ID: 900105188

View in Genome Browser
Species Human (GRCh38)
Location 1:978112-978134
Sequence TGCCCCGCACACGGCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 128}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900105171_900105188 19 Left 900105171 1:978070-978092 CCTGCCCCGGGAGCCGCTTCCCC 0: 1
1: 1
2: 5
3: 46
4: 463
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105182_900105188 -9 Left 900105182 1:978098-978120 CCCCGGGAACCACCTGCCCCGCA 0: 1
1: 0
2: 0
3: 18
4: 321
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105174_900105188 13 Left 900105174 1:978076-978098 CCGGGAGCCGCTTCCCCCGCAAC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105172_900105188 15 Left 900105172 1:978074-978096 CCCCGGGAGCCGCTTCCCCCGCA 0: 1
1: 0
2: 2
3: 10
4: 146
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105173_900105188 14 Left 900105173 1:978075-978097 CCCGGGAGCCGCTTCCCCCGCAA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105169_900105188 30 Left 900105169 1:978059-978081 CCCAGGAACTGCCTGCCCCGGGA 0: 1
1: 0
2: 2
3: 20
4: 161
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105180_900105188 -2 Left 900105180 1:978091-978113 CCCGCAACCCCGGGAACCACCTG 0: 1
1: 2
2: 8
3: 42
4: 188
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105170_900105188 29 Left 900105170 1:978060-978082 CCAGGAACTGCCTGCCCCGGGAG 0: 1
1: 0
2: 4
3: 17
4: 253
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105178_900105188 0 Left 900105178 1:978089-978111 CCCCCGCAACCCCGGGAACCACC 0: 1
1: 6
2: 1
3: 45
4: 212
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105183_900105188 -10 Left 900105183 1:978099-978121 CCCGGGAACCACCTGCCCCGCAC 0: 1
1: 0
2: 3
3: 19
4: 291
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105181_900105188 -3 Left 900105181 1:978092-978114 CCGCAACCCCGGGAACCACCTGC 0: 1
1: 2
2: 8
3: 23
4: 248
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105177_900105188 6 Left 900105177 1:978083-978105 CCGCTTCCCCCGCAACCCCGGGA 0: 1
1: 6
2: 2
3: 18
4: 316
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128
900105179_900105188 -1 Left 900105179 1:978090-978112 CCCCGCAACCCCGGGAACCACCT 0: 1
1: 7
2: 1
3: 49
4: 115
Right 900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900105188 Original CRISPR TGCCCCGCACACGGCCGCCC CGG Intronic
900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG + Intronic
900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG + Intronic
900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG + Intronic
900367654 1:2317807-2317829 AGCCCCGCCCACGGCAGCCATGG - Intergenic
900610990 1:3544595-3544617 TGCTCCACACACCGCAGCCCTGG + Intronic
901167823 1:7232276-7232298 TGTGCTGCACACGGCTGCCCCGG + Intronic
902833848 1:19034496-19034518 TGCCCCAAACACGTCTGCCCCGG + Intergenic
903466269 1:23554565-23554587 TGCCCTGCACAGGGCCTTCCCGG - Intergenic
920371502 1:205482052-205482074 TGCCCCAAATACGGCCCCCCGGG - Intergenic
1062836642 10:640250-640272 CGCCCCGCCCACGGCCACCAAGG + Intronic
1072618340 10:97064136-97064158 TGCCCCGCTCCCAGCTGCCCCGG + Intronic
1075743687 10:124711657-124711679 TCCCGCGCACACGGTCTCCCTGG - Intronic
1075796536 10:125123932-125123954 TGCCCAGCACAGAGCTGCCCCGG - Intronic
1076993758 11:288873-288895 GGCCCCACCCACAGCCGCCCCGG + Intergenic
1077014154 11:392604-392626 TGCCCCGCACGCGCCGGGCCAGG + Intronic
1077085468 11:747763-747785 TGCGCCTCTCACGGCCGACCCGG - Intronic
1077183916 11:1228182-1228204 GGCCCCGCAGCCGGCAGCCCTGG + Intronic
1081808349 11:45901913-45901935 TGCCCGGCACAGGGAGGCCCCGG - Intronic
1082986124 11:59172466-59172488 TGCCCCGCGCCCCGCCGCCCCGG - Intronic
1083184096 11:61007635-61007657 CGCCCCGCACGCGGGCTCCCAGG - Exonic
1083263363 11:61535155-61535177 TGCTCCTCACAGGGCTGCCCTGG - Intronic
1083572663 11:63768646-63768668 GGCCCCGCGCCCCGCCGCCCCGG - Exonic
1083689894 11:64401149-64401171 TGCCCCGCAGAGGGCACCCCCGG + Intergenic
1084690242 11:70721026-70721048 TGCCTGGCACACGGAAGCCCGGG - Intronic
1085047509 11:73362246-73362268 TGCCGCCCACCCCGCCGCCCAGG - Intronic
1085477904 11:76799290-76799312 TGCCCTGCACCCCGCAGCCCTGG + Intergenic
1089073589 11:115719403-115719425 TGCCCCGCACCTGCCCTCCCTGG + Intergenic
1089729510 11:120511632-120511654 GGCCCCGCGCACGGCCGGCCGGG - Intergenic
1091718537 12:2795888-2795910 TGCCCCGCGCCCGGCCTCCCCGG - Intronic
1096804797 12:54134088-54134110 AGCCCCGCACAGGGCCTCTCTGG + Intergenic
1097019114 12:56007614-56007636 CCCCCCGCACTGGGCCGCCCGGG + Intergenic
1102496113 12:113320599-113320621 TGACCCGCACACAGCCGGCCTGG - Exonic
1102930215 12:116856349-116856371 TGCCACGCACACGGGCTCCTTGG + Exonic
1103764779 12:123272028-123272050 TGCCCCGCGCCCGGCGCCCCGGG + Exonic
1106033050 13:26019695-26019717 TAGCCTGCACACGGCCGCCACGG + Intronic
1118751557 14:68811377-68811399 TCCCACCCACACAGCCGCCCTGG - Intergenic
1121226146 14:92323293-92323315 CGGCGCGCACTCGGCCGCCCGGG + Intronic
1122542936 14:102508008-102508030 TGCCCCTCACACAGCCCCTCCGG + Intronic
1123030611 14:105449516-105449538 TGCCCTGCGCCCGGCCGGCCCGG + Intronic
1123036700 14:105474656-105474678 TGCCCCGCACCCGCCACCCCCGG + Intronic
1125748847 15:42015097-42015119 TGCCCCAGACACTGCAGCCCAGG - Intronic
1132765763 16:1533457-1533479 TGTCCCGCACCCGGCATCCCTGG + Intronic
1132879521 16:2155840-2155862 TCACCCGCCCGCGGCCGCCCGGG - Exonic
1135479845 16:22813773-22813795 TGACCCGCACACGCACGCACAGG - Intergenic
1136267363 16:29129608-29129630 TCCCCAGCACAGGGCCGTCCTGG - Intergenic
1137769994 16:51008415-51008437 TGCCCCACACACTGTCCCCCTGG - Intergenic
1138686998 16:58734338-58734360 GGCCCAGCACGCGGCCGCTCTGG - Exonic
1142221603 16:88857520-88857542 TTCCCCGCGGACGGCGGCCCCGG + Intronic
1142335878 16:89489802-89489824 TCCGCCTCTCACGGCCGCCCCGG + Intronic
1143103471 17:4516434-4516456 AGCCCAGCACACGGCCTGCCAGG - Intronic
1151854450 17:76710951-76710973 TGGCCCGCACTCGGCGGCCGCGG - Exonic
1152809589 17:82375299-82375321 GGCCCCGCACGCGGCCGCGCAGG - Exonic
1154310345 18:13262359-13262381 TTCCACGCACAGGGCCGCACGGG - Intronic
1154310371 18:13262479-13262501 TTCCACGCACAGGGCCGCACGGG - Intronic
1154310377 18:13262509-13262531 TTCCACGCACAGGGCCGCACGGG - Intronic
1154310394 18:13262599-13262621 TTCCACGCACAGGGCCGCACGGG - Intronic
1154310407 18:13262659-13262681 TTCCACGCACAGGGCCGCACGGG - Intronic
1162588553 19:11576417-11576439 TGGCCCGCACACAGCTGTCCTGG - Exonic
1163334253 19:16660937-16660959 TGCCCCGCACCCCGCCTCGCTGG + Intergenic
1164644065 19:29845097-29845119 CGGCCCGCCCACCGCCGCCCTGG - Intergenic
1164692638 19:30222599-30222621 AGCCCCGCAGACGGCCGGGCAGG - Intergenic
1165348326 19:35262698-35262720 TGTCCCGCTCATGGCCACCCTGG + Intronic
1165996161 19:39845750-39845772 AGCGCCGCACACGGCCAACCGGG + Intronic
1166303039 19:41922836-41922858 TGGCCCGCGCACTGCCGCCGAGG + Intronic
1166733926 19:45073595-45073617 GCCACCGCACCCGGCCGCCCAGG + Intronic
1168330395 19:55564472-55564494 TGCCCGGCTCCCGGCCTCCCTGG - Intergenic
1168336258 19:55599330-55599352 TGCCCCCCAACCGGGCGCCCAGG - Intronic
1168720978 19:58554938-58554960 TGCCGCCCGCACGCCCGCCCGGG + Intronic
926143508 2:10382972-10382994 TGTCCCGCACACCACTGCCCTGG - Intronic
927845850 2:26472617-26472639 TGCACAGCACACGGCAGCGCCGG + Exonic
927985681 2:27409169-27409191 CGCCCCGCAAACGGCCGCTGCGG + Intronic
932307840 2:70716456-70716478 TGCCCCCTACACCCCCGCCCTGG + Intronic
938958414 2:136319637-136319659 TGCCCAGCACACAGCAGACCCGG - Intergenic
942868048 2:180699600-180699622 GGGCCCGCACATGGCTGCCCAGG - Intergenic
948589044 2:239037840-239037862 TGCCCAGCCCACGGGCACCCAGG + Intergenic
948603151 2:239118926-239118948 TGCCCCCCACAGGGCCTCTCAGG - Intronic
948604512 2:239126403-239126425 CGCACAGCACACAGCCGCCCTGG + Intronic
948844689 2:240677451-240677473 TGCCCCTCACTCGGCCCTCCAGG + Intronic
948849171 2:240697428-240697450 TGCCCCTCACTCGGCCCTCCAGG - Intronic
1170524784 20:17226882-17226904 GGCCCCGCCCTGGGCCGCCCCGG - Intronic
1175439633 20:58981530-58981552 CGCCCCGCCCCCGCCCGCCCGGG + Intronic
1175488750 20:59364506-59364528 TGCCTCGCACATGACGGCCCGGG - Intergenic
1176250481 20:64117971-64117993 TGCCCCGCACAGCTTCGCCCAGG - Intergenic
1176425411 21:6545590-6545612 TGGCCCGCTGACAGCCGCCCAGG + Intergenic
1178263865 21:31124523-31124545 TGCCCTGCTCATGGCCGGCCTGG + Exonic
1179700902 21:43153907-43153929 TGGCCCGCTGACAGCCGCCCAGG + Intergenic
1179836349 21:44036430-44036452 TGGCCCCCACACGGCCAGCCGGG - Intronic
1179890000 21:44330606-44330628 TGCCCCGCACGGAGCCGTCCTGG - Exonic
1180852766 22:19029756-19029778 TCGCCCGCGCCCGGCCGCCCCGG - Intergenic
1183649163 22:39144503-39144525 TGGCCCGCTCAGGCCCGCCCGGG + Intronic
1183698110 22:39434605-39434627 TGTCCCTGACGCGGCCGCCCAGG - Intronic
1185413431 22:50697578-50697600 CGCCCCCCGCACCGCCGCCCCGG + Intergenic
950703483 3:14766222-14766244 CGCCCCGCACAGGGCTGCCCTGG - Intronic
951217726 3:20040497-20040519 TGCCCCGCAGCCGCCCGGCCCGG - Exonic
952884699 3:38005334-38005356 TGCCGGGCACACGGCCACCTCGG + Intronic
964438097 3:156674887-156674909 AGCCCCGCACACTGCCGGCGCGG - Exonic
966849351 3:184155298-184155320 CGCCCCGCCCCCGGCCGCCGCGG - Intronic
968073511 3:195802721-195802743 TGCCACGCACACAGACGCGCTGG - Intronic
968137035 3:196227129-196227151 TTCCCCCCACAGGGCAGCCCCGG - Intronic
985040532 4:185887077-185887099 TTCCCCGCAGACAGCTGCCCAGG - Intronic
985988349 5:3535874-3535896 TTCCCCGCAGGCGGCCGCCGTGG - Intergenic
988564871 5:32312829-32312851 TCCCCAGCATACCGCCGCCCTGG + Exonic
992460227 5:76953707-76953729 TGCCCGGCTCGCGGGCGCCCGGG + Intronic
1002644215 5:180645320-180645342 CTCCCAGCACACGGCCGCCGTGG + Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1004664181 6:17735500-17735522 AGCCCCCCACCCAGCCGCCCCGG - Intergenic
1005959761 6:30686715-30686737 TGCCCCGCACTCCGCCCCCGAGG + Exonic
1006113317 6:31761895-31761917 TGCCTCCCACACAGCTGCCCAGG + Exonic
1008910857 6:56731084-56731106 TGCCCTGCACACCCCAGCCCTGG - Intronic
1016992397 6:149939040-149939062 AGCCCCGCACGCAGCTGCCCGGG + Intergenic
1019261131 7:82535-82557 TGCCCCACACGCAGCCGCCTCGG - Intergenic
1019536799 7:1533579-1533601 TGCCCCCCACACAGCCCCACAGG - Intronic
1020105629 7:5421097-5421119 TGCCCGGCCCGCTGCCGCCCGGG - Exonic
1023743645 7:43302598-43302620 TGCCCGGTACGGGGCCGCCCCGG + Intronic
1023842397 7:44104664-44104686 CGCCCCGCGCACGGCCGCCATGG - Exonic
1025561713 7:62379655-62379677 TGCCCCGCCCACGGCGCCGCGGG + Intergenic
1029495684 7:100894707-100894729 TGCCCAGCCCACCGCCCCCCAGG - Intronic
1030176605 7:106660833-106660855 CGCCCCGGCCACGGCCGCCCGGG - Exonic
1034637546 7:152579310-152579332 AACCCAGCAAACGGCCGCCCCGG - Intergenic
1035243555 7:157547893-157547915 TGCCCCTCGCGTGGCCGCCCTGG + Intronic
1035605335 8:926638-926660 TGCCCTGGCCACGGCCGCCCAGG - Intergenic
1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG + Intronic
1035758498 8:2051754-2051776 TACCCCGCACATGCCCGCCCTGG - Intronic
1037671309 8:21017496-21017518 TGCCCAGCAAACGGGCTCCCTGG + Intergenic
1037811661 8:22089985-22090007 CTCCCCGCACAGGGCCACCCAGG - Intronic
1042307116 8:67343617-67343639 TTCCCGGCAGACAGCCGCCCGGG - Exonic
1042485522 8:69341978-69342000 TGCCCCACACCCGGCAGCTCTGG - Intergenic
1045098931 8:98825862-98825884 CGCCCCGCCCCCGGCCGCGCCGG + Intronic
1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG + Intergenic
1049689929 8:143953920-143953942 TGCGCCGGACAGGGCCGCCCCGG + Intronic
1049891392 9:73513-73535 CGCCCTGCACCCGCCCGCCCGGG + Intergenic
1055960784 9:81818282-81818304 TGCCCCTCACACTGCAGCCTGGG - Intergenic
1060142861 9:121225780-121225802 TGCCCAGCACACAGCCTCACAGG + Intronic
1060549342 9:124477753-124477775 CGCCCCCCACAGGCCCGCCCAGG + Intronic
1062041213 9:134405129-134405151 AGCACAGCACAGGGCCGCCCCGG - Intronic
1062041722 9:134407511-134407533 CGGCCCGCACGCTGCCGCCCGGG - Intronic
1062521352 9:136959259-136959281 TGCCCCAAGCACGGCAGCCCAGG + Intergenic
1190265786 X:48826653-48826675 GGCCCCTCACTCGGCCGGCCGGG + Intergenic
1195654713 X:107323804-107323826 TCCCCCGCAGCCTGCCGCCCTGG + Intergenic
1196816296 X:119667652-119667674 TGCCCCTCCCACGGCTGCCCTGG + Intronic
1197720571 X:129742196-129742218 CCCCCCGCGCACGGCCCCCCTGG + Intronic
1197726505 X:129780541-129780563 TGCCCCGGCCACGGCCTCTCAGG + Intronic
1200108130 X:153725548-153725570 GGCCCTGCACTCGGCCGCCTTGG + Exonic