGAGTGGGAGGGGGG + Intergenic
1145262283 17:21361511-21361533 GTGGCTGAACAGAGGGAGCGGGG - Intergenic
1145886488 17:28385467-28385489 GTGGGTAGGCGGTGGGAGGAAGG + Intronic
1145984720 17:29037749-29037771 GGGGGCAAAGGGAGGGAGGATGG + Intronic
1146135777 17:30319670-30319692 GTGAGGGAAGAGAGGGAGGAAGG + Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147445726 17:40474286-40474308 GTGGGAGAAGAGAGGGAGGGAGG + Intergenic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1148701475 17:49589549-49589571 TTGGGTAAATAGAGGGTAGACGG + Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149989344 17:61372754-61372776 GGGGGGTAACAGAGAGAGGAGGG - Intronic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150619339 17:66797693-66797715 GTGGGGACACAGAGGGGAGAAGG - Intronic
1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151027441 17:70695095-70695117 GTGATTAAACTTAGGGAGGAAGG + Intergenic
1151345812 17:73500562-73500584 GGAGGAGAACAGAGGGAGGATGG - Intronic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1152482553 17:80564738-80564760 GAGGGTAGACGGTGGGAGGAGGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1203159869 17_GL000205v2_random:39285-39307 GTGGGGAAGCGGAGGGACGAGGG - Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153589366 18:6657150-6657172 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1154072554 18:11165882-11165904 GCAGGGAAACAGAGGCAGGAAGG + Intergenic
1155283606 18:24266214-24266236 GTGGGGAAAGCCAGGGAGGAAGG - Intronic
1155464077 18:26116121-26116143 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1156297885 18:35809178-35809200 GTGGAAAACTAGAGGGAGGAAGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158575029 18:58629498-58629520 GGGGGTAAGCAGGGTGAGGAGGG - Intergenic
1159199586 18:65166905-65166927 GTGGGTCTACAGAGGCAGGCAGG - Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160641539 19:141556-141578 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
1160687110 19:442247-442269 GTGGGTGAACGGATGGATGATGG + Intronic
1161038698 19:2098837-2098859 GGGGGTAAAGGGAGAGAGGAGGG + Intronic
1161148665 19:2695161-2695183 GTGGGTACACAGAGGGCGCTAGG - Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161604760 19:5208451-5208473 GGGGGTGAAGATAGGGAGGATGG - Intronic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161676248 19:5651681-5651703 GTGAGAAAGCACAGGGAGGAGGG - Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161873279 19:6887092-6887114 GTTGGTGAATAGAGGGAGGGAGG + Intergenic
1162395694 19:10417116-10417138 GGGGGTAAACTGAGGCACGAGGG - Intronic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163596025 19:18221333-18221355 GTGGGTAAAAAGCTGGAAGATGG - Intronic
1164953928 19:32364481-32364503 GGGGGGAAAGAGTGGGAGGAGGG - Intronic
1165135561 19:33666215-33666237 GGGGGTACACATAGGGAAGATGG + Intronic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166120765 19:40684914-40684936 GTGGGAAATCAGACGTAGGAGGG + Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167717151 19:51150823-51150845 GTGATTAGACAGAGGGAGGCAGG + Intronic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167918080 19:52758619-52758641 GAGGGTAGAGAGTGGGAGGAAGG + Intergenic
1167981683 19:53281429-53281451 TTGGGTAAATAGGGGTAGGAGGG + Intergenic
1167984411 19:53302233-53302255 TTGGGTAGACAGGGGTAGGAGGG - Intergenic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925493801 2:4423917-4423939 TTGGGTAAAGCGGGGGAGGATGG + Intergenic
926135038 2:10330571-10330593 GTGTGAGAACAGAGGGAGAAAGG - Intronic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
928623971 2:33120322-33120344 GAGGGTAAAAGGAGGGAGAAGGG - Intronic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG + Intronic
929404733 2:41628937-41628959 GTTGGTAAATATTGGGAGGAAGG + Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929731181 2:44494414-44494436 GTACGTAAACAGAGGGAAGAGGG - Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930519342 2:52444407-52444429 GTGGGAACACTGAGGCAGGAGGG - Intergenic
930700422 2:54455108-54455130 GCGGGCATTCAGAGGGAGGAGGG - Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932757382 2:74417885-74417907 GTGGGTGGACGGGGGGAGGAGGG + Intronic
932786288 2:74607168-74607190 GTGGTCAAACAGTTGGAGGAAGG - Exonic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937080461 2:119136514-119136536 ATGGGTAAACAGGGGAAGGGCGG - Intergenic
937304107 2:120860640-120860662 GTGGGTCAAAAGATGCAGGAGGG + Intronic
939156410 2:138529963-138529985 GAGGGTAAAGCGTGGGAGGAGGG - Intronic
939252913 2:139706036-139706058 GTTGGTGCACAGAGGGAGGCAGG + Intergenic
939417763 2:141923482-141923504 GTGTGTAGAGAGAGGGAGGGAGG + Intronic
941381849 2:164802836-164802858 GGAGGGAAAGAGAGGGAGGAAGG + Intronic
941408310 2:165120041-165120063 GTGGGTCTACAGAGGGATGATGG + Intronic
941563745 2:167082087-167082109 GTGGGTAGAGGGAGGGGGGAGGG - Intronic
941794221 2:169582553-169582575 GAGTGTAGACAGTGGGAGGAGGG - Intergenic
941827556 2:169916977-169916999 GGAGGTAAAGAGAGGGAGCAGGG - Intronic
942132914 2:172898463-172898485 GTGGGTCCACAGAGTGAGGTGGG - Intronic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943381600 2:187156656-187156678 GTGAGGACACAGAGAGAGGATGG - Intergenic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943689158 2:190851272-190851294 GTAGGTAAACTGAAGGAGGCTGG - Intergenic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
944287683 2:197970243-197970265 GTGTGTAAAAAGAGAGAGCATGG + Intronic
944399159 2:199305347-199305369 GGGGGTAAAAGGTGGGAGGAGGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946307892 2:218866245-218866267 GTGGGGAAATAGAGGGAGGCTGG + Intronic
946653419 2:221918731-221918753 GTGGGTAAACAGAGGAAGGCAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947931727 2:233970311-233970333 GTAGGCAAACAGCAGGAGGAAGG - Exonic
948524845 2:238565096-238565118 GTGAGGACACAGCGGGAGGATGG + Intergenic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
1168733542 20:109447-109469 GTGGATTACTAGAGGGAGGAGGG + Intergenic
1169524027 20:6403402-6403424 GTATGTGAACAGAGGGAGGAAGG + Intergenic
1169922899 20:10754444-10754466 TTGCGTAGAGAGAGGGAGGAGGG + Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170032400 20:11956817-11956839 GTGGGACAGCAGAGGCAGGAGGG - Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1171238153 20:23544635-23544657 GTGGGTCAACAGAGGCCAGATGG - Intergenic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1173380487 20:42535322-42535344 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1173398365 20:42702038-42702060 GTGGGTAAACAGAGAGGGAGGGG - Intronic
1173502976 20:43566889-43566911 GTGGGTAGAAGGAGGGAGGGAGG + Intronic
1174559416 20:51419421-51419443 ATGGGAAAAAAGAGGAAGGAGGG - Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175817896 20:61893148-61893170 GTGGGTGAATAGAGGGATGGTGG + Intronic
1175871833 20:62212893-62212915 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175871854 20:62212940-62212962 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177608036 21:23407767-23407789 GTGGGTGAACGGGTGGAGGAAGG - Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178499117 21:33111015-33111037 GTGGGTAAACTGAGGTACGGGGG + Intergenic
1178715548 21:34960793-34960815 GTCTGTAAACACAGGGAGAAGGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1179818993 21:43925525-43925547 GTGGGTAGACAAAAGGGGGAGGG + Intronic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1181998611 22:26902773-26902795 GGGGGGAAAGAGAGAGAGGAAGG - Intergenic
1182003595 22:26940889-26940911 GTGGGGGCACAGAGGGAGGGAGG + Intergenic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183251293 22:36732166-36732188 GTGCGTAGCAAGAGGGAGGAGGG - Intergenic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183642996 22:39103629-39103651 GTGGGACACCACAGGGAGGAAGG - Intronic
1184293370 22:43509597-43509619 GGGGGTGAATAGAGGGATGATGG - Intergenic
1184959345 22:47917828-47917850 GGCAGTAAAGAGAGGGAGGAGGG - Intergenic
1184959375 22:47917940-47917962 GGGAGGAAAGAGAGGGAGGAGGG - Intergenic
1185061598 22:48609889-48609911 GTTAGGACACAGAGGGAGGACGG - Intronic
949163885 3:913792-913814 GTGGGAAAACAAAGTGGGGAGGG - Intergenic
950030077 3:9846414-9846436 GGGGGTCAGCAGAGGCAGGATGG + Intronic
950110599 3:10416375-10416397 TTGGCTAAAAAGAGAGAGGAAGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950394816 3:12726008-12726030 GTGGGGAAAAATGGGGAGGAAGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951280415 3:20742122-20742144 GTGGGAAAGCAGAGGGGGTAGGG - Intergenic
951607290 3:24450040-24450062 GGAAGTAAACAGAGGGAAGAAGG + Intronic
952178278 3:30891052-30891074 GTTGGTAACCACAGGAAGGAAGG - Intronic
952742303 3:36746477-36746499 GTAGGAAAACTGAGGGATGAGGG - Intergenic
954092142 3:48293634-48293656 GTGGGAGAACAGAGGAAAGAAGG - Exonic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954886587 3:53880792-53880814 GGAGCTAACCAGAGGGAGGAGGG - Intronic
955496660 3:59540636-59540658 GAGGGTAAAGGGAGGAAGGAAGG + Intergenic
955956763 3:64298127-64298149 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
958027201 3:88061986-88062008 GTGGGCAAAGGGAGAGAGGAAGG + Intronic
959111774 3:102131269-102131291 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
960171545 3:114467363-114467385 GTGGGCAGATAAAGGGAGGATGG + Intronic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961514554 3:127424603-127424625 GTGTGTGAACAGAGAGAGGGAGG - Intergenic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
961749680 3:129087913-129087935 GGGGGGAAGCAGAGGGAGGTGGG - Exonic
962201510 3:133404289-133404311 GTAGGGAGACAGAGGGAGGTAGG - Intronic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
962894731 3:139704151-139704173 GTGGGTAAGGTGGGGGAGGAGGG + Intergenic
962894821 3:139704736-139704758 GTGGGGGAATAGAGGGAGTATGG + Intergenic
963496665 3:146072137-146072159 GTGTGTAAAGATAGGAAGGAGGG - Intronic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
964969596 3:162543158-162543180 GTGGGTAACCATATGGAGTATGG - Intergenic
965084629 3:164079018-164079040 GATGGTAGACAGTGGGAGGATGG + Intergenic
965145555 3:164897467-164897489 GTGGTTAAAGAGAGAGAGGTGGG + Intergenic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
966602715 3:181791041-181791063 GTGGGAGAAGAGAGAGAGGAAGG + Intergenic
966670536 3:182521180-182521202 GTGGGAAGACAAAGGCAGGATGG - Intergenic
967861593 3:194155997-194156019 GTAGGGAAGCAGAGGAAGGAAGG + Intergenic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
969838997 4:9866807-9866829 GTGGGTAAACTGATGCATGAGGG + Intronic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
971620174 4:28845626-28845648 GAGGGTAGAAAGTGGGAGGAGGG - Intergenic
973090261 4:46126833-46126855 GTGGTTCAAAAGAAGGAGGAGGG - Intergenic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
975609070 4:76186145-76186167 GTGGGCATACAGAGGAGGGAGGG + Intronic
975787974 4:77913961-77913983 GTGGGTGAAGAGGGGCAGGAAGG + Intronic
975794047 4:77987456-77987478 GTGAGTAAAAAGAGTAAGGATGG - Intergenic
976759595 4:88533960-88533982 GGAGGTAGAAAGAGGGAGGAAGG - Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
978647309 4:110951498-110951520 GTGGGTAGAGGGTGGGAGGAGGG - Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
979052923 4:115956912-115956934 TTGGGTAAACAAAGAGAGTAGGG - Intergenic
979132154 4:117060557-117060579 GAAGGTAAACAGAGTGATGAAGG - Intergenic
979440000 4:120740449-120740471 GTGGGTTTAGAGAGGAAGGAGGG - Intronic
980166423 4:129233610-129233632 ATGGGTAGACAGAGGCAGGTGGG + Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
982712358 4:158769506-158769528 GTGGAGAAAGAGCGGGAGGAAGG - Intronic
983177499 4:164608208-164608230 GTTCGTAAGCGGAGGGAGGAGGG - Intergenic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984850306 4:184146867-184146889 GTTAGTAACCAGATGGAGGAGGG - Intronic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
987525514 5:19044941-19044963 ATGGGTAAACTGGGAGAGGAGGG + Intergenic
988514892 5:31895760-31895782 GGGAGCAGACAGAGGGAGGAAGG - Intronic
988602547 5:32653428-32653450 GTTGGTAAGCAGAGGGCAGAGGG + Intergenic
988612389 5:32739216-32739238 GTGGGTATACTGAGGAGGGAAGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
989455946 5:41644509-41644531 GTGGGTGAAAAGTGGGAGGAGGG + Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991095390 5:62734455-62734477 TTGGGCAAAAAGCGGGAGGAGGG - Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
992520159 5:77542273-77542295 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
994988135 5:106964214-106964236 GTGTGTAAGCAGAGGTAGCAGGG + Intergenic
995741042 5:115356016-115356038 GTGTGTAAACAGAGAGGGTAAGG + Intergenic
995785182 5:115820122-115820144 GGGGATAACTAGAGGGAGGATGG - Intergenic
996046523 5:118879802-118879824 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
997029245 5:130104566-130104588 TTAGGTAAACAGAGAGAAGAAGG + Intronic
997749544 5:136330968-136330990 GTGGGTAAGCAGAGGGTTTATGG + Intronic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998579290 5:143354377-143354399 GTGGCTAAACTTAGTGAGGAAGG - Intronic
999496961 5:152108494-152108516 GTAGGGAAGCAGAGGGAGGGTGG + Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000495357 5:161976243-161976265 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1001293785 5:170484869-170484891 GTGGCTACAGAGAGGGAGGGTGG - Intronic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002735318 5:181382932-181382954 GTAGTCAAACAGAGGGAGGGAGG + Intergenic
1002749203 6:91193-91215 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
1002822963 6:745436-745458 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003162924 6:3651327-3651349 GGGGGAAAAGGGAGGGAGGAGGG + Intergenic
1004160853 6:13211643-13211665 GTGGGGAACCAGAGAAAGGAAGG - Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005693988 6:28334780-28334802 GTGGGACAACAGGGGGTGGAAGG + Intronic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1006861914 6:37177416-37177438 GTGGCTATAAAGAGGAAGGAAGG + Intergenic
1007582713 6:42968774-42968796 GTGAGTAGACAGAGGAGGGAGGG + Intronic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007962204 6:45970069-45970091 GGGGGTGAGGAGAGGGAGGAAGG - Intronic
1007995194 6:46300131-46300153 GTGGGAAAAAAGAGGGAAAAAGG + Intronic
1008081209 6:47196129-47196151 GTGGCTAAAGAGTGGGTGGAAGG - Intergenic
1008251642 6:49247009-49247031 GACGGTAGAGAGAGGGAGGAGGG + Intergenic
1008378997 6:50821802-50821824 GTAGGCAAGCGGAGGGAGGAAGG + Intronic
1009565861 6:65310428-65310450 GTGGGTACTCAGAGGCAGGCAGG - Intronic
1009890382 6:69673556-69673578 GTGGGCAACCTGGGGGAGGAGGG + Intergenic
1010252612 6:73723741-73723763 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010507219 6:76675401-76675423 GAGGGTAGAGGGAGGGAGGAGGG - Intergenic
1010659025 6:78547313-78547335 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1010769469 6:79812101-79812123 TTAGGTAAACCCAGGGAGGAGGG - Intergenic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1012840526 6:104323874-104323896 GAGGGTAAAGAACGGGAGGAGGG + Intergenic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1015056810 6:128912346-128912368 TTGTGTAAAAAGAGGGAGAAAGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1016054025 6:139559708-139559730 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1016784311 6:147993291-147993313 GGGAGTAAAGAAAGGGAGGAGGG + Intergenic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017003910 6:150015580-150015602 GTAGGAAAATAGAGGAAGGACGG + Intergenic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017577906 6:155826079-155826101 GTGGGGAAACACAGCAAGGAAGG - Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1018287796 6:162259252-162259274 GTGGGAGAACAGAGGCAGGTCGG - Intronic
1018310552 6:162503817-162503839 GTGGGTAAACAGGAGGGTGATGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018899022 6:168041999-168042021 GGGAGCAAACAGAGGCAGGAAGG + Exonic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019239584 6:170655246-170655268 GTAGTCAAACAGAGGGAGGGAGG + Intergenic
1019510480 7:1415193-1415215 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019510510 7:1415289-1415311 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021327973 7:19297752-19297774 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021547987 7:21837565-21837587 GGAGGTAAAAGGAGGGAGGATGG + Intronic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022177638 7:27887124-27887146 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022311456 7:29200369-29200391 GTGGATAGAGGGAGGGAGGAGGG - Intronic
1022600578 7:31755164-31755186 TTACGTAAACAGAGGGTGGATGG + Intronic
1023370185 7:39505496-39505518 GGGGGGAAAGAGAGGGAGGGAGG - Intergenic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024423322 7:49196199-49196221 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1024920145 7:54546285-54546307 GTGGGGAAGGAGAGGGAGAAAGG + Intronic
1025284210 7:57649384-57649406 GTGTGTAAACAGAGGAATGTGGG + Intergenic
1028911881 7:96216745-96216767 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1029009884 7:97248494-97248516 GGAGCTAAACAGAGGGATGATGG + Intergenic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1030560999 7:111085966-111085988 GAGGGTTAAGAGTGGGAGGAGGG + Intronic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031663860 7:124460864-124460886 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1032066203 7:128773481-128773503 TTTGGTAAGCACAGGGAGGAAGG - Intronic
1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG + Intergenic
1032625003 7:133582118-133582140 GAGGGTAGAGGGAGGGAGGAAGG - Intronic
1033439655 7:141367147-141367169 GTGGACCAGCAGAGGGAGGAAGG + Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035508190 8:151361-151383 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
1035527405 8:324616-324638 GTGGGTGAACAGGGGGTGGAGGG + Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035946742 8:3971667-3971689 GGGGGTACTCAGAGGGAGAAAGG + Intronic
1035976520 8:4318338-4318360 GTGCATAAAAAGAGAGAGGAGGG - Intronic
1036143032 8:6225704-6225726 GTGGGGAAGGAGAGGGAGGGAGG - Intergenic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036208452 8:6822794-6822816 GTGCCTAGACTGAGGGAGGAGGG + Intronic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036290125 8:7480395-7480417 GTGGGGGAAAAGAGGGAGGGAGG + Intergenic
1036331351 8:7831127-7831149 GTGGGGGAAAAGAGGGAGGGAGG - Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037937053 8:22921946-22921968 GGAGGTAAACTGAGGGTGGAGGG + Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038660544 8:29493008-29493030 GTCAGTGAACAGAGAGAGGAAGG - Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1040278866 8:46027621-46027643 GTGGGTAAATGGAGGGACGTTGG - Intergenic
1040655960 8:49508035-49508057 GGGGCTACAGAGAGGGAGGAAGG - Intergenic
1040671958 8:49702750-49702772 GTGGGTGAAGGGTGGGAGGAGGG + Intergenic
1041040440 8:53841274-53841296 TTGGGCTAACGGAGGGAGGAAGG - Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041755145 8:61305338-61305360 GTGGTTAATCAGAGAGGGGAAGG - Intronic
1041755173 8:61305699-61305721 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1042036535 8:64540103-64540125 GTGGGGAGACTGAGGTAGGAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044239893 8:89876711-89876733 GTGGGTAAAAATAAGGAAGAGGG - Intergenic
1044351264 8:91169252-91169274 GAGGGTAGAAAGTGGGAGGAGGG + Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1045573422 8:103393402-103393424 GTGGGCATACAGAGGGAGTCAGG - Intergenic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045689617 8:104746812-104746834 CTGGCTTAACAGAGGGAGGTAGG + Intronic
1046048198 8:108987982-108988004 GAGGGTAGAGGGAGGGAGGAGGG + Intergenic
1046188902 8:110763491-110763513 GAGGGTAGAAAGTGGGAGGAGGG + Intergenic
1046282650 8:112053860-112053882 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1047258722 8:123236969-123236991 GCGGGCAAACAGCTGGAGGATGG + Intronic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048152501 8:131907842-131907864 GTGGGTAGAAGAAGGGAGGAAGG - Intronic
1048348270 8:133594982-133595004 ATGGCTAAAGAGAGAGAGGAAGG - Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049806707 8:144544284-144544306 GTGGGCACACAGAGGCAGGGTGG - Intronic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050699288 9:8319434-8319456 GTAGGCATACAGAGGGAGAATGG + Intronic
1051494609 9:17705800-17705822 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052760425 9:32584810-32584832 GTGGGTAGACAGAGAGATGTTGG - Intergenic
1052990690 9:34517886-34517908 GTGGGTCTACACAGAGAGGAAGG + Intronic
1053163665 9:35829805-35829827 TTGGGTAAACACAGAGATGAGGG - Exonic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053865311 9:42431844-42431866 GGGGGTAAAAAGTGGGAGGTGGG - Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1055372851 9:75619349-75619371 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1055541126 9:77306444-77306466 GTGTGTAAAGAGAGGGAAAAGGG + Intronic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1057321182 9:94014444-94014466 GTGAGTTAACAGGGGGAGGGAGG - Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058352627 9:104043966-104043988 ATGGGAAAAGAGAGGCAGGAGGG + Intergenic
1058669867 9:107351758-107351780 GTGTGCTCACAGAGGGAGGATGG + Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059084472 9:111285209-111285231 GGGGGTTAAGAGAGGGAGCAGGG - Intergenic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059404464 9:114091573-114091595 GTGGGAAATTAGAGGGAGGAAGG - Intronic
1060299619 9:122367623-122367645 GTAGGTAAAGAGGAGGAGGAAGG + Intergenic
1060552480 9:124492242-124492264 GTAGGGAAAGAGAGGGAGGGGGG - Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1061679573 9:132236281-132236303 GTGGGTTAAAGGAGGGAGGGCGG + Intronic
1061789004 9:133048780-133048802 TGGGGTAAAATGAGGGAGGAGGG + Intronic
1061848259 9:133400286-133400308 GTGGGTGAATAGAAGGGGGAAGG - Intronic
1062049123 9:134438129-134438151 GTGCCTGAACAGAGGGTGGATGG + Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1203600240 Un_KI270748v1:6309-6331 GTAGTCAAACAGAGGGAGGGAGG + Intergenic
1185823746 X:3229022-3229044 ATGGGGAAACAGGGGGAGTAAGG + Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185848563 X:3464098-3464120 GTGGGTGAAGAGTGGGAGGAGGG - Intergenic
1186135111 X:6511068-6511090 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187556236 X:20354805-20354827 GTGGGTGAAGTGAGGAAGGAGGG + Intergenic
1187644902 X:21336371-21336393 GTGGGTGGAGAGTGGGAGGAGGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189748382 X:44193704-44193726 GTGTGTAGACAGAGGGAGAGTGG + Intronic
1190433827 X:50403992-50404014 GTGGGTAGATATAGGGATGAAGG - Intronic
1190755029 X:53394301-53394323 ATGGGTAAATATGGGGAGGAAGG + Intronic
1191157728 X:57293839-57293861 GTGGGTAAATGGGGGGAGCATGG + Intronic
1192420772 X:71028244-71028266 GTGGTAAAATAGAGAGAGGATGG + Intergenic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1192773084 X:74214099-74214121 GTGGGGAAAGAAATGGAGGAAGG + Intergenic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1192877362 X:75245791-75245813 GTGGGTGGAGAAAGGGAGGAGGG + Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193317113 X:80077137-80077159 GTGGGGAATCACAGGGAAGAGGG + Intergenic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1197404235 X:126029916-126029938 ATTGGTAATCAGTGGGAGGATGG + Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1200815080 Y:7522722-7522744 GTGGGTGAAGAGTGGGAGGAGGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201724176 Y:17135510-17135532 GAGAGTAAAAAGAGAGAGGAAGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202035613 Y:20631839-20631861 GTGGGGAAAAAGAGAGAGGTAGG - Intergenic