ID: 900102762

View in Genome Browser
Species Human (GRCh38)
Location 1:969124-969146
Sequence CCCACGTCTGCAGTATTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900102762 Original CRISPR CCCACGTCTGCAGTATTGTA TGG (reversed) Intronic
900102762 1:969124-969146 CCCACGTCTGCAGTATTGTATGG - Intronic
904107350 1:28097078-28097100 TCCACCTCTGCAGTATGGGAAGG - Intergenic
918734624 1:188043245-188043267 CCCACGGTTTCAGTGTTGTATGG + Intergenic
1064166329 10:12989357-12989379 CCCAAGTCTGCAGAATCCTAGGG + Intronic
1070057019 10:72945234-72945256 TCCACTTCTGCAGTATTCTCTGG - Intronic
1074711658 10:116183072-116183094 CCCAAGTCTTGAGTATTGAAAGG + Intronic
1077491554 11:2863055-2863077 CCCACGTCTGCCGTCTTGCCCGG - Intergenic
1087042728 11:93817587-93817609 CCCAGCTCTTCAGAATTGTAGGG + Intergenic
1102502558 12:113362408-113362430 CCCACTTCCGCAGTCTAGTATGG - Intronic
1104201493 12:126593992-126594014 CCCACATCTGCATAATTGTCTGG + Intergenic
1115341170 14:32294497-32294519 CCCATGTCTGCATTATTTTTTGG + Intergenic
1125518113 15:40334191-40334213 CCCACGTCTGCTGAATTATCCGG - Exonic
1133654911 16:7851693-7851715 TCCAAGCCTGCAGTATTGTTGGG + Intergenic
1139092446 16:63664861-63664883 CTCACATCAGCAGTATTCTAAGG + Intergenic
1139683044 16:68580457-68580479 CCCAGGTCTGCAGTCTTCTTGGG - Intergenic
1148019855 17:44546546-44546568 CCAACCTCTGCAGTATAGGAAGG + Intergenic
1157581853 18:48778340-48778362 CCCAGGTCTGCAGGAGTGCAGGG + Intronic
1159631481 18:70753533-70753555 TCCATGTCTACAATATTGTATGG - Intergenic
1162857926 19:13483319-13483341 CCCAAGTCTGCAGTAGCTTAAGG - Intronic
1165845191 19:38813382-38813404 ACCACGTATGTTGTATTGTAGGG + Intergenic
1168421980 19:56210353-56210375 CCCACCACTGGAGTATTGTGGGG + Intergenic
933894594 2:86799320-86799342 CCCACCTCTGGAGCATAGTAAGG - Intronic
936638070 2:114281953-114281975 CCCACGTCTACGGTCTTGCATGG - Intergenic
943928574 2:193820079-193820101 CCCAGGTCTGCAGCAGTGTCTGG + Intergenic
1171014754 20:21530165-21530187 TCCACGTCTGCAGAACTGGAAGG + Intergenic
1174564932 20:51457754-51457776 CCCAGGTCTGCAGTTTTACAAGG + Intronic
1179974872 21:44859008-44859030 CTCACGTCTGGAGGAGTGTAGGG - Intronic
952577679 3:34794604-34794626 CCCACTTCTCCAGTCTTGTCTGG - Intergenic
953856040 3:46499767-46499789 CCCTGGTCTGCGGTATTGCAGGG - Intronic
969740623 4:9023276-9023298 CCCAGGTCTGTATTATTCTACGG - Intergenic
983410678 4:167393607-167393629 CCCAGGTTAGCAGTAGTGTATGG - Intergenic
985704443 5:1392358-1392380 CCCACGTCTGCACTCCTGCAGGG - Intergenic
986242396 5:5972813-5972835 CCCACCTCTGCACCATTGCAGGG + Intergenic
987814731 5:22885254-22885276 CCACCATCTGTAGTATTGTATGG + Intergenic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
1008517465 6:52331770-52331792 CCCAATTCTGCAGTATGGGAAGG - Intergenic
1011094191 6:83640322-83640344 CCCACATCCACAGCATTGTATGG + Intronic
1022486257 7:30780230-30780252 CCTCCGTCTGCTGTATTCTAAGG + Intronic
1024200034 7:47097203-47097225 CCCAGGTCTCCAGTATTCTAAGG + Intergenic
1055286910 9:74738640-74738662 CCCACTTTTGCTGTATTGTGGGG - Intronic
1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG + Intergenic
1059437162 9:114283867-114283889 CCCACATCTTCAGTATTCCAGGG - Intronic
1060831580 9:126721034-126721056 CTCTCTTCTGCATTATTGTAAGG - Intergenic
1061672434 9:132196530-132196552 TCCACCACTGCAGTATTATACGG + Intronic
1194755721 X:97736816-97736838 CCCACATTTAGAGTATTGTAAGG + Intergenic
1194852068 X:98881694-98881716 CCCTCTTCTGCAGGGTTGTAGGG - Intergenic
1197938934 X:131768335-131768357 CGCACGATGGCAGTATTGTACGG + Intergenic