ID: 900106228

View in Genome Browser
Species Human (GRCh38)
Location 1:982261-982283
Sequence ACGACTTCCTGGCACGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106220_900106228 0 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 87
900106217_900106228 24 Left 900106217 1:982214-982236 CCACAAATAGATGGCATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 329
Right 900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 87
900106222_900106228 -1 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 87
900106223_900106228 -4 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 87
900106216_900106228 29 Left 900106216 1:982209-982231 CCAGGCCACAAATAGATGGCATT 0: 1
1: 0
2: 1
3: 10
4: 130
Right 900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106228 Original CRISPR ACGACTTCCTGGCACGGGGC CGG Intergenic
900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG + Intergenic
900358130 1:2274566-2274588 GGGACTTCCTGCCATGGGGCAGG - Intronic
901229897 1:7635938-7635960 ACGATTTCCTGGCGTGGGGCTGG - Intronic
901493223 1:9607193-9607215 TTGAGTGCCTGGCACGGGGCTGG + Intronic
903330214 1:22593322-22593344 ACCACCACCTGGGACGGGGCTGG - Exonic
904282184 1:29428344-29428366 ACTTCTTCCTGGCACAAGGCAGG + Intergenic
905627315 1:39497753-39497775 TCAACTTCCTGCCACGGGGTGGG - Intronic
906661849 1:47588499-47588521 AGGACTTCCTGGGATGGGCCTGG + Intergenic
910388959 1:86717351-86717373 ACGACTTCCTGGCACAAAACAGG - Intronic
911925800 1:103830826-103830848 ACAACTGCCTGCCAAGGGGCTGG + Intergenic
912208591 1:107534561-107534583 CCCAGTGCCTGGCACGGGGCTGG + Intergenic
912508718 1:110174130-110174152 ACCCCTTCCTGGGACAGGGCTGG - Intronic
912883495 1:113444144-113444166 ACAACTGCCTGCCATGGGGCTGG - Intronic
1064549491 10:16484502-16484524 ATAGCTTCCTGGCACGGGGGAGG - Exonic
1065311907 10:24424466-24424488 CCGAGTTCCTGGCACAGGCCTGG + Intronic
1075406563 10:122199470-122199492 GAGACTTCCTGGCATGGGGTGGG + Intronic
1076154698 10:128194676-128194698 ATGACTTCCTGGCAGCGGGTTGG + Intergenic
1085302487 11:75466740-75466762 ACGATTTGCTGGCACATGGCGGG + Intronic
1090023864 11:123151077-123151099 ATCACTGCCTGGCACGTGGCAGG - Intronic
1092070523 12:5627795-5627817 AAGACTTCCTGGTAGGGGCCAGG + Intronic
1101467038 12:104958818-104958840 ACACCTGCCTGGCACGGGGAGGG - Intergenic
1118699512 14:68419590-68419612 ACAACATCCTGCCACAGGGCTGG + Intronic
1121584127 14:95051281-95051303 ACGACTACCTGGCACATGGAGGG + Intergenic
1121961320 14:98262860-98262882 ACCTGTTCCTGGCACGGTGCAGG + Intergenic
1122814890 14:104307479-104307501 ACCCCATCCTGGCACTGGGCAGG - Intergenic
1123937361 15:25200443-25200465 ATGACTTCCAGCCACGGGGAAGG - Intergenic
1126804859 15:52337710-52337732 GAGACTTCCTGGGAGGGGGCAGG + Intronic
1129604569 15:77018603-77018625 AGGTCTTCCTGGCATGGGGGAGG + Intronic
1131997597 15:98147256-98147278 AGCACTTCCTGTCACTGGGCAGG + Intergenic
1132302847 15:100787184-100787206 AAGACTTCATGGGACGGGGTGGG + Intergenic
1137558146 16:49485821-49485843 ACTTCTTCCAGGCACAGGGCAGG + Intergenic
1141120079 16:81346803-81346825 AAGACTGCCTGGCAGGAGGCAGG + Intronic
1142070097 16:88087152-88087174 ACGTCAGCCTGGCACGGGGCAGG + Intronic
1142283420 16:89160963-89160985 CCGTCTTCCTGCCACGCGGCTGG + Intergenic
1145009682 17:19360829-19360851 CCCACTGCCTGGCACAGGGCTGG + Intronic
1151349217 17:73521791-73521813 AGGACTTCCTGGTACGCGCCAGG - Intronic
1159021754 18:63149026-63149048 ATGACTTCGTGGCTCTGGGCAGG - Intronic
1160793906 19:935089-935111 CCCCCTTCCTGGCACGTGGCAGG + Intronic
1161866209 19:6833798-6833820 AGGACATCCTGGAACTGGGCAGG + Intronic
1162559453 19:11407583-11407605 ACGACTTCCTGGTTCAGGGAAGG + Intronic
1164581115 19:29435772-29435794 ACGACTGCCTGGCAGGGAGCCGG + Intergenic
1164711860 19:30362515-30362537 ACGACTTCCTTCCACAGGCCTGG - Intronic
1165154279 19:33777777-33777799 GCAACTTCCTGTCACGGGCCTGG + Intergenic
1167746574 19:51354403-51354425 ACGACAGCCTGGAAAGGGGCAGG + Exonic
931117686 2:59182387-59182409 GAGACTTCCTGGGATGGGGCTGG + Intergenic
932414515 2:71565536-71565558 ACGACTTCCTGGAAGAGGGGAGG - Intronic
932575757 2:72961544-72961566 GGGCCTTCTTGGCACGGGGCTGG - Intronic
934657719 2:96124686-96124708 CCTACCTCCTGGCACGGTGCAGG - Intronic
946360990 2:219219193-219219215 ACGGAATCCTGGCTCGGGGCAGG + Intronic
947633259 2:231666892-231666914 ACCCCTTCCTGTCCCGGGGCTGG - Intergenic
947872685 2:233448296-233448318 AGGACTTCGTGGCACGGGTGGGG + Exonic
948626142 2:239269423-239269445 CTGACTTCCTGGCACTGGCCAGG + Intronic
1169414987 20:5408560-5408582 AAGGCTTCCTGGCACCAGGCTGG - Intergenic
1176134736 20:63517479-63517501 ACCAGTATCTGGCACGGGGCAGG - Intergenic
1176247049 20:64102365-64102387 CGGACCTCCTGACACGGGGCGGG - Intergenic
1179471388 21:41613007-41613029 AAGACTTCCCGGCAGAGGGCAGG - Intergenic
1179711787 21:43267778-43267800 ACGAGTTCCTGCCACGTGCCAGG + Intergenic
1180045799 21:45304559-45304581 ATGACTGCCAGGCACGGAGCAGG - Intergenic
1183084945 22:35480993-35481015 AGAACTTCCAGGCACTGGGCTGG - Intergenic
1183708128 22:39487526-39487548 AGGGCCTCCTGGCTCGGGGCTGG - Exonic
1185163089 22:49241309-49241331 GTGACTTCCTGGGAAGGGGCCGG - Intergenic
950880282 3:16317637-16317659 AGGATTACCAGGCACGGGGCTGG + Intronic
950940039 3:16883888-16883910 ACGAGTTCCGTGCGCGGGGCTGG + Intronic
951473194 3:23078119-23078141 AAGACTTCCAGTCTCGGGGCCGG + Intergenic
955377383 3:58409383-58409405 TCTACTTCCTGGCTCGGGTCTGG - Intronic
956573622 3:70726168-70726190 AAGACTGCCTGGCATGTGGCAGG - Intergenic
957237104 3:77607901-77607923 GCCCCTTCCTGGCACGGAGCTGG + Exonic
958790233 3:98643741-98643763 AGGACTTCCAGGCTCTGGGCTGG + Intergenic
976629902 4:87225469-87225491 ACTACTTCCTGCCAAGGGCCAGG + Intronic
985950936 5:3220859-3220881 ACGCCTGCCTGGCAAAGGGCTGG - Intergenic
990236700 5:53776590-53776612 ACCACTTCCTGTCACTGGACAGG + Intergenic
990544997 5:56814573-56814595 AGCACTTCCTGGCACAGCGCTGG + Intergenic
992306653 5:75447091-75447113 ACAGCTGCCTGCCACGGGGCTGG + Intronic
998206021 5:140157418-140157440 GTGACTTCCTGACAGGGGGCGGG + Intergenic
1000030839 5:157399752-157399774 ACAGCTTCCTGCCATGGGGCAGG - Intronic
1001315777 5:170640346-170640368 ATGTCTTTCTAGCACGGGGCTGG - Intronic
1002896308 6:1382344-1382366 GGGGCTGCCTGGCACGGGGCAGG + Intergenic
1004378950 6:15115712-15115734 ACCGCTTCCTGGTACGTGGCAGG + Intergenic
1010794835 6:80106765-80106787 TCGGCTTCCTGGCGCGGGGCTGG + Exonic
1018980503 6:168598440-168598462 AAGACTTCCAGCCACAGGGCTGG + Intronic
1023600988 7:41881719-41881741 TCCACTTCCTGTCACGAGGCTGG + Intergenic
1024669225 7:51577114-51577136 AAGTCTTCCTGGCTCTGGGCTGG + Intergenic
1026652207 7:72225383-72225405 ACCATTCCCTGGCACGGGGGAGG + Intronic
1030826085 7:114160028-114160050 ATTCCTTCCTGGTACGGGGCAGG + Intronic
1033661908 7:143408441-143408463 GCTACTTCCTGGCAAGGGTCCGG + Intronic
1036177359 8:6551350-6551372 ACGCCTTCATGGCACGGGACAGG + Intronic
1038656784 8:29460087-29460109 AAGCCTTGCTGGCAAGGGGCAGG - Intergenic
1039198223 8:35056441-35056463 ACAACTGCCTGCCACAGGGCTGG + Intergenic
1062443757 9:136584804-136584826 ACGAGGTTGTGGCACGGGGCAGG - Intergenic
1062465161 9:136677654-136677676 GGGCCCTCCTGGCACGGGGCAGG + Intronic
1062535790 9:137020574-137020596 AGGACTTCGGGGCACAGGGCAGG + Intronic
1195005137 X:100678407-100678429 ATGACTTCCTGGGAGGGGTCAGG - Exonic
1199746657 X:150776039-150776061 CAGACTTCCTGGGACGGGGGTGG - Intronic