ID: 900105223

View in Genome Browser
Species Human (GRCh38)
Location 1:978214-978236
Sequence TGCCCCGCACACGCCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 2, 2: 1, 3: 15, 4: 221}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900105216_900105223 11 Left 900105216 1:978180-978202 CCTAACCCTGCACACTCTTGGCC 0: 1
1: 0
2: 1
3: 18
4: 226
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105213_900105223 15 Left 900105213 1:978176-978198 CCACCCTAACCCTGCACACTCTT 0: 1
1: 0
2: 2
3: 22
4: 290
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105209_900105223 24 Left 900105209 1:978167-978189 CCGCCTGCCCCACCCTAACCCTG 0: 1
1: 0
2: 12
3: 121
4: 933
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105210_900105223 21 Left 900105210 1:978170-978192 CCTGCCCCACCCTAACCCTGCAC 0: 1
1: 0
2: 4
3: 91
4: 792
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105215_900105223 12 Left 900105215 1:978179-978201 CCCTAACCCTGCACACTCTTGGC 0: 1
1: 0
2: 2
3: 7
4: 136
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105211_900105223 17 Left 900105211 1:978174-978196 CCCCACCCTAACCCTGCACACTC 0: 1
1: 0
2: 2
3: 34
4: 499
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105212_900105223 16 Left 900105212 1:978175-978197 CCCACCCTAACCCTGCACACTCT 0: 1
1: 0
2: 2
3: 28
4: 356
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105220_900105223 5 Left 900105220 1:978186-978208 CCTGCACACTCTTGGCCTGGGAA 0: 1
1: 0
2: 0
3: 17
4: 193
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105221_900105223 -10 Left 900105221 1:978201-978223 CCTGGGAACTGCCTGCCCCGCAC 0: 1
1: 0
2: 3
3: 21
4: 255
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105219_900105223 6 Left 900105219 1:978185-978207 CCCTGCACACTCTTGGCCTGGGA 0: 1
1: 0
2: 3
3: 18
4: 223
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900105223 Original CRISPR TGCCCCGCACACGCCCGCCC CGG Intronic
900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG + Intronic
900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG + Intronic
900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG + Intronic
900109561 1:999836-999858 CGCCCCCCTCACGCCCGGCCGGG + Exonic
900148675 1:1168960-1168982 GGCCCCGCAGACACCAGCCCAGG + Intergenic
900176630 1:1294038-1294060 TGCCCCGACCACGCCTACCCCGG - Intronic
900354933 1:2256485-2256507 TGGCCCTCACCTGCCCGCCCTGG + Intronic
900593096 1:3468516-3468538 TGCCCTCCACACTCCCTCCCTGG + Intronic
900648152 1:3718210-3718232 TGCCCCGCCCCGCCCCGCCCCGG - Intronic
901506690 1:9689734-9689756 GACCCCGCAGACGCCCGCACAGG - Intronic
902366087 1:15975564-15975586 AGCCCCGCTCCCTCCCGCCCCGG + Intronic
902808895 1:18877317-18877339 CTCCCCGCACACCCCAGCCCCGG + Intronic
902833848 1:19034496-19034518 TGCCCCAAACACGTCTGCCCCGG + Intergenic
903015484 1:20358838-20358860 TGCCACACACACCCCTGCCCTGG - Intergenic
903883877 1:26530141-26530163 TCCCTCGCACACGCACACCCGGG - Intronic
904025311 1:27499116-27499138 TGCCCTGCACAAGCCTGGCCAGG - Intergenic
904607085 1:31703992-31704014 TGCCCGGCGCACGCCTGCCGGGG + Exonic
906210814 1:44011350-44011372 TCCCCCGCAGTCGCCTGCCCAGG - Intronic
911072927 1:93846742-93846764 TGCCCCGAGCCCGCGCGCCCGGG - Intronic
912776520 1:112509213-112509235 TGCCCCGTCCACGCCCCTCCGGG + Exonic
916792592 1:168136957-168136979 CGCCCCCCCCACGCCCGGCCGGG + Intronic
918511135 1:185316248-185316270 GCACCCGCACACCCCCGCCCCGG + Intronic
919942455 1:202297698-202297720 TGTCCCCCACCCTCCCGCCCCGG + Intronic
923684153 1:236142422-236142444 GGCCCCGCGCGCCCCCGCCCCGG - Intergenic
924482820 1:244452017-244452039 TGCCCCGCGCAGGCCGGCCTCGG + Exonic
1067220349 10:44339656-44339678 TGCCCAGCACACCCCAGCCAGGG + Intergenic
1067569390 10:47360426-47360448 TGCCCCGCACAGGCCTACACAGG + Intergenic
1067686097 10:48466737-48466759 TGCCCGCCGCCCGCCCGCCCCGG + Intronic
1070111972 10:73495648-73495670 TGCCCAGCAGGGGCCCGCCCAGG + Intronic
1072294192 10:93993856-93993878 TTCCCAGAACTCGCCCGCCCCGG - Intergenic
1074786974 10:116849849-116849871 TCCTCCGCACACGCAGGCCCAGG - Intronic
1075174329 10:120145153-120145175 TCCCCCACACACTCCCACCCAGG - Intergenic
1075748356 10:124743680-124743702 GTCCCCGCGCCCGCCCGCCCTGG + Intronic
1077014154 11:392604-392626 TGCCCCGCACGCGCCGGGCCAGG + Intronic
1077495428 11:2884644-2884666 AGCCCCGCACGGCCCCGCCCCGG - Intronic
1077610742 11:3641998-3642020 GGCCCCGCCCACGCCCCGCCGGG - Exonic
1078023550 11:7673838-7673860 AGACCCGGACACGCACGCCCGGG + Exonic
1078023659 11:7674253-7674275 CACCCCGCAAACACCCGCCCCGG - Intronic
1078801150 11:14644627-14644649 GGCCCCGCACACGCCCCCGGAGG + Exonic
1082986124 11:59172466-59172488 TGCCCCGCGCCCCGCCGCCCCGG - Intronic
1084816342 11:71649122-71649144 GGCCCTGCACATGCCCTCCCAGG - Intergenic
1089073589 11:115719403-115719425 TGCCCCGCACCTGCCCTCCCTGG + Intergenic
1089729510 11:120511632-120511654 GGCCCCGCGCACGGCCGGCCGGG - Intergenic
1091718537 12:2795888-2795910 TGCCCCGCGCCCGGCCTCCCCGG - Intronic
1092065910 12:5589580-5589602 TGCCCAGCACCCCCCCGCCAGGG - Intronic
1092214599 12:6672286-6672308 TGCCCTCCCCACCCCCGCCCCGG - Intronic
1093506193 12:19869589-19869611 TTCCCCACACACCCCCACCCCGG - Intergenic
1096004329 12:48157055-48157077 GGCCCCGCCCCCTCCCGCCCCGG + Intronic
1096106229 12:48998301-48998323 GGCCCCGCCCACGCCGACCCTGG + Exonic
1102496113 12:113320599-113320621 TGACCCGCACACAGCCGGCCTGG - Exonic
1103063567 12:117878260-117878282 TGCCCTGCAAAAGCCAGCCCTGG - Intronic
1104182290 12:126393651-126393673 TGGCCGGCAGACACCCGCCCAGG + Intergenic
1104873970 12:132020102-132020124 TCCCCAGCACTCACCCGCCCCGG + Exonic
1106590762 13:31096790-31096812 TGCCCAGCCCACGCCTGCTCTGG + Intergenic
1108618524 13:52159237-52159259 TGCCCCGCGGGCGCCGGCCCCGG - Intronic
1110436309 13:75481540-75481562 CGCCCCGCAGCCGCCCGCCTCGG + Exonic
1113872220 13:113566255-113566277 AGCCCCGCTGTCGCCCGCCCCGG - Intergenic
1118809233 14:69261256-69261278 GGCTCCGCACGCCCCCGCCCGGG - Intronic
1121013546 14:90535227-90535249 TGCCCCGGCCACACCTGCCCAGG + Exonic
1122183429 14:99971777-99971799 GCCCGCGCACACGCCGGCCCGGG + Intronic
1123036700 14:105474656-105474678 TGCCCCGCACCCGCCACCCCCGG + Intronic
1124696903 15:31870853-31870875 TGCCCCGCCCCCGCCCCTCCGGG + Intergenic
1128605384 15:69033069-69033091 CCCCCCGCCCACGCCCGCGCCGG + Exonic
1128782981 15:70375189-70375211 CTCCCCGCACACGCCCCTCCCGG + Intergenic
1131260308 15:90884409-90884431 TCCCCTCCACAGGCCCGCCCCGG + Exonic
1132398102 15:101489178-101489200 TGTCCCGCGCGCGCCCCCCCGGG + Intronic
1132522232 16:397138-397160 AGACCCGCCCCCGCCCGCCCGGG - Intronic
1133239295 16:4404975-4404997 TGCCCCGCACCTGCCTGTCCTGG + Intronic
1133242864 16:4425970-4425992 TGCCCCCACCACGCCCTCCCTGG - Exonic
1135479845 16:22813773-22813795 TGACCCGCACACGCACGCACAGG - Intergenic
1136845237 16:33571564-33571586 TGCCCCCGGCCCGCCCGCCCGGG + Intergenic
1137029304 16:35506955-35506977 CGCCCCGCATCCCCCCGCCCTGG - Intergenic
1138385919 16:56635616-56635638 TGCTGCGCACAGGCCAGCCCAGG + Intergenic
1139439747 16:66960230-66960252 TGCCCTGCAGATCCCCGCCCCGG + Intergenic
1141788481 16:86217275-86217297 AACCCAGCACACGCCCCCCCAGG - Intergenic
1142083803 16:88165285-88165307 TGCCCAGCTCACGCCACCCCGGG + Intergenic
1142283369 16:89160816-89160838 GTCCCCGCACCAGCCCGCCCTGG + Intergenic
1203106945 16_KI270728v1_random:1420217-1420239 TGCCCCCGGCCCGCCCGCCCGGG + Intergenic
1203155405 16_KI270728v1_random:1871862-1871884 TGCCCCCGGCCCGCCCGCCCGGG + Intergenic
1142852593 17:2711493-2711515 AGTCCCGAACCCGCCCGCCCTGG + Intronic
1142863397 17:2776773-2776795 TGCCGCGCACGCGCGCACCCCGG - Intergenic
1144829313 17:18122597-18122619 TGCCCAGCACAGGCAGGCCCAGG + Intronic
1144854112 17:18258600-18258622 GGCCCGGCACGCGCCCGGCCCGG + Intronic
1145110412 17:20156650-20156672 TGCCCCTCACACTCACGCCAGGG + Intronic
1145950320 17:28812289-28812311 AGCCCAGCTCACCCCCGCCCCGG + Intronic
1146229348 17:31094856-31094878 TGCCGCGCATGCGCCCGCGCCGG - Intergenic
1146406846 17:32546098-32546120 TTCCCTTCACACACCCGCCCTGG + Intronic
1146630205 17:34464105-34464127 TGCCCCCCACAGGCCTGCCAGGG - Intergenic
1147184449 17:38705775-38705797 CGCCCCGCGCACGCCGCCCCCGG - Intronic
1148040398 17:44702204-44702226 CGCCCCCCACCCCCCCGCCCCGG - Intergenic
1149486439 17:57046337-57046359 GGCCACGAACACCCCCGCCCCGG + Intergenic
1150212046 17:63446792-63446814 TGCCCCGCCCTCGCCCTGCCCGG + Intergenic
1151589263 17:75032737-75032759 TTCCCCCAACCCGCCCGCCCGGG - Intronic
1151704261 17:75758400-75758422 TGCCGGGCACAGGCCGGCCCAGG - Intronic
1152499430 17:80698062-80698084 TGCCCCGCACCCACCCGTCTGGG - Intronic
1152573703 17:81131213-81131235 AGCCCCGCTCATGCCCGGCCCGG - Intronic
1152578945 17:81157574-81157596 TGCCCAGCCCAGGCCAGCCCAGG + Intronic
1152729045 17:81960985-81961007 TGCCCCCGACACCCCCGGCCCGG - Exonic
1152809589 17:82375299-82375321 GGCCCCGCACGCGGCCGCGCAGG - Exonic
1154272085 18:12929212-12929234 TCCCACTCACACGCCAGCCCTGG + Intronic
1155570347 18:27185377-27185399 GCCCCCGCCCCCGCCCGCCCGGG + Intergenic
1157464089 18:47930201-47930223 GGCCCCGAACCCGCACGCCCGGG + Intronic
1158541164 18:58355955-58355977 TCCCCTGCACTCCCCCGCCCCGG + Intronic
1159106014 18:64002696-64002718 TCCCCAGCACCCGCCCTCCCCGG - Intronic
1160781655 19:880183-880205 GGCCCAGGACACGCCCGCCGGGG + Intronic
1160809161 19:1005603-1005625 TGCCCCACACAGCCCAGCCCGGG - Intronic
1161770986 19:6230540-6230562 TGCCCCGCCCCTGCCCGCCAAGG - Intronic
1162430453 19:10625430-10625452 AGCCCCGCCCGCGCCCTCCCGGG + Exonic
1163241619 19:16067270-16067292 TGCCCGGGACACGCCCACGCGGG + Intronic
1164051275 19:21587135-21587157 GGCCCCCCACACGCCCTTCCTGG + Intergenic
1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG + Intergenic
1166543267 19:43619527-43619549 TGCCTCGCGCACCCCTGCCCGGG + Intronic
1166869777 19:45864265-45864287 ACCCCCGCCCTCGCCCGCCCCGG - Exonic
1168290179 19:55353823-55353845 AGCCCTGCACACGCCTGGCCCGG + Intronic
1168349818 19:55669354-55669376 GGCCCCTCACATGCCCCCCCAGG - Intronic
1168720978 19:58554938-58554960 TGCCGCCCGCACGCCCGCCCGGG + Intronic
926143508 2:10382972-10382994 TGTCCCGCACACCACTGCCCTGG - Intronic
926305340 2:11633992-11634014 TGCCCCGCACAGTCCCCCCAGGG - Intronic
929936582 2:46297978-46298000 TGCCCCGCGCAGCCCGGCCCTGG - Intronic
931257375 2:60585176-60585198 TGCCTTGCTCACCCCCGCCCTGG - Intergenic
932307840 2:70716456-70716478 TGCCCCCTACACCCCCGCCCTGG + Intronic
934777591 2:96949266-96949288 TGCCCCCCTCACCCACGCCCTGG + Intronic
935301704 2:101698270-101698292 CGCCCCGCACCAGCCCGCACAGG - Intronic
936561296 2:113541826-113541848 CGCCCTGCACCCGCCCGCCTGGG - Intergenic
937866233 2:126753469-126753491 TGCCCTGCACACACACGACCCGG + Intergenic
938077286 2:128346521-128346543 TGCCCCGCAGACGCAGGCCTTGG - Intergenic
938547946 2:132352512-132352534 TGCCCCCGGCCCGCCCGCCCGGG + Intergenic
947913615 2:233818343-233818365 TGCCCAGCACATGCCCTCCATGG - Intronic
948763698 2:240208737-240208759 GGCTCCGCACATGCCTGCCCTGG + Intergenic
949022706 2:241750392-241750414 GACCCCCCACCCGCCCGCCCGGG - Intronic
1169257426 20:4109917-4109939 TGCCCCTCACCCACCCACCCAGG - Intergenic
1172599664 20:36175093-36175115 TGCCCCACCGCCGCCCGCCCCGG - Intronic
1173880306 20:46406636-46406658 CGCCCCGCACAGGCCGGGCCCGG + Intronic
1173899156 20:46574461-46574483 TGACCCGCACTTGCACGCCCCGG + Intronic
1173980610 20:47221138-47221160 GGTCCCACACACGCCGGCCCAGG + Intronic
1175439633 20:58981530-58981552 CGCCCCGCCCCCGCCCGCCCGGG + Intronic
1175488750 20:59364506-59364528 TGCCTCGCACATGACGGCCCGGG - Intergenic
1175787920 20:61723660-61723682 TGCACCGCACAGCCCTGCCCAGG - Intronic
1176250481 20:64117971-64117993 TGCCCCGCACAGCTTCGCCCAGG - Intergenic
1176308470 21:5136675-5136697 TGCCCAGCACACGCTGGCTCAGG - Intronic
1176380723 21:6111071-6111093 GGCCCCGCCCCGGCCCGCCCCGG - Intergenic
1176706261 21:10121567-10121589 TGCCCCTGGCCCGCCCGCCCGGG - Intergenic
1178935233 21:36856050-36856072 TGCCCCCCACCCACCAGCCCTGG - Intronic
1179457310 21:41508246-41508268 GCCCCCGCCCCCGCCCGCCCAGG - Intronic
1179742749 21:43427169-43427191 GGCCCCGCCCCGGCCCGCCCCGG + Intergenic
1179848589 21:44125357-44125379 TGCCCAGCACACGCTGGCTCAGG + Intronic
1179959785 21:44761814-44761836 TGCCACGCCCACACACGCCCAGG - Intergenic
1180005615 21:45019144-45019166 TGCCCCGCGCCCGCCGCCCCCGG + Intergenic
1183093409 22:35538886-35538908 TGCCCAGCACAAACCCTCCCGGG + Intergenic
1183253585 22:36746615-36746637 TGCCCATCACACGCCGGCCAAGG + Intergenic
1183293998 22:37019386-37019408 CGCCCCGCACTCACTCGCCCCGG + Exonic
1183649163 22:39144503-39144525 TGGCCCGCTCAGGCCCGCCCGGG + Intronic
1184661173 22:45966213-45966235 TGCCCTGCAGACCCCCGCCTGGG - Intronic
1185204187 22:49528468-49528490 TGCCCCGGACTCACCTGCCCAGG - Intronic
1185204215 22:49528560-49528582 TGCCCCGGACTCACCTGCCCAGG - Intronic
1185337814 22:50278560-50278582 TGCCCAGTTCTCGCCCGCCCCGG + Intronic
950548098 3:13650721-13650743 TGGCCCGCACCGGCCCGCACCGG - Intergenic
950703483 3:14766222-14766244 CGCCCCGCACAGGGCTGCCCTGG - Intronic
951217726 3:20040497-20040519 TGCCCCGCAGCCGCCCGGCCCGG - Exonic
954183184 3:48897795-48897817 TGCTCCCCACAGGCCCACCCTGG + Intronic
956605006 3:71065077-71065099 CGCCCCGCGCCCGCGCGCCCCGG + Intronic
956666290 3:71645172-71645194 TGCCAAGCACACTCCCGCTCTGG - Intergenic
962940803 3:140123160-140123182 CGCCCCCCACCCCCCCGCCCTGG - Intronic
963091392 3:141486915-141486937 GGCCCCGCCCCCGCCCCCCCCGG - Intergenic
967849500 3:194071214-194071236 TGCCCCGCGCCCGCCCGGGCGGG - Intergenic
968514250 4:1009775-1009797 GGCCCCGCCCCCGCCCGGCCAGG + Intergenic
968612252 4:1562650-1562672 CGCCCGGCCCACGCCAGCCCTGG - Intergenic
968884243 4:3318759-3318781 AGCCCCGCACACTCCCACACTGG - Intronic
968907937 4:3463222-3463244 AGCCCCGCCCGCGCCGGCCCTGG + Intergenic
969620183 4:8275031-8275053 TGCCCCGCCCACTCCCGCTGGGG + Intronic
970453092 4:16191324-16191346 TACCCCGCACAGGCCTGGCCAGG - Intronic
973319131 4:48792430-48792452 TGCCCCCCGCACCCCCGCACAGG + Intergenic
978126888 4:105146402-105146424 TTCCCCGCGCTCGCCAGCCCTGG + Exonic
979205544 4:118033557-118033579 CGGCCCGCGCGCGCCCGCCCCGG - Intergenic
983919779 4:173333728-173333750 AGCCCCGCCAGCGCCCGCCCTGG - Intronic
985467576 5:12303-12325 TGCCCTGGGCCCGCCCGCCCGGG + Intergenic
993457349 5:88141638-88141660 TGCGCCGACCAGGCCCGCCCCGG - Intergenic
998230883 5:140360860-140360882 TGCCCCCCACGTGCCCACCCTGG + Exonic
999062918 5:148654487-148654509 TGGCCAGCACGCGCCCTCCCTGG + Intronic
1000318860 5:160118595-160118617 TGCCCCGCAGGCGCCCACCTGGG + Intronic
1001690588 5:173629799-173629821 TGCTCCCCACACACCTGCCCTGG + Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1005851707 6:29827909-29827931 GACCCCGCACTCACCCGCCCAGG - Exonic
1005866644 6:29942618-29942640 GACCCCGCACTCACCCGCCCAGG - Exonic
1005875313 6:30006661-30006683 GACCCCGCACTCACCCGCCCAGG - Intergenic
1005931676 6:30489587-30489609 GACCCCGCACTCACCCGCCCAGG - Exonic
1006456258 6:34133566-34133588 TGCCCTGCCCATGCCCACCCAGG - Exonic
1008374539 6:50777189-50777211 TGCCCAGCACAAGCCAGACCAGG + Intergenic
1008910857 6:56731084-56731106 TGCCCTGCACACCCCAGCCCTGG - Intronic
1019451112 7:1098815-1098837 TCCCCCGCTCACCCCAGCCCCGG - Intronic
1020005767 7:4783160-4783182 TGTCCCGCGCAGGCCCACCCCGG - Intronic
1020085346 7:5307467-5307489 GGCCCGGCACAGGCCCACCCTGG - Exonic
1020204737 7:6105416-6105438 CGGCCAGCACACGCCCACCCCGG - Intronic
1020253004 7:6484192-6484214 TGCCCCGCGCGCGCGCGCGCCGG - Exonic
1021144591 7:17069415-17069437 TGCCCTGCACACACCCACACAGG + Intergenic
1021687619 7:23202656-23202678 TGCCCCGCCCCCCCCCCCCCCGG + Intergenic
1023791859 7:43758887-43758909 TGCCCCGCCCCGCCCCGCCCGGG + Intronic
1023842397 7:44104664-44104686 CGCCCCGCGCACGGCCGCCATGG - Exonic
1023861911 7:44221664-44221686 TGCCCCGCACCCCCATGCCCGGG + Intronic
1024394273 7:48848120-48848142 GGCCCCGCGCGCGCCCGCCGAGG + Intergenic
1025208975 7:57009821-57009843 GGCCCGGCACAGGCCCACCCTGG + Intergenic
1025662975 7:63567035-63567057 GGCCCGGCACAGGCCCACCCTGG - Intergenic
1026973021 7:74479375-74479397 GGCCCCGCTCAGGCCCGACCAGG + Intronic
1030176605 7:106660833-106660855 CGCCCCGGCCACGGCCGCCCGGG - Exonic
1034449399 7:151129331-151129353 TGCCCCCCACTGCCCCGCCCCGG + Intronic
1035287548 7:157815939-157815961 TCCCCAGCACACGCCCTCTCTGG + Intronic
1035605335 8:926638-926660 TGCCCTGGCCACGGCCGCCCAGG - Intergenic
1035625463 8:1067523-1067545 TGCCCGGCCCACGCACGCCTGGG + Intergenic
1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG + Intronic
1035758498 8:2051754-2051776 TACCCCGCACATGCCCGCCCTGG - Intronic
1039474590 8:37833079-37833101 TGCCCGGGGCACCCCCGCCCAGG - Exonic
1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG + Intergenic
1049240948 8:141537094-141537116 TGCACCGCCCAGGCCAGCCCAGG - Intergenic
1049689929 8:143953920-143953942 TGCGCCGGACAGGGCCGCCCCGG + Intronic
1049726197 8:144147624-144147646 TCGCAAGCACACGCCCGCCCTGG - Intergenic
1049747750 8:144270151-144270173 CGCCCCGCACCTGCCCGCTCAGG - Intronic
1049792082 8:144476770-144476792 TGCCCCCCACACCCCCGGTCGGG + Intergenic
1049891392 9:73513-73535 CGCCCTGCACCCGCCCGCCCGGG + Intergenic
1052048801 9:23822960-23822982 TGCCTCTCCCACACCCGCCCTGG - Intronic
1052857299 9:33415324-33415346 TCCCCCGCACCCCCTCGCCCAGG - Intergenic
1053643547 9:40108684-40108706 TGCCCCTGGCCCGCCCGCCCGGG - Intergenic
1053667423 9:40325924-40325946 TGCCCCACAAACTCCCTCCCTGG - Intronic
1053917002 9:42951027-42951049 TGCCCCACAAACTCCCTCCCTGG - Intergenic
1054324402 9:63705912-63705934 TGCCCCCGGCCCGCCCGCCCGGG - Intergenic
1054378568 9:64465951-64465973 TGCCCCACAAACTCCCTCCCTGG - Intergenic
1054517187 9:66050361-66050383 TGCCCCACAAACTCCCTCCCTGG + Intergenic
1054541205 9:66267920-66267942 TGCCCCTGGCCCGCCCGCCCGGG + Intergenic
1054695608 9:68356968-68356990 CGCCCTGCACCCGCCCGCCTGGG - Exonic
1056731048 9:89167085-89167107 TGGCCAGCACACCCCTGCCCTGG + Intronic
1057445730 9:95113095-95113117 GGCCCCCCACACACCCTCCCTGG - Intronic
1057942388 9:99296555-99296577 TGCCACGCGCACACCCTCCCCGG + Intergenic
1060549342 9:124477753-124477775 CGCCCCCCACAGGCCCGCCCAGG + Intronic
1060952320 9:127612198-127612220 TGCCCCGCCCCCGCGCGCGCCGG + Intergenic
1202791297 9_KI270719v1_random:91656-91678 TGCCCCTGGCCCGCCCGCCCGGG - Intergenic
1202800302 9_KI270719v1_random:169775-169797 TGCCCCCGGCGCGCCCGCCCGGG + Intergenic
1190490641 X:50979476-50979498 TGCCCCCCACCGGCCCTCCCAGG + Intergenic
1196816296 X:119667652-119667674 TGCCCCTCCCACGGCTGCCCTGG + Intronic
1197223205 X:123932723-123932745 AGCCCCCCACCCCCCCGCCCAGG - Intergenic
1198205523 X:134460787-134460809 TGGTCCCCACACGCCCTCCCAGG - Intronic
1198321298 X:135521231-135521253 TGCCCCGCAGCTGCGCGCCCGGG + Exonic