ID: 900104522

View in Genome Browser
Species Human (GRCh38)
Location 1:976670-976692
Sequence GGCCCCGCACACGCCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 287}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900104515_900104522 23 Left 900104515 1:976624-976646 CCTAGGACAGAAGCTCACCTTCA 0: 1
1: 0
2: 1
3: 13
4: 189
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104519_900104522 -2 Left 900104519 1:976649-976671 CCCACGGCTGCACTCAGAGATGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104521_900104522 -3 Left 900104521 1:976650-976672 CCACGGCTGCACTCAGAGATGGC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104514_900104522 24 Left 900104514 1:976623-976645 CCCTAGGACAGAAGCTCACCTTC 0: 1
1: 0
2: 0
3: 20
4: 130
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104517_900104522 6 Left 900104517 1:976641-976663 CCTTCAGCCCCACGGCTGCACTC 0: 1
1: 0
2: 0
3: 19
4: 277
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104513_900104522 25 Left 900104513 1:976622-976644 CCCCTAGGACAGAAGCTCACCTT 0: 1
1: 0
2: 0
3: 11
4: 148
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104518_900104522 -1 Left 900104518 1:976648-976670 CCCCACGGCTGCACTCAGAGATG 0: 1
1: 0
2: 0
3: 17
4: 147
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900104522 Original CRISPR GGCCCCGCACACGCCCGCCC CGG Intronic
900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG + Intronic
900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG + Intronic
900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG + Intronic
900109561 1:999836-999858 CGCCCCCCTCACGCCCGGCCGGG + Exonic
900148675 1:1168960-1168982 GGCCCCGCAGACACCAGCCCAGG + Intergenic
900345557 1:2208714-2208736 GGCCCCTCCCAAGCCTGCCCAGG - Intronic
900503658 1:3018583-3018605 GCCCCCGCCCCCGCCCTCCCCGG - Intergenic
900564792 1:3326959-3326981 GGGCCCCCAGACGCCTGCCCTGG + Intronic
900998193 1:6134098-6134120 GCCCCTGCCCACCCCCGCCCCGG - Intronic
901019105 1:6246941-6246963 GTCCCCCCGCGCGCCCGCCCTGG - Intergenic
901506690 1:9689734-9689756 GACCCCGCAGACGCCCGCACAGG - Intronic
901641323 1:10694538-10694560 GGCCCGGCCCGCGCCGGCCCCGG + Intronic
901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG + Intronic
902366087 1:15975564-15975586 AGCCCCGCTCCCTCCCGCCCCGG + Intronic
902379858 1:16047883-16047905 GGCCCTGCCCACCCCCGCCAAGG + Exonic
902808895 1:18877317-18877339 CTCCCCGCACACCCCAGCCCCGG + Intronic
903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG + Intergenic
903467153 1:23559577-23559599 GGCCCTGCCCCCGCCGGCCCTGG + Exonic
903596992 1:24502748-24502770 GCCCCCGCGCGCCCCCGCCCCGG + Intronic
904384947 1:30135017-30135039 GCCCCCGCACCCGCCTCCCCTGG - Intergenic
904613243 1:31736561-31736583 GGCCCTGCTCACCCCAGCCCAGG + Exonic
908460906 1:64347742-64347764 GGCCTATCACACGCCTGCCCTGG - Intergenic
910571133 1:88704736-88704758 GCCCCTGCACACTCCAGCCCAGG + Intronic
913549987 1:119907766-119907788 GGTCCCGCACACACCACCCCTGG - Intergenic
914195273 1:145445284-145445306 GGCCACGCACAGGCCAGCCATGG + Intergenic
914758452 1:150579756-150579778 GGCCCCGCCCCGGCCCGGCCGGG - Intergenic
916792592 1:168136957-168136979 CGCCCCCCCCACGCCCGGCCGGG + Intronic
916890135 1:169106195-169106217 GGCCCCGAACCCGCCCTCTCGGG + Intronic
918450102 1:184649731-184649753 GGCCCCGGCCCAGCCCGCCCAGG - Intergenic
918511135 1:185316248-185316270 GCACCCGCACACCCCCGCCCCGG + Intronic
920522161 1:206635725-206635747 GGCCCCGCATCCTTCCGCCCAGG - Exonic
920528738 1:206686153-206686175 GCCCCCTCCCACGCCCGCGCGGG + Intronic
922526654 1:226309290-226309312 GGCTCCGCCCGCGCCTGCCCGGG + Exonic
922602873 1:226870554-226870576 GCCCCGCCCCACGCCCGCCCAGG - Exonic
923684153 1:236142422-236142444 GGCCCCGCGCGCCCCCGCCCCGG - Intergenic
924482785 1:244451929-244451951 GGCCCCGCCCCCGCCCCGCCGGG + Exonic
1065186313 10:23173748-23173770 GGCCCCGCGCGCCCCCTCCCGGG - Intergenic
1065239954 10:23695075-23695097 GGCCCCCGGCACGCTCGCCCGGG + Intronic
1069158192 10:65054415-65054437 GGCCCAGGACGCGCCCGCGCTGG + Intergenic
1070305038 10:75234799-75234821 GGCCCCTCCCAGGCCGGCCCGGG + Intronic
1075424110 10:122328221-122328243 GGCACCGCACCCACCAGCCCCGG + Intronic
1075748356 10:124743680-124743702 GTCCCCGCGCCCGCCCGCCCTGG + Intronic
1076321910 10:129589343-129589365 GGCCTGGCACACGCCCTGCCAGG + Intronic
1076993758 11:288873-288895 GGCCCCACCCACAGCCGCCCCGG + Intergenic
1077014154 11:392604-392626 TGCCCCGCACGCGCCGGGCCAGG + Intronic
1077038518 11:507055-507077 GGCCTCGCCCACGCCGGCCTTGG - Intronic
1077112234 11:866860-866882 GGCCCCTCCCACCCCTGCCCTGG - Exonic
1077183916 11:1228182-1228204 GGCCCCGCAGCCGGCAGCCCTGG + Intronic
1077495423 11:2884634-2884656 GGCCCCGCCCCGGCCCGGCCCGG - Intronic
1077495428 11:2884644-2884666 AGCCCCGCACGGCCCCGCCCCGG - Intronic
1077610742 11:3641998-3642020 GGCCCCGCCCACGCCCCGCCGGG - Exonic
1078023550 11:7673838-7673860 AGACCCGGACACGCACGCCCGGG + Exonic
1078023659 11:7674253-7674275 CACCCCGCAAACACCCGCCCCGG - Intronic
1078355398 11:10628582-10628604 GGCCCAGCAAATGCCCCCCCTGG + Intronic
1078801150 11:14644627-14644649 GGCCCCGCACACGCCCCCGGAGG + Exonic
1081705609 11:45180752-45180774 GAGCCCGCCCGCGCCCGCCCCGG + Intronic
1081807150 11:45896846-45896868 GGCCCCGCAGCCCCCCGGCCGGG + Intronic
1083274189 11:61587681-61587703 GCGCCCGCAAACGCCCGGCCTGG + Intergenic
1083560626 11:63670918-63670940 GGCCCCGCCGAGCCCCGCCCTGG - Intronic
1083572663 11:63768646-63768668 GGCCCCGCGCCCCGCCGCCCCGG - Exonic
1084028500 11:66467203-66467225 GGCCCCGCACGCCCCGGGCCCGG - Intronic
1084295783 11:68213002-68213024 GGCCCCGGCCCCACCCGCCCTGG + Intronic
1084473691 11:69377095-69377117 GGGAACGCACACGCCCACCCAGG + Intergenic
1084816342 11:71649122-71649144 GGCCCTGCACATGCCCTCCCAGG - Intergenic
1088094089 11:106077748-106077770 GGCCCAGCGCACGCCCTCCATGG - Exonic
1089073589 11:115719403-115719425 TGCCCCGCACCTGCCCTCCCTGG + Intergenic
1089525550 11:119094598-119094620 GGCGCCGCACCTGCCCGCCTCGG - Exonic
1089729510 11:120511632-120511654 GGCCCCGCGCACGGCCGGCCGGG - Intergenic
1091558625 12:1594285-1594307 GGCCCGGCCCTCCCCCGCCCCGG + Intronic
1094536082 12:31324164-31324186 GGCCCCGCGCCAGCCCGGCCCGG + Intronic
1096004329 12:48157055-48157077 GGCCCCGCCCCCTCCCGCCCCGG + Intronic
1096106229 12:48998301-48998323 GGCCCCGCCCACGCCGACCCTGG + Exonic
1096674888 12:53221113-53221135 GGCCCCGCCCCACCCCGCCCAGG + Intronic
1096870344 12:54588673-54588695 GGCTCCGCACCCGCCCCTCCCGG + Intergenic
1096983606 12:55743114-55743136 GCCCCCCCAGCCGCCCGCCCCGG + Intergenic
1097236834 12:57546413-57546435 GGCCCCGTACACCACCACCCTGG + Intronic
1100565324 12:95789848-95789870 GCCCCAGCCCACGCGCGCCCAGG + Intronic
1101674336 12:106903757-106903779 GGCCCCGCCCACCCCCACGCCGG - Intergenic
1103412811 12:120724902-120724924 GGCACCACCCACGCCCTCCCAGG - Intergenic
1104689480 12:130814515-130814537 GGGCCTGCACACTCCTGCCCAGG - Intronic
1104872713 12:132011833-132011855 GGCCACGCACTCGCAGGCCCAGG + Intronic
1107078288 13:36346700-36346722 GGCCCCGCGCAGACCCCCCCAGG + Exonic
1108541682 13:51452321-51452343 GGTCCCCGACACCCCCGCCCCGG + Intronic
1110436309 13:75481540-75481562 CGCCCCGCAGCCGCCCGCCTCGG + Exonic
1110860512 13:80341031-80341053 GCCCCCGCGCCCGCCCGGCCCGG - Intergenic
1113655915 13:112067735-112067757 GCCCCCGCCGCCGCCCGCCCCGG - Exonic
1113872220 13:113566255-113566277 AGCCCCGCTGTCGCCCGCCCCGG - Intergenic
1118033265 14:61838969-61838991 GGCCCCCCACCCCCCCGCCATGG + Intergenic
1118809233 14:69261256-69261278 GGCTCCGCACGCCCCCGCCCGGG - Intronic
1122183429 14:99971777-99971799 GCCCGCGCACACGCCGGCCCGGG + Intronic
1122995594 14:105262139-105262161 GGCCCCGCACATGCCTGGACGGG + Intronic
1123036700 14:105474656-105474678 TGCCCCGCACCCGCCACCCCCGG + Intronic
1124250629 15:28104585-28104607 GGCCCCTGACAGGCCTGCCCTGG - Intergenic
1125756685 15:42069852-42069874 GGCCCCTCAGAGGCCTGCCCTGG - Intronic
1127293663 15:57591855-57591877 GGCCCCGCCCCGGCCCGGCCCGG + Intergenic
1128605384 15:69033069-69033091 CCCCCCGCCCACGCCCGCGCCGG + Exonic
1128782981 15:70375189-70375211 CTCCCCGCACACGCCCCTCCCGG + Intergenic
1131215187 15:90530211-90530233 GCCCCCGCCCGCGCCGGCCCGGG - Intronic
1132482307 16:172740-172762 GGCCCCGCGCAGGCCCCGCCCGG + Intergenic
1132483155 16:176544-176566 GGCCCCGCGCAGGCCCCGCCCGG + Intergenic
1132508746 16:325949-325971 GGCCACGAAAAGGCCCGCCCTGG + Intronic
1132522232 16:397138-397160 AGACCCGCCCCCGCCCGCCCGGG - Intronic
1132591141 16:726986-727008 GCCCCCGCCCCCGCCCGGCCCGG - Intronic
1132618565 16:854010-854032 GGACCTGGACACGCCCGGCCAGG - Exonic
1132629143 16:908486-908508 GGCCCCGAGCACACCCGACCAGG + Intronic
1132848973 16:2015659-2015681 GGCCCCGAACAGGAACGCCCTGG - Intronic
1132915101 16:2340003-2340025 GGCGCAGCAAACGCCCGCCGCGG + Intronic
1132935008 16:2475604-2475626 GGCCCCGCCCCGCCCCGCCCAGG + Intronic
1135296476 16:21283759-21283781 GGCTCCCCACACTCCCACCCCGG + Intronic
1135325067 16:21520719-21520741 GGCCCCGCCCAGGCGCACCCGGG - Intergenic
1135479845 16:22813773-22813795 TGACCCGCACACGCACGCACAGG - Intergenic
1135521626 16:23182654-23182676 GGCCCCGCCCCCACCTGCCCAGG - Intergenic
1136336550 16:29613987-29614009 GGCCCCGCCCAGGCGCACCCGGG - Intergenic
1136428208 16:30183229-30183251 GGCCCCGCAGACGCGAGCGCAGG - Intronic
1137029304 16:35506955-35506977 CGCCCCGCATCCCCCCGCCCTGG - Intergenic
1137426395 16:48384873-48384895 GGCCCGGCCCCCGCGCGCCCGGG - Intronic
1137618249 16:49859002-49859024 GGCCCCCAGCTCGCCCGCCCAGG + Intergenic
1138686998 16:58734338-58734360 GGCCCAGCACGCGGCCGCTCTGG - Exonic
1139575929 16:67842223-67842245 GAATCCGCACACACCCGCCCCGG + Exonic
1140408077 16:74724281-74724303 GGCCCCGCACACCACCCCACTGG + Intronic
1141788481 16:86217275-86217297 AACCCAGCACACGCCCCCCCAGG - Intergenic
1142283369 16:89160816-89160838 GTCCCCGCACCAGCCCGCCCTGG + Intergenic
1142378785 16:89720681-89720703 GGCCCCGTCCTCGCCCTCCCCGG + Intronic
1142431084 16:90027750-90027772 GTGCCCGCCCACGCCCACCCGGG - Intronic
1142637724 17:1268411-1268433 GCCCCCGCCCGCCCCCGCCCGGG + Intergenic
1142712786 17:1732509-1732531 GCCCCCGCCCCAGCCCGCCCTGG - Intronic
1142852593 17:2711493-2711515 AGTCCCGAACCCGCCCGCCCTGG + Intronic
1143030476 17:3964486-3964508 GGCCCCGCGCCGCCCCGCCCCGG - Intergenic
1144847050 17:18225563-18225585 GGCCCCGCGCGCCCGCGCCCGGG + Intergenic
1144854112 17:18258600-18258622 GGCCCGGCACGCGCCCGGCCCGG + Intronic
1145950320 17:28812289-28812311 AGCCCAGCTCACCCCCGCCCCGG + Intronic
1147184449 17:38705775-38705797 CGCCCCGCGCACGCCGCCCCCGG - Intronic
1147617160 17:41836276-41836298 GGCCCCACCAACCCCCGCCCGGG - Intronic
1148040398 17:44702204-44702226 CGCCCCCCACCCCCCCGCCCCGG - Intergenic
1149486439 17:57046337-57046359 GGCCACGAACACCCCCGCCCCGG + Intergenic
1151494511 17:74451382-74451404 GGCCCTGCTTACTCCCGCCCGGG + Intronic
1152466927 17:80471740-80471762 GGCCCAGCACCAGCACGCCCTGG + Exonic
1152573703 17:81131213-81131235 AGCCCCGCTCATGCCCGGCCCGG - Intronic
1152593992 17:81229388-81229410 GGCCCCACAGCCGCCCTCCCAGG - Exonic
1152720696 17:81922569-81922591 GGCCCCGCAAAGACCCGCCTGGG + Exonic
1152809589 17:82375299-82375321 GGCCCCGCACGCGGCCGCGCAGG - Exonic
1152891248 17:82882861-82882883 GGCGCCTCACACACACGCCCCGG + Intronic
1152997922 18:425452-425474 GGCCCAGCACACTCCCCTCCTGG - Intronic
1154214738 18:12407893-12407915 GGCCCCGCCCACGCCGCGCCCGG + Exonic
1155570347 18:27185377-27185399 GCCCCCGCCCCCGCCCGCCCGGG + Intergenic
1155877067 18:31101516-31101538 GCCCCGGCGCACTCCCGCCCCGG + Intronic
1155877073 18:31101532-31101554 GCCCCGGCGCACTCCCGCCCCGG + Intronic
1157464089 18:47930201-47930223 GGCCCCGAACCCGCACGCCCGGG + Intronic
1158718362 18:59900264-59900286 GGCCCCGACCCCGCCCGGCCTGG - Intronic
1160155620 18:76431954-76431976 GGCCCCGCCCACCACTGCCCTGG + Intronic
1160781655 19:880183-880205 GGCCCAGGACACGCCCGCCGGGG + Intronic
1160796019 19:945760-945782 GGGCCAGAACACGCCTGCCCCGG - Intronic
1160824134 19:1071526-1071548 GTCCCCGCACACCCCCTACCCGG - Intronic
1160833077 19:1112326-1112348 GGCCCCGCCCCCGCCTGGCCGGG - Intronic
1160862187 19:1242079-1242101 GCCCCCGGACCCGCGCGCCCCGG + Intronic
1161207221 19:3047333-3047355 GGACCCGAGCACGCCCCCCCAGG + Intronic
1161210440 19:3062650-3062672 GGCCCGGCCCGCCCCCGCCCCGG + Intronic
1161354842 19:3813331-3813353 GGCCCCTCACCCACCCTCCCAGG + Intronic
1161401171 19:4066696-4066718 GGCCCCGGCCCCGCGCGCCCCGG - Exonic
1161951891 19:7472071-7472093 GGACCGGCACACGCCGGCTCAGG - Exonic
1162430453 19:10625430-10625452 AGCCCCGCCCGCGCCCTCCCGGG + Exonic
1163273593 19:16268829-16268851 GGCCCCCCACCCGCCCACACTGG + Intergenic
1163597078 19:18226388-18226410 GGGCCCCCCCGCGCCCGCCCCGG - Intronic
1163607274 19:18281990-18282012 GCCCCCGCCCCCGCCCGGCCGGG - Intergenic
1163698930 19:18777575-18777597 GTCCACCCACCCGCCCGCCCAGG + Exonic
1164051275 19:21587135-21587157 GGCCCCCCACACGCCCTTCCTGG + Intergenic
1165296127 19:34927245-34927267 GCTCCCGCACTCGCCGGCCCGGG - Exonic
1165419501 19:35715953-35715975 GGCCCCGCACAGCTCAGCCCTGG + Exonic
1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG + Intergenic
1166380503 19:42353012-42353034 GCCCCCTCCCACACCCGCCCCGG + Exonic
1166733926 19:45073595-45073617 GCCACCGCACCCGGCCGCCCAGG + Intronic
1166869777 19:45864265-45864287 ACCCCCGCCCTCGCCCGCCCCGG - Exonic
1168172114 19:54595969-54595991 GGCTCCGCACAGGCCCTGCCAGG + Intronic
1168176835 19:54632794-54632816 GGCTCCGCACAGGCCCTGCCGGG + Intronic
1168290179 19:55353823-55353845 AGCCCTGCACACGCCTGGCCCGG + Intronic
1168349818 19:55669354-55669376 GGCCCCTCACATGCCCCCCCAGG - Intronic
1168720978 19:58554938-58554960 TGCCGCCCGCACGCCCGCCCGGG + Intronic
927256351 2:21043850-21043872 GGCCGCGCACTCACCGGCCCTGG + Exonic
927481045 2:23454216-23454238 GGCCCCTGACCCTCCCGCCCCGG + Intronic
927978253 2:27356704-27356726 GGCCCCCCACACACCCGCTGCGG + Intronic
932307840 2:70716456-70716478 TGCCCCCTACACCCCCGCCCTGG + Intronic
934761104 2:96857692-96857714 GGCCCCGCACGAGCTCGGCCAGG - Intronic
935301704 2:101698270-101698292 CGCCCCGCACCAGCCCGCACAGG - Intronic
936561296 2:113541826-113541848 CGCCCTGCACCCGCCCGCCTGGG - Intergenic
937221741 2:120346063-120346085 GCCCGCGCCCGCGCCCGCCCGGG - Intergenic
937306114 2:120872033-120872055 GGCCCCTCACCCGCCTGCACAGG - Intronic
941905485 2:170714358-170714380 GGCCCCCCACAGCCCAGCCCGGG + Exonic
942868048 2:180699600-180699622 GGGCCCGCACATGGCTGCCCAGG - Intergenic
945879605 2:215312204-215312226 GGCCCCCCACGCTCCCGCCTTGG + Intronic
946231201 2:218292256-218292278 GGCCGCCCACCCGCGCGCCCAGG + Intronic
946351854 2:219160566-219160588 GGCCCCGCCCACCCCTCCCCCGG + Intronic
948272922 2:236687814-236687836 GGCACCGCACTGGCCTGCCCTGG - Intergenic
948301354 2:236909548-236909570 GGCCCCACACATGCCTGCCGCGG - Intergenic
948729017 2:239951897-239951919 GGCCCTGCTGACGCCTGCCCAGG + Intronic
948763698 2:240208737-240208759 GGCTCCGCACATGCCTGCCCTGG + Intergenic
949022706 2:241750392-241750414 GACCCCCCACCCGCCCGCCCGGG - Intronic
1170524770 20:17226855-17226877 GCCCCCGCCCACCCCCGGCCCGG - Intronic
1170524784 20:17226882-17226904 GGCCCCGCCCTGGGCCGCCCCGG - Intronic
1172118707 20:32585480-32585502 GGCCCAGCCCCCGCCCGGCCCGG + Intronic
1172468517 20:35174657-35174679 GCCCCCTCCCACGCCGGCCCAGG + Intronic
1173495546 20:43514934-43514956 GGCTCCGCCCACGCCCCCTCAGG - Intronic
1173793584 20:45843513-45843535 GGCCCCACACTCACCGGCCCAGG + Exonic
1173880306 20:46406636-46406658 CGCCCCGCACAGGCCGGGCCCGG + Intronic
1173980610 20:47221138-47221160 GGTCCCACACACGCCGGCCCAGG + Intronic
1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG + Intronic
1175439633 20:58981530-58981552 CGCCCCGCCCCCGCCCGCCCGGG + Intronic
1175913485 20:62415309-62415331 GGCCACGCATGCCCCCGCCCAGG - Intronic
1176380723 21:6111071-6111093 GGCCCCGCCCCGGCCCGCCCCGG - Intergenic
1177871036 21:26573093-26573115 GGCCCGGGACGCGCCCGGCCCGG - Exonic
1178840734 21:36135701-36135723 GGCCGCGCACAGGCCCTCACAGG - Intronic
1179457310 21:41508246-41508268 GCCCCCGCCCCCGCCCGCCCAGG - Intronic
1179742749 21:43427169-43427191 GGCCCCGCCCCGGCCCGCCCCGG + Intergenic
1180699689 22:17774510-17774532 GGGCCCGCCCCGGCCCGCCCCGG + Intronic
1182352704 22:29707709-29707731 GGCCCAGCACCCTCCTGCCCTGG - Intergenic
1183185968 22:36291861-36291883 GGCCCCGCACGGCCCCTCCCCGG + Intronic
1183293998 22:37019386-37019408 CGCCCCGCACTCACTCGCCCCGG + Exonic
1183649163 22:39144503-39144525 TGGCCCGCTCAGGCCCGCCCGGG + Intronic
1183649451 22:39145663-39145685 GGCCGCGCGCACGCACGCACGGG + Intronic
1184453692 22:44597453-44597475 GGCCCCGCACCAGCCCCCTCTGG + Intergenic
1184458859 22:44626043-44626065 GCCCCCACACACCCCCGGCCGGG + Intergenic
1184523108 22:45007438-45007460 GCCCCCGCGCGCCCCCGCCCGGG - Intronic
1185042702 22:48513624-48513646 GGGGCCGCACAGGCCTGCCCAGG - Intronic
1185247454 22:49780724-49780746 GGCCCTGCCAACTCCCGCCCTGG + Intronic
1185285103 22:49996568-49996590 GGCCTCCCGCACGCCCACCCTGG - Exonic
1185388389 22:50546880-50546902 GGCCCCGCGCCCGCCTGCCAGGG - Intergenic
950703483 3:14766222-14766244 CGCCCCGCACAGGGCTGCCCTGG - Intronic
951217726 3:20040497-20040519 TGCCCCGCAGCCGCCCGGCCCGG - Exonic
956605006 3:71065077-71065099 CGCCCCGCGCCCGCGCGCCCCGG + Intronic
961202354 3:125055436-125055458 GGTCCCGCACACGCCGGGCGAGG + Intronic
961574387 3:127822995-127823017 GGTCCCGGACACGCCCGGCGTGG - Intronic
961649063 3:128408460-128408482 GCCCCTGCACACTCCCACCCAGG + Exonic
962498480 3:135965943-135965965 GGTCCCGGCCCCGCCCGCCCCGG - Intronic
962940803 3:140123160-140123182 CGCCCCCCACCCCCCCGCCCTGG - Intronic
963091392 3:141486915-141486937 GGCCCCGCCCCCGCCCCCCCCGG - Intergenic
968230445 3:197002459-197002481 GGCCCCGCACCCGCTGGGCCTGG - Exonic
968514250 4:1009775-1009797 GGCCCCGCCCCCGCCCGGCCAGG + Intergenic
968612252 4:1562650-1562672 CGCCCGGCCCACGCCAGCCCTGG - Intergenic
968653425 4:1768841-1768863 GGCCCCCCACAGGCCTGCCTGGG - Intergenic
968884243 4:3318759-3318781 AGCCCCGCACACTCCCACACTGG - Intronic
968907937 4:3463222-3463244 AGCCCCGCCCGCGCCGGCCCTGG + Intergenic
969418212 4:7074772-7074794 GGCCCCGGCCACACCCGTCCTGG - Intergenic
970319707 4:14863053-14863075 GCCCCCGCACGCGCCGCCCCAGG + Intergenic
974752017 4:66154104-66154126 GGCCCCCCACACCCCCATCCTGG + Intergenic
979205544 4:118033557-118033579 CGGCCCGCGCGCGCCCGCCCCGG - Intergenic
982370322 4:154626872-154626894 GGCTCCGCACACCCCCTACCGGG - Intergenic
982583200 4:157204897-157204919 GGCCCCGCACACACACGGGCTGG - Intronic
982712189 4:158768888-158768910 GGCCCGGCGGCCGCCCGCCCCGG - Intergenic
983620703 4:169758053-169758075 GGCCCCGCCCACTCCCGTGCTGG + Intergenic
983919779 4:173333728-173333750 AGCCCCGCCAGCGCCCGCCCTGG - Intronic
985520997 5:373841-373863 GCTCCCGCCCCCGCCCGCCCGGG - Intronic
985689760 5:1300640-1300662 GGCTCCACAGACCCCCGCCCTGG - Intergenic
992105891 5:73448595-73448617 GGCTCCGCTCGCGCCCGGCCCGG + Intergenic
993125933 5:83835625-83835647 GGCTCCGCACACTCCAGCCTAGG + Intergenic
1002043227 5:176529005-176529027 GGCCACGCAGCCGCCTGCCCGGG - Exonic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1002926851 6:1610014-1610036 GGCCCCCCCCCCCCCCGCCCTGG + Exonic
1004193771 6:13486861-13486883 GGTGCCGAACACGCCCACCCCGG + Exonic
1004262069 6:14117540-14117562 GTCCCCGCCCCCGCGCGCCCGGG - Intronic
1005847349 6:29792297-29792319 GACCCCGCACTCACCTGCCCAGG - Intergenic
1005851707 6:29827909-29827931 GACCCCGCACTCACCCGCCCAGG - Exonic
1005864245 6:29926522-29926544 GATCCCGCACTCACCCGCCCAGG - Intergenic
1005866644 6:29942618-29942640 GACCCCGCACTCACCCGCCCAGG - Exonic
1005875313 6:30006661-30006683 GACCCCGCACTCACCCGCCCAGG - Intergenic
1005905550 6:30259689-30259711 GACCCCGCACTCACCGGCCCAGG - Intergenic
1005931676 6:30489587-30489609 GACCCCGCACTCACCCGCCCAGG - Exonic
1006066043 6:31463271-31463293 GACCCCGCACTCACCTGCCCAGG - Intergenic
1006369231 6:33633847-33633869 GGCCCCGCCCCGGCCCGGCCCGG - Intronic
1008910857 6:56731084-56731106 TGCCCTGCACACCCCAGCCCTGG - Intronic
1011610645 6:89146715-89146737 GGTCCCACACACACCTGCCCCGG - Intronic
1013308690 6:108873420-108873442 GGCCCTGCTCACGCCTGTCCTGG + Intronic
1013395923 6:109739676-109739698 GGCCCCACTCAGGCCAGCCCTGG + Intronic
1017282196 6:152637074-152637096 GGCCCGCCACACCCCCTCCCCGG + Intronic
1018180380 6:161217860-161217882 GGCCCTGCACACACCAGCTCTGG + Intronic
1019351689 7:557037-557059 GGCCCCTCCCACCCCCGGCCTGG + Intronic
1019442657 7:1055301-1055323 GGGCCCTCACACGCACGCGCAGG + Exonic
1020016528 7:4834921-4834943 GGCCCAGCCCCTGCCCGCCCGGG - Exonic
1020085346 7:5307467-5307489 GGCCCGGCACAGGCCCACCCTGG - Exonic
1020204737 7:6105416-6105438 CGGCCAGCACACGCCCACCCCGG - Intronic
1023842397 7:44104664-44104686 CGCCCCGCGCACGGCCGCCATGG - Exonic
1024394273 7:48848120-48848142 GGCCCCGCGCGCGCCCGCCGAGG + Intergenic
1025208975 7:57009821-57009843 GGCCCGGCACAGGCCCACCCTGG + Intergenic
1025662975 7:63567035-63567057 GGCCCGGCACAGGCCCACCCTGG - Intergenic
1026850373 7:73719744-73719766 GGCCCCGCCCCACCCCGCCCGGG + Intergenic
1026973021 7:74479375-74479397 GGCCCCGCTCAGGCCCGACCAGG + Intronic
1029073624 7:97919551-97919573 GGCCGTGCACATGCCCTCCCAGG + Intergenic
1030114134 7:106050375-106050397 GGCCCAGCTCACCCCCACCCAGG + Intergenic
1030176605 7:106660833-106660855 CGCCCCGGCCACGGCCGCCCGGG - Exonic
1031011177 7:116526203-116526225 GCCCCCGCCCGCGCACGCCCCGG - Intronic
1032391292 7:131556725-131556747 GGCCCCGGCCCCGCCCGGCCCGG - Intronic
1034412300 7:150947821-150947843 GGCCCTGCCCCCGCCCGGCCCGG + Exonic
1035069300 7:156129657-156129679 GCCCGAGCACACGCACGCCCTGG + Intergenic
1035443899 7:158926476-158926498 GGCCCCGCATGTGCCCGGCCTGG - Intronic
1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG + Intronic
1035752110 8:2003089-2003111 GGCCCCGCAAACCCCTGCCGAGG - Exonic
1035758498 8:2051754-2051776 TACCCCGCACATGCCCGCCCTGG - Intronic
1036033362 8:4994646-4994668 GGCCCCGGCCCCGCCAGCCCGGG - Exonic
1036244070 8:7101715-7101737 GGCCATGCACATGCCCTCCCAGG - Intergenic
1036256724 8:7212330-7212352 GGCCGTGCACATGCCCTCCCAGG + Intergenic
1036308774 8:7670932-7670954 GGCCGTGCACATGCCCTCCCAGG + Intergenic
1036360767 8:8075179-8075201 GGCCGTGCACATGCCCTCCCAGG - Intergenic
1036890200 8:12591793-12591815 GGCCGTGCACATGCCCTCCCAGG + Intergenic
1037815636 8:22110196-22110218 GGCCCCACCCCCGCCCTCCCAGG - Intergenic
1038633032 8:29263209-29263231 GGCCCCGCCCACGACGACCCTGG - Intergenic
1041012463 8:53558563-53558585 GCCCCCTCACACTCCCACCCAGG + Intergenic
1045488621 8:102654214-102654236 GCCCCCGCCCGCGCCCGACCCGG + Intronic
1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG + Intergenic
1047024501 8:120811573-120811595 GCCCCCGGACTCGCCCGCCGGGG - Exonic
1048425533 8:134319693-134319715 GGCCCCTCACACCCTCTCCCTGG - Intergenic
1048865698 8:138760186-138760208 GTCCCCGCACCTGCCTGCCCAGG + Intronic
1049282866 8:141759409-141759431 GCCCCCGCTCACCCCTGCCCCGG - Intergenic
1049583089 8:143421532-143421554 GGCCCCGCAGGCGCCTGGCCCGG - Intronic
1049670933 8:143869560-143869582 GGGCACGCAGTCGCCCGCCCAGG - Exonic
1049716422 8:144095159-144095181 GACCCCGGGCACGCGCGCCCGGG - Exonic
1049747750 8:144270151-144270173 CGCCCCGCACCTGCCCGCTCAGG - Intronic
1049796875 8:144501008-144501030 GGCCCCGCGGACGTCAGCCCCGG + Intronic
1049891392 9:73513-73535 CGCCCTGCACCCGCCCGCCCGGG + Intergenic
1053003383 9:34589914-34589936 GGCCCCGCGCGCCCCCGCCTTGG + Intronic
1054695608 9:68356968-68356990 CGCCCTGCACCCGCCCGCCTGGG - Exonic
1057445730 9:95113095-95113117 GGCCCCCCACACACCCTCCCTGG - Intronic
1058961772 9:109998620-109998642 GGCTCCCCACTCCCCCGCCCTGG - Intronic
1059470933 9:114504715-114504737 GCCCCCGCCGCCGCCCGCCCCGG + Exonic
1060549342 9:124477753-124477775 CGCCCCCCACAGGCCCGCCCAGG + Intronic
1061262616 9:129488473-129488495 GTCCCCACTCCCGCCCGCCCCGG - Intergenic
1061283637 9:129610561-129610583 GGCTCCGCACAGCCCCGCTCCGG - Intronic
1062022651 9:134326671-134326693 GGCCCCGTCCCCGCCCGGCCCGG - Intronic
1062056994 9:134473948-134473970 GGCCCCCCAGGCGCCAGCCCAGG - Intergenic
1062204134 9:135326377-135326399 GGCCCTGGACACGCAGGCCCTGG + Intergenic
1062699394 9:137891066-137891088 GGCCACGCACAGGCCAGCCATGG - Intronic
1188003479 X:25002527-25002549 GGCCGCGCACACTTGCGCCCTGG + Intergenic
1190265786 X:48826653-48826675 GGCCCCTCACTCGGCCGGCCGGG + Intergenic
1196819571 X:119692461-119692483 GGCGCCGCCGCCGCCCGCCCGGG + Intronic
1197223205 X:123932723-123932745 AGCCCCCCACCCCCCCGCCCAGG - Intergenic
1199265546 X:145822172-145822194 GGCCACCCACACACGCGCCCCGG - Exonic
1200092948 X:153644279-153644301 GCCCCCGCACCCGCCCCCGCCGG - Intronic
1200108130 X:153725548-153725570 GGCCCTGCACTCGGCCGCCTTGG + Exonic
1200224850 X:154411788-154411810 GGCGCCCCACAGGCCGGCCCGGG + Exonic