ID: 900106223

View in Genome Browser
Species Human (GRCh38)
Location 1:982242-982264
Sequence TCGTCCTCATGTACTGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 35}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106223_900106226 -9 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106226 1:982256-982278 TGAGGACGACTTCCTGGCACGGG 0: 1
1: 0
2: 0
3: 8
4: 133
900106223_900106231 3 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106231 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 5
3: 53
4: 501
900106223_900106236 18 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106236 1:982283-982305 GGCTGAGGTGGGGTCAGACACGG 0: 1
1: 5
2: 30
3: 47
4: 508
900106223_900106227 -8 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106227 1:982257-982279 GAGGACGACTTCCTGGCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 79
900106223_900106225 -10 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106225 1:982255-982277 ATGAGGACGACTTCCTGGCACGG 0: 1
1: 0
2: 0
3: 7
4: 85
900106223_900106234 8 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106234 1:982273-982295 CACGGGGCCGGGCTGAGGTGGGG 0: 1
1: 0
2: 0
3: 43
4: 392
900106223_900106228 -4 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 87
900106223_900106237 19 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106237 1:982284-982306 GCTGAGGTGGGGTCAGACACGGG 0: 1
1: 0
2: 2
3: 21
4: 258
900106223_900106232 6 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106232 1:982271-982293 GGCACGGGGCCGGGCTGAGGTGG 0: 1
1: 0
2: 2
3: 59
4: 583
900106223_900106238 23 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106238 1:982288-982310 AGGTGGGGTCAGACACGGGCCGG 0: 1
1: 1
2: 2
3: 20
4: 212
900106223_900106239 26 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106239 1:982291-982313 TGGGGTCAGACACGGGCCGGAGG 0: 1
1: 1
2: 0
3: 13
4: 139
900106223_900106233 7 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106233 1:982272-982294 GCACGGGGCCGGGCTGAGGTGGG 0: 1
1: 0
2: 1
3: 45
4: 438
900106223_900106229 -3 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106229 1:982262-982284 CGACTTCCTGGCACGGGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106223 Original CRISPR TCGTCCTCATGTACTGTAGC TGG (reversed) Intergenic
900106223 1:982242-982264 TCGTCCTCATGTACTGTAGCTGG - Intergenic
901143205 1:7049042-7049064 TTTTCCTCATGTACCGTATCAGG - Intronic
1070806944 10:79276270-79276292 GCGTCCTCATGTACTTCAGGAGG + Intronic
1087643958 11:100785825-100785847 TTTTCCTCCTGTAATGTAGCAGG + Intronic
1087873729 11:103330739-103330761 TCCTCCTCTTGTACTGAAACTGG + Intronic
1101158490 12:101950524-101950546 TCGTCCTCTTGTAAAGTAGTAGG + Intronic
1108981096 13:56515541-56515563 TCTCCTTCATGCACTGTAGCAGG - Intergenic
1112475249 13:99725885-99725907 TCGTGCGCATGTGCAGTAGCTGG - Intronic
1113432475 13:110262606-110262628 TCCTCTTCTTGTACAGTAGCAGG - Intronic
1115811638 14:37115415-37115437 CCGTCCTCATGTATTTTTGCTGG - Intronic
1121995610 14:98600394-98600416 TCGTACCCATGCACTCTAGCTGG + Intergenic
1125810080 15:42531737-42531759 TCCTCCTCATATACTTCAGCAGG + Exonic
1133595566 16:7288026-7288048 TTTTCCTCATGTTCTGTAGAAGG + Intronic
1135613403 16:23888392-23888414 GGGTCCTCATGGGCTGTAGCAGG + Intronic
1138189119 16:54999864-54999886 TCGGCCTCATCTACTGTGGCAGG - Intergenic
1151442726 17:74143366-74143388 TAATCCTCATGTACTGTGGGAGG + Intergenic
1160478663 18:79218158-79218180 TTTTCCTCATGTTCTGTATCTGG + Intronic
1167262604 19:48467539-48467561 TCGTCCTCATTTGCTGTCCCTGG - Intronic
929107795 2:38380975-38380997 TTGTCCACATCTACTCTAGCAGG - Intergenic
948279741 2:236737936-236737958 TCATCCTCACCTACAGTAGCAGG - Intergenic
1170756041 20:19208066-19208088 TCCTCCTTATGTAGTGTAGCTGG + Intergenic
1175106945 20:56622201-56622223 TCATCCTCATGTATTGTGACAGG + Intergenic
1177564912 21:22807970-22807992 TCCTCCACACGTGCTGTAGCAGG + Intergenic
1177662446 21:24103124-24103146 TTGCCTTCAGGTACTGTAGCAGG - Intergenic
957554777 3:81752403-81752425 TCTTCCTCCTGAACTGTAGATGG - Intronic
965835352 3:172845533-172845555 TTTTCCTTATGTACTATAGCAGG - Intergenic
977709617 4:100110177-100110199 TCCTGCTCAAGTCCTGTAGCTGG - Intergenic
987373375 5:17213258-17213280 TCCTCTTCATGTACTGTAAAAGG - Intronic
996483518 5:124002843-124002865 TCTTCCTCATCTACAGTAGCAGG + Intergenic
999124742 5:149238860-149238882 TCGTCCTCATGAACTGTAGAGGG + Intronic
1004954941 6:20719173-20719195 TCCTCCTCCTCTACTGTGGCTGG - Intronic
1005344812 6:24878931-24878953 TCTTCCTCATTTTCTGTAACAGG + Intronic
1005831411 6:29673755-29673777 TCTTCCTCATTCACTGTAGAAGG - Exonic
1006104336 6:31707517-31707539 TCGTCCCCATGTAGAGTAGGTGG - Exonic
1040751733 8:50717859-50717881 TGGTACTCATGTACTGCAGTGGG - Intronic
1041928739 8:63265332-63265354 TTGTCCTCATTTGCTGTAGATGG + Intergenic
1045971700 8:108085577-108085599 TCTTCCTCATGAACTGAATCTGG - Intergenic
1048295064 8:133208020-133208042 TCTCCCTCATGTACAGTAGTGGG + Intronic
1055204643 9:73713255-73713277 TCGTCCTGATTTAATGTAGGAGG - Intergenic
1192905686 X:75547784-75547806 TCCTCCTCATGTACTCTCACCGG + Intergenic