ID: 900106220

View in Genome Browser
Species Human (GRCh38)
Location 1:982238-982260
Sequence CCTCATGTACTGTAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 108}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106220_900106227 -4 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106227 1:982257-982279 GAGGACGACTTCCTGGCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 79
900106220_900106233 11 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106233 1:982272-982294 GCACGGGGCCGGGCTGAGGTGGG 0: 1
1: 0
2: 1
3: 45
4: 438
900106220_900106231 7 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106231 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 5
3: 53
4: 501
900106220_900106238 27 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106238 1:982288-982310 AGGTGGGGTCAGACACGGGCCGG 0: 1
1: 1
2: 2
3: 20
4: 212
900106220_900106234 12 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106234 1:982273-982295 CACGGGGCCGGGCTGAGGTGGGG 0: 1
1: 0
2: 0
3: 43
4: 392
900106220_900106236 22 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106236 1:982283-982305 GGCTGAGGTGGGGTCAGACACGG 0: 1
1: 5
2: 30
3: 47
4: 508
900106220_900106229 1 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106229 1:982262-982284 CGACTTCCTGGCACGGGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
900106220_900106239 30 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106239 1:982291-982313 TGGGGTCAGACACGGGCCGGAGG 0: 1
1: 1
2: 0
3: 13
4: 139
900106220_900106228 0 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 87
900106220_900106232 10 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106232 1:982271-982293 GGCACGGGGCCGGGCTGAGGTGG 0: 1
1: 0
2: 2
3: 59
4: 583
900106220_900106226 -5 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106226 1:982256-982278 TGAGGACGACTTCCTGGCACGGG 0: 1
1: 0
2: 0
3: 8
4: 133
900106220_900106237 23 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106237 1:982284-982306 GCTGAGGTGGGGTCAGACACGGG 0: 1
1: 0
2: 2
3: 21
4: 258
900106220_900106225 -6 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106225 1:982255-982277 ATGAGGACGACTTCCTGGCACGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106220 Original CRISPR CCTCATGTACTGTAGCTGGA GGG (reversed) Intergenic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900527869 1:3137948-3137970 GCTCTTGGACTGTGGCTGGAGGG + Intronic
901430615 1:9211806-9211828 CCTCATGTGCTGAGGCTCGAAGG - Intergenic
904845424 1:33409974-33409996 CCTCATGTATTTTCTCTGGAAGG + Intronic
906794087 1:48682868-48682890 CCTCATTTAATGGAGCTGGTGGG + Intronic
913378563 1:118184366-118184388 CCTCATTTACTGAAGCTGGGTGG + Intronic
916567834 1:165997101-165997123 TCTCATGTACTGGAGCTGATGGG + Intergenic
917771029 1:178278199-178278221 CCACATGTACACTAGCAGGACGG - Intronic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
920165445 1:204032377-204032399 TCTCATCTTCTGTAGCTGTAGGG + Intergenic
923114167 1:230918872-230918894 TCTCATCTACTATAGCTGCAAGG + Intronic
924105680 1:240646817-240646839 CCTAATGTAATATATCTGGAAGG - Intergenic
1065885199 10:30070678-30070700 CGGCATATGCTGTAGCTGGAGGG - Intronic
1069140182 10:64812312-64812334 CCTTATTTCCTGTAGCTGAAGGG - Intergenic
1070138768 10:73720341-73720363 CCTCTTGTCTTGTAGCTAGAGGG - Intergenic
1072842472 10:98789700-98789722 CCTCATTTCTTATAGCTGGATGG + Intronic
1072860690 10:99001812-99001834 AGTAATGTACTGTAGCTTGATGG - Intronic
1073817937 10:107228094-107228116 CCTCATCTTCTGTAGCTGAAGGG + Intergenic
1074027103 10:109647675-109647697 CCTGAAGTACATTAGCTGGAGGG - Intergenic
1077103989 11:833953-833975 CATCATGGAATGGAGCTGGAGGG - Intronic
1079699567 11:23527000-23527022 CCTTATATCCTGTAGCTGTAGGG + Intergenic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1082655577 11:55852642-55852664 CCTCATCTAATTTAGCTGGCTGG + Intergenic
1085466740 11:76729142-76729164 CCTCATGTCCTGTAGGTGCAGGG - Intergenic
1087873732 11:103330743-103330765 CCTCTTGTACTGAAACTGGCCGG + Intronic
1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG + Intronic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1099908039 12:88795167-88795189 TCTCATGGACTGTAGCTTGCTGG + Intergenic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1101967363 12:109290778-109290800 CCTGCTGTACTGTAGCTGTGAGG + Intronic
1115853293 14:37604136-37604158 CCTCCTGGACTGTAGCTTGGAGG - Intronic
1121712017 14:96045496-96045518 CCTCATGGAGTGGAGTTGGATGG + Intronic
1121713696 14:96057789-96057811 CCTCCTGCATTGTACCTGGAAGG + Intronic
1122305798 14:100765674-100765696 TCTCATCTCCTGCAGCTGGAGGG - Intergenic
1124888435 15:33709395-33709417 CAGCATGTACAGTAGCTGAAAGG + Intronic
1126270823 15:46815060-46815082 CCTTATGTCCTGTAGCTGCAAGG - Intergenic
1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG + Intergenic
1127470877 15:59289010-59289032 CCTAAAATATTGTAGCTGGAAGG + Intronic
1134906950 16:17988023-17988045 CCTCATGTTCCCTAGCTTGAGGG + Intergenic
1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG + Intronic
1137963552 16:52909298-52909320 CCTCATTGATTGTAGCTTGAGGG + Intergenic
1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG + Intronic
1146716849 17:35093506-35093528 CCTCATGCCCTGGAGCTGTACGG - Intronic
1148836617 17:50469038-50469060 CCTCATGCACGGTAGCCGGCTGG - Intronic
1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG + Intronic
1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG + Intronic
1159156219 18:64586738-64586760 CCTCATGTATTCTAGCTACAAGG - Intergenic
1160130166 18:76218354-76218376 CCTCATGCACTGGAACTGGAAGG - Intergenic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1167503000 19:49857822-49857844 CCTCACGGACTGTGGCTGGGAGG + Intronic
925741533 2:7009300-7009322 CATCTTGTTCTGTAGCTGAAGGG + Intronic
932850273 2:75177878-75177900 CGTCATGTTGTGGAGCTGGAGGG - Intronic
935717995 2:105955357-105955379 CCTCCTGTGCTGTGGGTGGAAGG - Intergenic
937536536 2:122895768-122895790 ACTCATGTCCTGCAACTGGATGG + Intergenic
940561514 2:155302830-155302852 TCTCATTTTCTGTAGCTAGAAGG - Intergenic
940841969 2:158594211-158594233 CCTCATGTCCTGTTGCTGATGGG + Intronic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
943689311 2:190852891-190852913 CCTCATGCCCTGGAGCAGGAGGG + Intergenic
948940298 2:241191987-241192009 TGTCATTCACTGTAGCTGGAAGG + Intronic
1169611550 20:7386143-7386165 CCTCATTTCCTGTACCTGCAGGG - Intergenic
1170539843 20:17376428-17376450 CCTCAAGTACTGTAGGAGGATGG - Intronic
1170983610 20:21238275-21238297 CATCATGTACTTGAGCTGCAGGG + Intronic
1173398650 20:42704398-42704420 CCTAATGGTCTTTAGCTGGAAGG + Intronic
1177095082 21:16822765-16822787 CCTAATCTCCTGTAGCTGGAAGG + Intergenic
949196066 3:1309511-1309533 CCTCAATTACTGTAGCTTTACGG + Intronic
950880630 3:16320166-16320188 CTTCAAGTAGTTTAGCTGGAAGG + Intronic
953166031 3:40465695-40465717 CCTCATGGACTGTAGCCAAAGGG - Intergenic
955949413 3:64227002-64227024 CTTCAGGAACTGCAGCTGGAAGG - Intronic
961919558 3:130411792-130411814 CCTCATGTCCTGTAATTGGCTGG - Intronic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
980092706 4:128458965-128458987 CCGTCTGTGCTGTAGCTGGAGGG + Intergenic
981008116 4:139896567-139896589 CCTCATTTAGTGTGGCTTGATGG + Intronic
984450963 4:179900891-179900913 CTGCCTGTACTGTAGCTGCAAGG - Intergenic
986274010 5:6257781-6257803 GCTAATGGACTGGAGCTGGAGGG - Intergenic
986579708 5:9252645-9252667 CCTTATGTACTGGAGATGGTAGG + Intronic
986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG + Intergenic
988000359 5:25340270-25340292 CCTCGTCTACTGTAGTTGAATGG + Intergenic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
992320895 5:75612025-75612047 CACCATGTACTGTGGGTGGAAGG + Intronic
992616184 5:78548219-78548241 GCTTATGTACCGTAGCTGGGAGG - Intronic
996634546 5:125674155-125674177 CCTCATCCACTATAGCTGGAGGG + Intergenic
999083942 5:148870576-148870598 CTCCATGTGCTGTAACTGGAAGG - Intergenic
999274359 5:150319163-150319185 CCTCCTGGAATGCAGCTGGAGGG - Intronic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
1001043309 5:168352503-168352525 CCTTAGGTCCTGCAGCTGGAAGG - Intronic
1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG + Intergenic
1006054850 6:31376735-31376757 CCTAATCTCCTGTAGCTGCAGGG - Intergenic
1007412523 6:41673314-41673336 CCTCAGGTACCTTAGCTGGTAGG - Intergenic
1010407362 6:75520268-75520290 CCTTATTTCCTGTAGCTGCAGGG - Intergenic
1012225799 6:96702051-96702073 CCTTATCTTCTGTAGCTGCAGGG + Intergenic
1013418691 6:109947161-109947183 CACCAGGTGCTGTAGCTGGAAGG + Intergenic
1015360780 6:132336686-132336708 CCTCATGTGCTTTAGCTGACAGG - Intronic
1019230487 6:170557078-170557100 CCTCAGGTAATATAGCAGGAGGG + Exonic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG + Intronic
1030313986 7:108095540-108095562 CCTCATGTAGTTTTACTGGATGG + Intronic
1030388925 7:108901342-108901364 CCTCTTGTCCTTTAGATGGAAGG - Intergenic
1033544524 7:142388251-142388273 CATCAGGTACTGTAGCTCTAAGG + Intergenic
1037799932 8:22027201-22027223 CCTCATGCACTGAGGGTGGAGGG + Intronic
1038345592 8:26729485-26729507 GCTGATGTACTATATCTGGAAGG - Intergenic
1039788817 8:40857556-40857578 TCTCATGCACTGTAGGTGAAAGG + Intronic
1042089961 8:65148156-65148178 CCTCATGGAGGGTAGCTGTAGGG - Intergenic
1044634303 8:94307292-94307314 TCTCATTTACTGTAGCTGAGAGG + Intergenic
1045519851 8:102894255-102894277 CAACATGTACTGAAGCTGGGAGG + Intronic
1047565105 8:126035384-126035406 CCTTATCTACTGTAGCTGCAGGG - Intergenic
1049740921 8:144240476-144240498 CCCCATGTGCTGTGGCTGCAGGG - Intronic
1051022900 9:12567155-12567177 ACTCATCTCCTGTAGCTGAAGGG - Intergenic
1051171309 9:14320917-14320939 CCCCAAGTACAGTAGCTGGCAGG - Intronic
1051192968 9:14534240-14534262 CCTCAGGTGCTCTAGGTGGAAGG + Intergenic
1051265911 9:15307704-15307726 CCACCTGGACTGTAGGTGGAAGG + Intergenic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058205440 9:102100325-102100347 TCTCATTTACTACAGCTGGAAGG + Intergenic
1059466312 9:114470837-114470859 CTTCATGTCCTGGAGCTGGAAGG - Intronic
1060861212 9:126956319-126956341 CCTCAGGGACTGAAGTTGGATGG + Intronic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1061972657 9:134053349-134053371 CTGCATGTACTGCAGCTGGTTGG + Exonic
1189665963 X:43355081-43355103 CCTGATCTCCTGTAGCTGCAGGG - Intergenic
1190218398 X:48495255-48495277 CCTCATGGACTGGGACTGGAAGG + Intergenic
1197610446 X:128632474-128632496 CCTCAAGTGCTTTAGATGGAAGG - Intergenic
1197923495 X:131621510-131621532 CCTCTTATAGTGTTGCTGGAAGG + Intergenic