ID: 900104522

View in Genome Browser
Species Human (GRCh38)
Location 1:976670-976692
Sequence GGCCCCGCACACGCCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 287}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900104513_900104522 25 Left 900104513 1:976622-976644 CCCCTAGGACAGAAGCTCACCTT 0: 1
1: 0
2: 0
3: 11
4: 148
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104514_900104522 24 Left 900104514 1:976623-976645 CCCTAGGACAGAAGCTCACCTTC 0: 1
1: 0
2: 0
3: 20
4: 130
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104519_900104522 -2 Left 900104519 1:976649-976671 CCCACGGCTGCACTCAGAGATGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104518_900104522 -1 Left 900104518 1:976648-976670 CCCCACGGCTGCACTCAGAGATG 0: 1
1: 0
2: 0
3: 17
4: 147
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104515_900104522 23 Left 900104515 1:976624-976646 CCTAGGACAGAAGCTCACCTTCA 0: 1
1: 0
2: 1
3: 13
4: 189
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104517_900104522 6 Left 900104517 1:976641-976663 CCTTCAGCCCCACGGCTGCACTC 0: 1
1: 0
2: 0
3: 19
4: 277
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287
900104521_900104522 -3 Left 900104521 1:976650-976672 CCACGGCTGCACTCAGAGATGGC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG 0: 1
1: 1
2: 2
3: 45
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900104522 Original CRISPR GGCCCCGCACACGCCCGCCC CGG Intronic