ID: 900106222

View in Genome Browser
Species Human (GRCh38)
Location 1:982239-982261
Sequence TCCTCATGTACTGTAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106222_900106228 -1 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 87
900106222_900106229 0 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106229 1:982262-982284 CGACTTCCTGGCACGGGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
900106222_900106233 10 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106233 1:982272-982294 GCACGGGGCCGGGCTGAGGTGGG 0: 1
1: 0
2: 1
3: 45
4: 438
900106222_900106238 26 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106238 1:982288-982310 AGGTGGGGTCAGACACGGGCCGG 0: 1
1: 1
2: 2
3: 20
4: 212
900106222_900106236 21 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106236 1:982283-982305 GGCTGAGGTGGGGTCAGACACGG 0: 1
1: 5
2: 30
3: 47
4: 508
900106222_900106231 6 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106231 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 5
3: 53
4: 501
900106222_900106225 -7 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106225 1:982255-982277 ATGAGGACGACTTCCTGGCACGG 0: 1
1: 0
2: 0
3: 7
4: 85
900106222_900106234 11 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106234 1:982273-982295 CACGGGGCCGGGCTGAGGTGGGG 0: 1
1: 0
2: 0
3: 43
4: 392
900106222_900106232 9 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106232 1:982271-982293 GGCACGGGGCCGGGCTGAGGTGG 0: 1
1: 0
2: 2
3: 59
4: 583
900106222_900106237 22 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106237 1:982284-982306 GCTGAGGTGGGGTCAGACACGGG 0: 1
1: 0
2: 2
3: 21
4: 258
900106222_900106239 29 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106239 1:982291-982313 TGGGGTCAGACACGGGCCGGAGG 0: 1
1: 1
2: 0
3: 13
4: 139
900106222_900106226 -6 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106226 1:982256-982278 TGAGGACGACTTCCTGGCACGGG 0: 1
1: 0
2: 0
3: 8
4: 133
900106222_900106227 -5 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106227 1:982257-982279 GAGGACGACTTCCTGGCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106222 Original CRISPR TCCTCATGTACTGTAGCTGG AGG (reversed) Intergenic
900106222 1:982239-982261 TCCTCATGTACTGTAGCTGGAGG - Intergenic
904058112 1:27685725-27685747 TCCTGATGAGCTGCAGCTGGTGG + Intergenic
906794085 1:48682867-48682889 GCCTCATTTAATGGAGCTGGTGG + Intronic
909833906 1:80230258-80230280 TCCTCACATACTGGAGCAGGAGG + Intergenic
914414120 1:147462567-147462589 TCCTCATGCATTGTTGTTGGGGG - Intergenic
916024857 1:160824650-160824672 AACTAATGTACTGTAGGTGGTGG - Intronic
916567833 1:165997100-165997122 TTCTCATGTACTGGAGCTGATGG + Intergenic
917059874 1:171025786-171025808 TCCTCATCTATTGTAGTTTGTGG - Intronic
917843488 1:179001796-179001818 GCCTCAAGTACTGCTGCTGGTGG - Intergenic
919609355 1:199726158-199726180 TCCTCATGTATTGTGGTTTGGGG - Intergenic
920165444 1:204032376-204032398 TTCTCATCTTCTGTAGCTGTAGG + Intergenic
920367384 1:205455352-205455374 TCCACATATACTGGAGTTGGTGG + Intronic
1064280261 10:13945046-13945068 TCCCATTGTACTGTTGCTGGTGG - Intronic
1067561443 10:47307536-47307558 CCCTCATGCACTGGGGCTGGGGG + Intronic
1070700197 10:78596486-78596508 TCCTCTTGTGCTGTAGCTAGGGG - Intergenic
1072960319 10:99923464-99923486 TCCTCCTGCACTGTAACTGTGGG + Intronic
1073817935 10:107228093-107228115 CCCTCATCTTCTGTAGCTGAAGG + Intergenic
1074027105 10:109647676-109647698 TCCTGAAGTACATTAGCTGGAGG - Intergenic
1074906535 10:117869149-117869171 TCCTCAGGTACTGTATCTAAAGG + Intergenic
1078501509 11:11883731-11883753 TTCTAATATACTCTAGCTGGTGG - Intronic
1085466742 11:76729143-76729165 ACCTCATGTCCTGTAGGTGCAGG - Intergenic
1085549852 11:77358962-77358984 TCCTCATCTTCTGAAACTGGTGG + Exonic
1088649406 11:111944145-111944167 TCCTCATCTTCTGCTGCTGGAGG + Intronic
1090758915 11:129818260-129818282 TCCTCCAGTAGTGTAGCTTGTGG - Intronic
1091875651 12:3931048-3931070 TCCTAATGTGTTGTAGGTGGAGG + Intergenic
1094037572 12:26087181-26087203 TCCTCATCAACTGTAAATGGAGG + Intergenic
1095276405 12:40288556-40288578 TGCTCATGTACTGCTGGTGGGGG - Intronic
1095575217 12:43729553-43729575 TCCACATTTTCTGTTGCTGGAGG - Exonic
1098636240 12:72787252-72787274 TCTTCATGAAGTGAAGCTGGGGG - Intergenic
1100025729 12:90125574-90125596 TCCTAATGAAGTGTAGTTGGTGG + Intergenic
1104250827 12:127092083-127092105 GCCTCCTGAACTGGAGCTGGCGG - Intergenic
1108672256 13:52703622-52703644 TCATCATGCCATGTAGCTGGTGG - Exonic
1108980750 13:56510041-56510063 TGCTCATATACTGTTGGTGGGGG - Intergenic
1115537523 14:34386967-34386989 TCCTCATGTGCTGCAGGTGAGGG - Intronic
1117294777 14:54369334-54369356 ACCTCATGTACTGCATCTGATGG + Intergenic
1121995613 14:98600397-98600419 TACCCATGCACTCTAGCTGGGGG + Intergenic
1123150267 14:106174761-106174783 TCACCATGGACTGTACCTGGGGG - Intergenic
1123165019 14:106318219-106318241 TCAACATGTACTGGACCTGGAGG - Intergenic
1202888256 14_KI270722v1_random:129309-129331 TCCTCATGTACTGATGTAGGTGG + Intergenic
1129599908 15:76992690-76992712 CCCTCATGTACCACAGCTGGAGG + Intergenic
1130251841 15:82304868-82304890 TCATCAGGTACTGCAGCTGCAGG + Intergenic
1136679785 16:31952027-31952049 TCACCATGGACTGTACCTGGGGG + Intergenic
1136890276 16:33966074-33966096 TCACCATGGACTGTACCTGGGGG - Intergenic
1140845224 16:78880672-78880694 TGCTGATGTACTCTTGCTGGCGG + Intronic
1140918559 16:79515983-79516005 TCCTCATTTACCTTAGCTTGAGG - Intergenic
1141648019 16:85377823-85377845 TCCACATGTGCAGGAGCTGGGGG + Intergenic
1203082755 16_KI270728v1_random:1157540-1157562 TCACCATGGACTGTACCTGGGGG + Intergenic
1142883198 17:2896786-2896808 TCCTCATCTAATGCACCTGGAGG + Intronic
1145035944 17:19540729-19540751 TCCTCACGTTCAGTAGCAGGGGG + Intronic
1145939885 17:28737797-28737819 TCCCCATGCACTGTACCTGCAGG + Exonic
1146463849 17:33069934-33069956 TCTTCATTTACTGCAGTTGGAGG - Intronic
1147728191 17:42579924-42579946 TTTTCATGTACTGCAGGTGGGGG - Exonic
1149869151 17:60167411-60167433 TCCTCAGGGACTCTTGCTGGGGG - Intronic
1150314070 17:64154061-64154083 TCCTCATGTTCTGGAACTGTGGG - Intronic
1151891634 17:76954366-76954388 TCCTCATGAGCTGCAGCAGGAGG - Intergenic
1153041151 18:813330-813352 TCCTCATGGACTGAACCTTGAGG + Intergenic
1153699076 18:7674333-7674355 TCCTCTTCCACTGTAGCTAGAGG + Intronic
1161589119 19:5120851-5120873 GCCTCAGGCACTGTGGCTGGGGG - Intronic
1162851746 19:13436378-13436400 TCCTGTTGTTCTGTAGCAGGAGG - Intronic
1163162794 19:15475598-15475620 GGCTCATGCACTGAAGCTGGAGG + Exonic
1166147126 19:40845466-40845488 TCCTCATGGACCTTGGCTGGGGG + Exonic
1166151281 19:40877362-40877384 TCCTCATGGACCTTGGCTGGGGG + Exonic
1166179022 19:41094238-41094260 TCCTCATGGACCTTGGCTGGGGG - Exonic
1167490274 19:49788985-49789007 CCCTCGTGTGCTGCAGCTGGAGG - Intronic
925741532 2:7009299-7009321 TCATCTTGTTCTGTAGCTGAAGG + Intronic
931203952 2:60128802-60128824 TCCTAGTCTACTGTAGATGGGGG - Intergenic
931648950 2:64451842-64451864 TCCCCAAGTACTGGGGCTGGGGG - Intergenic
932226448 2:70044814-70044836 ACTGCATGTACTGGAGCTGGTGG - Intergenic
932850274 2:75177879-75177901 TCGTCATGTTGTGGAGCTGGAGG - Intronic
935422225 2:102881066-102881088 GGCTCATGTTTTGTAGCTGGGGG + Intergenic
935879486 2:107548582-107548604 TACTCATGCAGTTTAGCTGGGGG - Intergenic
940841967 2:158594210-158594232 GCCTCATGTCCTGTTGCTGATGG + Intronic
941577239 2:167248431-167248453 TTCTCATCTACTGGAGGTGGAGG - Exonic
944534555 2:200696270-200696292 TCTTCATGTTCTGCTGCTGGTGG - Intergenic
947740601 2:232483164-232483186 CCATCATGTACTGGAGCTGCGGG + Exonic
1169611552 20:7386144-7386166 TCCTCATTTCCTGTACCTGCAGG - Intergenic
1176215220 20:63944719-63944741 TCTTCATGTCCAGGAGCTGGTGG + Exonic
1178224262 21:30697379-30697401 TCCTTATGTACTTTAAATGGAGG - Intergenic
1179570989 21:42278912-42278934 TCCTCTTGTCCTGTAGCTGATGG - Intronic
1180330383 22:11472985-11473007 TCCTCATGTACTGATGTAGGTGG + Intergenic
1182985149 22:34709325-34709347 TCCTCTAGTACGGTAGGTGGAGG - Intergenic
1183737970 22:39654346-39654368 TTATCATGTCCTGGAGCTGGAGG + Intronic
952715684 3:36478121-36478143 CCCTCATCTTCTGTAGCAGGAGG - Intronic
959017528 3:101152637-101152659 TCCTGATTCACTGTACCTGGAGG + Intergenic
964467185 3:157007259-157007281 TCCTTATGGTCTGTAGATGGTGG - Intronic
970737208 4:19186681-19186703 TTCTCACGTACTGTTGCTGGTGG + Intergenic
971255487 4:25010043-25010065 TTCTGATATACTGCAGCTGGTGG - Intronic
974552466 4:63396201-63396223 TCCTCATTCACTGAAGCTGTGGG + Intergenic
977381236 4:96276754-96276776 TTCTCATGTATTGTTGTTGGGGG + Intergenic
980214881 4:129839054-129839076 TGCTCATACACTGTTGCTGGTGG + Intergenic
986474878 5:8119003-8119025 CCCTCATGTTCTGTAGCAAGAGG + Intergenic
991256691 5:64622053-64622075 ACCTCATCTTCTGTAGCTGGAGG - Intergenic
996634544 5:125674154-125674176 CCCTCATCCACTATAGCTGGAGG + Intergenic
998172677 5:139881733-139881755 TCCTCATGAACTGCAGCTCCTGG - Intronic
999274361 5:150319164-150319186 TCCTCCTGGAATGCAGCTGGAGG - Intronic
1000652884 5:163838638-163838660 TCCACATGTGCTTCAGCTGGTGG - Intergenic
1006054852 6:31376736-31376758 TCCTAATCTCCTGTAGCTGCAGG - Intergenic
1006373337 6:33658663-33658685 TCTTCATGTGCAGGAGCTGGGGG - Exonic
1006811853 6:36825315-36825337 TGCTCAGGGACTGGAGCTGGGGG - Intronic
1007930983 6:45690285-45690307 TCCTCAGTTTCTGTTGCTGGAGG - Intergenic
1008548786 6:52607306-52607328 TCTTCAGATTCTGTAGCTGGAGG + Intergenic
1009803498 6:68572935-68572957 CCCTGATGCACTGTAGCTGTGGG + Intergenic
1019051645 6:169188233-169188255 TCCTCACTCACTGTTGCTGGAGG - Intergenic
1019907889 7:4078539-4078561 TCCTCATTTGCTGTTGCTTGGGG - Intronic
1024748928 7:52440443-52440465 TTCTCATGTTTTGTATCTGGAGG + Intergenic
1028925178 7:96349809-96349831 TCCTGTTGTACTGCAGCTGAGGG - Intergenic
1029171142 7:98629885-98629907 TCCTCATGTTCTGGGGCTGAAGG + Intergenic
1029307187 7:99629175-99629197 TCCTCCTGTCCTGTAGGCGGTGG + Exonic
1032098546 7:128953389-128953411 TCCTATTGTTCTGTAGCTTGAGG + Intergenic
1032710944 7:134459326-134459348 TCCTCAGCTGCTGTATCTGGTGG + Intergenic
1037910463 8:22740961-22740983 TCCTCACGTAGGGTAGGTGGGGG - Intronic
1038893119 8:31750072-31750094 TCCTCTTCTACTGTGGCTGTAGG - Intronic
1038976231 8:32699295-32699317 TCCTCCTGTTCTGTAGTTGACGG + Intronic
1040751732 8:50717856-50717878 TACTCATGTACTGCAGTGGGTGG - Intronic
1042586291 8:70342934-70342956 TCTTCATGTACTCTATCTAGTGG - Intronic
1045971697 8:108085574-108085596 TCCTCATGAACTGAATCTGGGGG - Intergenic
1047565107 8:126035385-126035407 GCCTTATCTACTGTAGCTGCAGG - Intergenic
1047765039 8:127983452-127983474 CCCTCTTGTTCTGTAGCTTGTGG + Intergenic
1049740923 8:144240477-144240499 TCCCCATGTGCTGTGGCTGCAGG - Intronic
1051850969 9:21507590-21507612 TCCTCCTGTCGCGTAGCTGGGGG - Intergenic
1054792377 9:69268111-69268133 GCCTCATAAACTGTAGCTGTGGG - Intergenic
1055678337 9:78688955-78688977 TCCTCATGGGCTGTAGCTGGAGG + Intergenic
1057853586 9:98584397-98584419 TCCTCCTCTACTGTAGCTCATGG + Intronic
1061629934 9:131865962-131865984 TCCTCAGCTGCTGCAGCTGGTGG - Intronic
1062027028 9:134345292-134345314 TGCTCATGAAGTGTAGCTGCTGG + Intronic
1187111298 X:16303340-16303362 TCCTCATGCTCTGTACCTGATGG + Intergenic
1201470963 Y:14334539-14334561 TCCTCAGGGACTGTAGGTGTGGG - Intergenic