ID: 900105223

View in Genome Browser
Species Human (GRCh38)
Location 1:978214-978236
Sequence TGCCCCGCACACGCCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 2, 2: 1, 3: 15, 4: 221}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900105211_900105223 17 Left 900105211 1:978174-978196 CCCCACCCTAACCCTGCACACTC 0: 1
1: 0
2: 2
3: 34
4: 499
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105209_900105223 24 Left 900105209 1:978167-978189 CCGCCTGCCCCACCCTAACCCTG 0: 1
1: 0
2: 12
3: 121
4: 933
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105219_900105223 6 Left 900105219 1:978185-978207 CCCTGCACACTCTTGGCCTGGGA 0: 1
1: 0
2: 3
3: 18
4: 223
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105212_900105223 16 Left 900105212 1:978175-978197 CCCACCCTAACCCTGCACACTCT 0: 1
1: 0
2: 2
3: 28
4: 356
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105220_900105223 5 Left 900105220 1:978186-978208 CCTGCACACTCTTGGCCTGGGAA 0: 1
1: 0
2: 0
3: 17
4: 193
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105213_900105223 15 Left 900105213 1:978176-978198 CCACCCTAACCCTGCACACTCTT 0: 1
1: 0
2: 2
3: 22
4: 290
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105215_900105223 12 Left 900105215 1:978179-978201 CCCTAACCCTGCACACTCTTGGC 0: 1
1: 0
2: 2
3: 7
4: 136
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105210_900105223 21 Left 900105210 1:978170-978192 CCTGCCCCACCCTAACCCTGCAC 0: 1
1: 0
2: 4
3: 91
4: 792
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105221_900105223 -10 Left 900105221 1:978201-978223 CCTGGGAACTGCCTGCCCCGCAC 0: 1
1: 0
2: 3
3: 21
4: 255
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221
900105216_900105223 11 Left 900105216 1:978180-978202 CCTAACCCTGCACACTCTTGGCC 0: 1
1: 0
2: 1
3: 18
4: 226
Right 900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG 0: 1
1: 2
2: 1
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900105223 Original CRISPR TGCCCCGCACACGCCCGCCC CGG Intronic