ID: 900106229

View in Genome Browser
Species Human (GRCh38)
Location 1:982262-982284
Sequence CGACTTCCTGGCACGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106220_900106229 1 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106229 1:982262-982284 CGACTTCCTGGCACGGGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
900106217_900106229 25 Left 900106217 1:982214-982236 CCACAAATAGATGGCATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 329
Right 900106229 1:982262-982284 CGACTTCCTGGCACGGGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
900106222_900106229 0 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106229 1:982262-982284 CGACTTCCTGGCACGGGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
900106223_900106229 -3 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106229 1:982262-982284 CGACTTCCTGGCACGGGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
900106216_900106229 30 Left 900106216 1:982209-982231 CCAGGCCACAAATAGATGGCATT 0: 1
1: 0
2: 1
3: 10
4: 130
Right 900106229 1:982262-982284 CGACTTCCTGGCACGGGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106229 Original CRISPR CGACTTCCTGGCACGGGGCC GGG Intergenic
900106229 1:982262-982284 CGACTTCCTGGCACGGGGCCGGG + Intergenic
901251606 1:7783978-7784000 CGGCCCCCTGGCACGGCGCCGGG - Intergenic
901493224 1:9607194-9607216 TGAGTGCCTGGCACGGGGCTGGG + Intronic
901684713 1:10937494-10937516 CTGCTGCCTGGCACGGGGACAGG + Intergenic
902987320 1:20162780-20162802 CTACTGCCTGGCACTGTGCCTGG + Intronic
903665839 1:25006972-25006994 CCCTTTCCTGGCACAGGGCCAGG - Intergenic
905004202 1:34697189-34697211 CAAATGCCTGGCACGGTGCCTGG + Intergenic
905500858 1:38435162-38435184 CTAGCTCCTGGCACAGGGCCTGG - Intergenic
905627314 1:39497752-39497774 CAACTTCCTGCCACGGGGTGGGG - Intronic
905846989 1:41241842-41241864 CGGCCTCCGGGCTCGGGGCCGGG + Intronic
906211078 1:44012572-44012594 CCACTTCCTGGCACAGTGCCTGG - Intronic
906320081 1:44810298-44810320 CGACTTCTGGGCACAGAGCCAGG + Exonic
907400159 1:54220313-54220335 GGACTGCCTGGAAGGGGGCCAGG + Intronic
908252930 1:62279421-62279443 AGAATTCCAGGCACTGGGCCAGG + Intronic
912775984 1:112506825-112506847 CGACTTCCTGGCACAGAAACTGG - Intronic
920496110 1:206455968-206455990 CATCCTGCTGGCACGGGGCCAGG - Intronic
920987555 1:210904767-210904789 GGAATTCCTGGCATGGTGCCTGG - Intronic
922803312 1:228373717-228373739 CCACCTCCAGGCACGGGGTCAGG - Intronic
1074599576 10:114900142-114900164 CAACTTCCTGCCACAGGGGCAGG + Intergenic
1075227929 10:120646254-120646276 CGGCTTCCTGACATGGGCCCAGG - Intergenic
1075406564 10:122199471-122199493 AGACTTCCTGGCATGGGGTGGGG + Intronic
1079005022 11:16785458-16785480 CTAGTCCCTGGCACAGGGCCTGG - Intronic
1080272671 11:30467336-30467358 GGAATTCCTGGCAAGGGGGCAGG + Intronic
1080895814 11:36448155-36448177 GGGCTACCTGGCACAGGGCCCGG - Intronic
1081771658 11:45653982-45654004 GGACTTCCTAGCACGTTGCCTGG - Intronic
1083815521 11:65130428-65130450 CAACTCCCAGGCAGGGGGCCTGG + Intronic
1084481110 11:69420764-69420786 GGCCTACCTGCCACGGGGCCAGG - Intergenic
1090271304 11:125388159-125388181 CCACTTCCTGACACAGGACCAGG - Intronic
1100731088 12:97470368-97470390 CCACTGCCTAGCACGGTGCCTGG + Intergenic
1103235580 12:119369787-119369809 CCAGTACCTAGCACGGGGCCTGG + Intronic
1103905814 12:124326744-124326766 TGACTTCTCTGCACGGGGCCTGG - Intronic
1113615703 13:111679048-111679070 GGGCTTCCTGGCACGGGCCCAGG - Intergenic
1113621171 13:111763950-111763972 GGGCTTCCTGGCACGGGCCCAGG - Intergenic
1114063446 14:19039355-19039377 CGCATTCCTGGCACCAGGCCTGG + Intergenic
1114098810 14:19360641-19360663 CGCATTCCTGGCACCAGGCCTGG - Intergenic
1116615159 14:47126759-47126781 AGACTTCCTGGCAGATGGCCTGG - Intronic
1120924011 14:89780126-89780148 CCAGTGCCTGGCATGGGGCCTGG + Intergenic
1121495080 14:94386474-94386496 TCACTTACTGGCAGGGGGCCTGG + Intronic
1122307758 14:100776493-100776515 CTGCTTCCTGGCCAGGGGCCTGG + Intergenic
1122470702 14:101964308-101964330 CAACGTCCTGGCTCGGCGCCCGG - Intergenic
1128291635 15:66482667-66482689 CTAGTGCCTGGCATGGGGCCTGG + Intronic
1128588667 15:68875129-68875151 CAAATTCCTAGCACCGGGCCTGG + Intronic
1130195194 15:81772802-81772824 TTACTTCCTGGCACAGGACCTGG - Intergenic
1131269778 15:90940024-90940046 CCAGTTCCTGGCACAGGGCGTGG - Intronic
1133227911 16:4351266-4351288 CGACTTCCTGGCCCCGCGGCCGG + Exonic
1135201323 16:20439995-20440017 CCAGTGCCTGGCACAGGGCCTGG - Intronic
1135217785 16:20587869-20587891 CCAGTGCCTGGCACAGGGCCTGG + Intergenic
1136249116 16:28992060-28992082 AGAATTCCTGGAACTGGGCCGGG + Intergenic
1142070098 16:88087153-88087175 CGTCAGCCTGGCACGGGGCAGGG + Intronic
1143027244 17:3948084-3948106 CCAGTGCCTAGCACGGGGCCGGG + Intronic
1144793280 17:17873828-17873850 GGCCTCCATGGCACGGGGCCAGG + Intronic
1145009684 17:19360830-19360852 CCACTGCCTGGCACAGGGCTGGG + Intronic
1145794694 17:27648984-27649006 CGGCTTCCTGGCCCTGGGGCCGG + Exonic
1146251774 17:31352340-31352362 GGATTTCCTGGCTCGGGGACTGG - Exonic
1148079495 17:44959968-44959990 CGGTTCCCTGGCACGGGGACAGG + Exonic
1149350344 17:55780353-55780375 CCACTGCCTGGCAGTGGGCCTGG - Intronic
1150618622 17:66791592-66791614 CGGCTGCCTGGCACGGGGCAAGG - Intronic
1150631886 17:66885582-66885604 CAACTTCATGGCCCTGGGCCAGG + Intergenic
1150788820 17:68183992-68184014 AGAGCTCCTGGCACAGGGCCTGG + Intergenic
1151447346 17:74175910-74175932 CTTATTCCTGGCACAGGGCCAGG - Intergenic
1154450648 18:14473360-14473382 CGCATTCCTGGCACCAGGCCTGG - Intergenic
1158633707 18:59138452-59138474 GGACTTCCTGCCACGGTGCCAGG + Intergenic
1158916622 18:62137921-62137943 TGACTTCCTGGCACTTGGCTTGG - Intronic
1159927557 18:74282492-74282514 TGACTTCCTGGCACCGGACATGG + Intronic
1160665703 19:327078-327100 CGACTGCCTGGCAGGGGGCCTGG + Intronic
1160691057 19:460852-460874 CGGCTTCCTGGGCCGCGGCCCGG - Exonic
1160909285 19:1467438-1467460 CGTCCTCCTGGGCCGGGGCCGGG - Exonic
1161319191 19:3633218-3633240 CCAGTCCCTGGCAGGGGGCCTGG - Intronic
1161541096 19:4851957-4851979 CGGCTTCCGGTCAGGGGGCCTGG + Intronic
1161925137 19:7294147-7294169 CGAGATCCTGGGACGGGGCCCGG - Intergenic
1162496018 19:11023859-11023881 CCACTTCCTGTCAGGGGGCCAGG + Intronic
1162833490 19:13301455-13301477 CGCCTTCCTGTCATGGGGGCTGG - Intronic
1163521509 19:17794796-17794818 CGGGTTCCTGGCACAGAGCCCGG - Intergenic
1164581116 19:29435773-29435795 CGACTGCCTGGCAGGGAGCCGGG + Intergenic
1165154280 19:33777778-33777800 CAACTTCCTGTCACGGGCCTGGG + Intergenic
1166953066 19:46443269-46443291 TTGCTTCCTGGCACAGGGCCTGG + Intergenic
1167053431 19:47094341-47094363 CCACTGCCTGGCATTGGGCCTGG - Intronic
1168124713 19:54277114-54277136 CCGCTTCCTGGCTGGGGGCCCGG - Intronic
926298996 2:11588949-11588971 CCACTCCCTGCCACTGGGCCAGG - Intronic
928658408 2:33476542-33476564 TGACCTCCTGGCACGGTGGCGGG + Exonic
934657718 2:96124685-96124707 CTACCTCCTGGCACGGTGCAGGG - Intronic
935555437 2:104504890-104504912 CCACGTCCTGGCAGGGGGACGGG - Intergenic
936472730 2:112813143-112813165 CCAGCTCCTGGCACGGTGCCTGG - Intergenic
938480786 2:131659520-131659542 CGCATTCCTGGCACCAGGCCTGG + Intergenic
947766570 2:232641709-232641731 CGACTGCCTAGCATGGGGGCTGG - Intronic
947931464 2:233968436-233968458 CGACTGCTTTGCACTGGGCCGGG - Intronic
948220359 2:236264681-236264703 CCTCTTCCTGGCACTGGGCTTGG + Intergenic
1172631127 20:36378917-36378939 CCAGTCCCTGGCACGAGGCCCGG - Intronic
1173579613 20:44137688-44137710 CCAGTACCTGGCACGGTGCCTGG - Intronic
1176110248 20:63407685-63407707 CGACTTCCTGGGAGTGGTCCAGG - Intronic
1176138270 20:63534514-63534536 TGGCTGCCTGGCACGGGGGCAGG - Intronic
1176159027 20:63639274-63639296 GGACTTCCTGACATGGGGGCAGG - Intergenic
1176247048 20:64102364-64102386 GGACCTCCTGACACGGGGCGGGG - Intergenic
1179150839 21:38806571-38806593 TGACTTCCTGGAGCGGCGCCGGG + Intronic
1179546806 21:42118096-42118118 CCACTTCCTAGCAAGGGGCCTGG + Intronic
1179605649 21:42513836-42513858 CGACTTCCTGGAGCGGCGCGCGG - Intronic
1180481940 22:15761989-15762011 CGCATTCCTGGCACCAGGCCTGG + Intergenic
1181064698 22:20299859-20299881 CCACGTCCTGGCACGGCCCCTGG - Intergenic
1181624603 22:24114681-24114703 AGACTTCCTGGGACAAGGCCTGG - Intronic
1181822519 22:25487143-25487165 TGAATTCCTGGCACGGTGCCAGG + Intergenic
1182106479 22:27693441-27693463 CCAGGTCCTGGCACAGGGCCTGG + Intergenic
1185171628 22:49297826-49297848 CCACAGCCTGGCATGGGGCCGGG - Intergenic
950722969 3:14897963-14897985 CGTCTTCCTGGCCCGGGAGCAGG + Exonic
951473195 3:23078120-23078142 AGACTTCCAGTCTCGGGGCCGGG + Intergenic
951527757 3:23670146-23670168 ACACTTCCTGGCACTGGGCCTGG - Intergenic
954682513 3:52353372-52353394 CCACTTCCTGGCAGGCTGCCGGG - Exonic
955953979 3:64269169-64269191 CTAGTACCTGGCATGGGGCCTGG - Intronic
969442866 4:7227633-7227655 CGACTCCCTGGCAATGGGGCTGG - Intronic
969872987 4:10116386-10116408 CGACTTCCTGGTCCGCGCCCCGG + Intronic
982312755 4:154002831-154002853 CAGCTTCCTGCCAAGGGGCCTGG - Intergenic
986566361 5:9119027-9119049 CCACTCCCAGGCACGGGGGCCGG - Exonic
987211008 5:15683370-15683392 TGACTCCCTGACACGGGTCCTGG - Intronic
987819742 5:22947595-22947617 AGACTTCCTAGAACAGGGCCAGG + Intergenic
992482808 5:77168314-77168336 TTCCTTCCTGGCACGGGGGCTGG + Intergenic
998206022 5:140157419-140157441 TGACTTCCTGACAGGGGGCGGGG + Intergenic
999626292 5:153524030-153524052 AGAATTCCTGGCACAGGGCCAGG + Intronic
999727053 5:154446129-154446151 CGGCCTCCTCGCGCGGGGCCCGG - Exonic
1000293651 5:159894052-159894074 CACCTACCTGGCAAGGGGCCAGG + Intergenic
1000658387 5:163909624-163909646 AGACTTCCTTGCACGGGGTCTGG + Intergenic
1002512756 5:179733373-179733395 CGGCGTCCAGGCGCGGGGCCGGG - Exonic
1002896309 6:1382345-1382367 GGGCTGCCTGGCACGGGGCAGGG + Intergenic
1007695143 6:43727254-43727276 ACACTTCCTAGCACAGGGCCTGG + Intergenic
1013211654 6:107992233-107992255 CAACTTGCTGCCAAGGGGCCAGG + Intergenic
1017847254 6:158269856-158269878 AGACTGCCGGGCACCGGGCCTGG - Intronic
1018909005 6:168091251-168091273 CGCCTTCCCGACACAGGGCCAGG + Intergenic
1019343929 7:520576-520598 CGACTTCCCGGCTCAGGGCGCGG - Intergenic
1019361009 7:604162-604184 CCACCTCCTGGGACGGGCCCAGG + Intronic
1021580825 7:22151152-22151174 CTAAGTACTGGCACGGGGCCTGG + Intronic
1022178568 7:27896001-27896023 CCAGTTCCTAGCACAGGGCCAGG + Intronic
1023098518 7:36688736-36688758 TGAATTCCTGGCACAGTGCCTGG + Intronic
1023600990 7:41881720-41881742 CCACTTCCTGTCACGAGGCTGGG + Intergenic
1030138925 7:106285325-106285347 CGAGTTCCCGGCACGGGCGCGGG + Intronic
1031887585 7:127257264-127257286 AGACTTGCTGGGATGGGGCCTGG + Intergenic
1035471516 7:159112774-159112796 CGCCTGCCTGGGACGGGACCCGG + Intronic
1049186598 8:141258190-141258212 CGACTTCCTGACCCTAGGCCAGG - Intronic
1049470904 8:142774612-142774634 AGACTTCCTAGCACAGGGGCCGG + Intronic
1049571298 8:143371451-143371473 GGACTGCCTGGCCCAGGGCCAGG + Intronic
1049762439 8:144337365-144337387 CGCCTGCCTCGCTCGGGGCCTGG + Intergenic
1055597593 9:77881313-77881335 ACACTGCCTGGCACGTGGCCAGG + Intronic
1057440946 9:95082833-95082855 CGGCTCCCTGGCCCAGGGCCTGG + Intronic
1060258358 9:122052492-122052514 GGACCACCTAGCACGGGGCCTGG + Intronic
1060296412 9:122346674-122346696 CCAGTGCCTGGCACAGGGCCTGG + Intergenic
1060414563 9:123421210-123421232 AGATCTCCTAGCACGGGGCCTGG - Intronic
1060916954 9:127397496-127397518 CGTCGTCCAGGCGCGGGGCCGGG - Exonic
1061485078 9:130916416-130916438 CGAGATCCTAGCACAGGGCCCGG - Intronic
1062144248 9:134980057-134980079 CTCCTTCCTGCCACAGGGCCAGG - Intergenic
1190740827 X:53287786-53287808 CCACTTCCTGGGGCTGGGCCAGG + Intronic
1192183139 X:68928870-68928892 CCACTTCCTCGCACAGTGCCTGG + Intergenic
1192260923 X:69505482-69505504 CAGCTCCCTGGCCCGGGGCCGGG - Exonic
1192807534 X:74523632-74523654 CCACTTCCTGTCAAGGAGCCAGG + Intronic
1200062024 X:153487981-153488003 TCCCTTCCTGGCACAGGGCCTGG - Intronic
1200064024 X:153496295-153496317 AGCCTTTCTGGCACGGGGGCAGG - Intronic