ID: 900106225

View in Genome Browser
Species Human (GRCh38)
Location 1:982255-982277
Sequence ATGAGGACGACTTCCTGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106217_900106225 18 Left 900106217 1:982214-982236 CCACAAATAGATGGCATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 329
Right 900106225 1:982255-982277 ATGAGGACGACTTCCTGGCACGG 0: 1
1: 0
2: 0
3: 7
4: 85
900106223_900106225 -10 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106225 1:982255-982277 ATGAGGACGACTTCCTGGCACGG 0: 1
1: 0
2: 0
3: 7
4: 85
900106220_900106225 -6 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106225 1:982255-982277 ATGAGGACGACTTCCTGGCACGG 0: 1
1: 0
2: 0
3: 7
4: 85
900106216_900106225 23 Left 900106216 1:982209-982231 CCAGGCCACAAATAGATGGCATT 0: 1
1: 0
2: 1
3: 10
4: 130
Right 900106225 1:982255-982277 ATGAGGACGACTTCCTGGCACGG 0: 1
1: 0
2: 0
3: 7
4: 85
900106222_900106225 -7 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106225 1:982255-982277 ATGAGGACGACTTCCTGGCACGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106225 Original CRISPR ATGAGGACGACTTCCTGGCA CGG Intergenic
900106225 1:982255-982277 ATGAGGACGACTTCCTGGCACGG + Intergenic
900701870 1:4053559-4053581 ATGACGAAGACTTGCTTGCATGG + Intergenic
901157305 1:7149296-7149318 AGGAGAAAGACTTTCTGGCAGGG + Intronic
903951940 1:27000845-27000867 ATGAGGAAGACTTCCTGAGGAGG - Exonic
904306969 1:29596196-29596218 ATGAGGAGGACTTCCTGAGCTGG - Intergenic
906200976 1:43960173-43960195 TTGAGGAGGACTTGGTGGCAGGG - Intronic
911792770 1:102039566-102039588 ATGAAGAGGCCTGCCTGGCAAGG + Intergenic
911861800 1:102960780-102960802 ATGAAGATGACTTGCTGGCTAGG + Intronic
914331512 1:146674996-146675018 ATGTGCACCACTTCCAGGCATGG + Intergenic
915462285 1:156077216-156077238 ATGAAAACGACTTCCTGGCGGGG - Exonic
917931190 1:179823950-179823972 ATGAAGATGACCTCCTGGCTGGG - Intergenic
919751987 1:201043487-201043509 AGGTGGACAACTTCCTGGAAAGG - Exonic
924799337 1:247316168-247316190 GTGTGCACGACTTCCTGGGAGGG + Intronic
1063381710 10:5589979-5590001 ATGAAGACGTCTTCCTGGCTGGG + Intergenic
1067286530 10:44911480-44911502 GTGAGGACAAAGTCCTGGCAGGG - Exonic
1069326948 10:67242779-67242801 ATGAGGCAGACTTCCTGCCTTGG - Intronic
1070909952 10:80109270-80109292 ATGAAGAACAATTCCTGGCAAGG - Intergenic
1075227931 10:120646261-120646283 GGGAGGACGGCTTCCTGACATGG - Intergenic
1078456318 11:11478473-11478495 ATGAGGACGGCTTCATCTCAGGG - Intronic
1079418371 11:20261949-20261971 ATGAACATGACTTCCCGGCAGGG + Intergenic
1083336420 11:61924300-61924322 AAGATGACGACTTACTGGCAGGG - Intergenic
1102666611 12:114579527-114579549 AGGAGGACCACTTGCTGACAGGG + Intergenic
1103171352 12:118822810-118822832 ATGAGGATGCCTTTCTGGGAAGG - Intergenic
1105794729 13:23839938-23839960 ATGAGGAGGATTTCCTGTCCTGG - Intronic
1106310242 13:28547957-28547979 CTGAGGTCCACTTTCTGGCATGG - Intergenic
1108387439 13:49913124-49913146 ATGAGAACCACTTTCTGGCTGGG + Exonic
1112001987 13:95219304-95219326 ATGAGCAAGACATACTGGCAGGG + Intronic
1121091701 14:91187482-91187504 ATGAGGGCGGCTGCCTGGCTTGG + Intronic
1121177205 14:91899453-91899475 ATGACGACTTCTTCCTGGCAGGG - Intronic
1121555373 14:94832406-94832428 CTGAGGAAGAATTCCTAGCAAGG + Intergenic
1121916410 14:97840153-97840175 CTGCGGATCACTTCCTGGCAAGG - Intergenic
1122339502 14:101019071-101019093 ATGAGGACCACGTGCTGGCGGGG - Intergenic
1127881642 15:63163347-63163369 AAGAGGACCACATCCTGACAGGG - Intergenic
1137027004 16:35486484-35486506 ATCAGGACTGCTTCCTGACACGG - Intergenic
1140002042 16:71035904-71035926 ATGTGCACCACTTCCAGGCATGG - Intronic
1145207888 17:20994404-20994426 GTGAGCCCGACTTCCAGGCAAGG + Intergenic
1151750365 17:76033779-76033801 CTTAGGAGGACTTCCTGGGAAGG + Intergenic
1154181778 18:12144795-12144817 ATGTGTGAGACTTCCTGGCAGGG - Intergenic
1154182126 18:12146789-12146811 ATGTGTGAGACTTCCTGGCAGGG + Intergenic
1159682938 18:71377767-71377789 ATGGAGACCACTGCCTGGCATGG - Intergenic
1161452241 19:4352943-4352965 AGGAGGAGGACGTTCTGGCAGGG + Exonic
1163217793 19:15893778-15893800 ATGTGGATGACTGCCTGCCAGGG + Intronic
1163934012 19:20424942-20424964 AAGAGGACGGCTTTCTGGTATGG - Intergenic
1166125042 19:40710063-40710085 CTGCAGACGACCTCCTGGCATGG + Exonic
1166278635 19:41774427-41774449 AGGAGGGTGACTTCCTGGAATGG + Intergenic
926107257 2:10160195-10160217 ATCAGGAAGGCTTCCTGGAAAGG - Intronic
926482833 2:13421259-13421281 ATGGGGCCAACTTGCTGGCAGGG + Intergenic
927639008 2:24835072-24835094 ATGGGGAAGACTTCCCGGAAAGG - Intronic
931089989 2:58875543-58875565 TTAAGGAGGACTTCCTGGCAAGG + Intergenic
932439959 2:71728223-71728245 ATGTGCACCACTTCCTGGCCTGG - Intergenic
938062206 2:128262712-128262734 ATGAGGACACCTTCCTAGGAGGG - Intronic
938098504 2:128479273-128479295 ATGATGACACCTTCCTGGCCAGG + Intergenic
939312366 2:140498583-140498605 TAGAGGACGATTTCCTGTCATGG + Intronic
939689397 2:145239008-145239030 CTGAAGACGACTTCCTGACAGGG - Intergenic
940865941 2:158817904-158817926 CTGAGGAAGAGATCCTGGCATGG + Intronic
948398479 2:237664512-237664534 GTGAAGAGAACTTCCTGGCAAGG + Intronic
1178749897 21:35292203-35292225 TTGAGGCCGACCTCCTGGAAGGG - Intronic
1180841786 22:18962329-18962351 ATGAGATCTACTTCCTAGCAGGG - Intergenic
1181888235 22:26038579-26038601 ATGAAGAGGATCTCCTGGCAGGG + Intergenic
1181961256 22:26623247-26623269 ATGAGGACGGCTTCCAGGGCCGG + Exonic
1182475720 22:30575290-30575312 ATGAGGACCAATGCCTGCCAGGG + Intergenic
1184224024 22:43118791-43118813 ATGAGGTCGAACTCCTGGTAGGG - Intronic
1184370049 22:44076386-44076408 AGGAGAACGAATTTCTGGCAGGG - Intronic
950189790 3:10968698-10968720 ATGAGAAGGACTCCCTGGGATGG - Intergenic
953911394 3:46894828-46894850 ATGAGGAAGACTTTGTGGCTAGG + Intronic
956201824 3:66714315-66714337 ATGAGGATGACTGCCTAGAAGGG - Intergenic
962557392 3:136568374-136568396 ATGAGTACGAAATACTGGCAGGG + Intronic
968532879 4:1104493-1104515 ATGAAGACCACTTCCAGGCCTGG - Intronic
969091402 4:4696544-4696566 ATGAGGAAGACTTTCTCTCAAGG + Intergenic
972079792 4:35136598-35136620 ATGAGGAAGACTGGGTGGCAAGG - Intergenic
986712639 5:10499162-10499184 ATGAGCAGTACTTCCTGGCCTGG - Intergenic
1004374028 6:15076321-15076343 TTTAGGACCACTTCCTGGCCTGG - Intergenic
1005602115 6:27437331-27437353 ATGAGGAGGACTCCGTGGAAAGG + Intergenic
1007371704 6:41430457-41430479 AGGAGGACAGCTTCCTGGGAGGG + Intergenic
1011353171 6:86445473-86445495 ATGATGAAGACTTCATTGCATGG - Intergenic
1027197527 7:76040956-76040978 ATGAGGAAAACTCCCAGGCAAGG + Intronic
1028819924 7:95196755-95196777 ATGAAGATGACTTACTGGAAAGG + Intronic
1032495235 7:132356522-132356544 AAGAGGATGACATCCTTGCAGGG - Intronic
1032675487 7:134126421-134126443 ATGAGGGCTACTTCCCTGCAAGG + Intergenic
1040433534 8:47367195-47367217 ATGGAGAGGACTACCTGGCAAGG + Intronic
1041902055 8:62993124-62993146 ATGTGGACGACTTCCAGGCCTGG - Intronic
1052488024 9:29127727-29127749 ATGAGGACAACTGCCCTGCATGG + Intergenic
1056972670 9:91220523-91220545 ATGTGCACAACTTCCTAGCAAGG - Intronic
1058480064 9:105383521-105383543 GGGAGGACGGCTTCTTGGCATGG + Intronic
1060402117 9:123355298-123355320 ACAAGAAGGACTTCCTGGCAGGG + Intergenic
1060485239 9:124042280-124042302 GTGAGGACGACTTTCTGGGCTGG + Intergenic
1061451584 9:130669926-130669948 AAGAGGAGGGCTTCCTGGTAGGG + Intronic
1061677693 9:132227709-132227731 CTGAGGATGGCTCCCTGGCATGG - Intronic
1062091553 9:134681140-134681162 ATGAGGCCGCCTGCCTTGCAGGG + Intronic
1189960848 X:46323618-46323640 ATGAGGAAGAACTCCTGGAAAGG - Intergenic
1193320091 X:80111696-80111718 ATAAGGATGACTGCCTGACATGG + Intergenic
1195755909 X:108198620-108198642 ATGAGGAGGACTGACTGTCACGG - Intronic
1198662189 X:138981752-138981774 ATGAGAAGGGCTTCATGGCATGG - Intronic