ID: 900106231

View in Genome Browser
Species Human (GRCh38)
Location 1:982268-982290
Sequence CCTGGCACGGGGCCGGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 501}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106223_900106231 3 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106231 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 5
3: 53
4: 501
900106222_900106231 6 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106231 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 5
3: 53
4: 501
900106220_900106231 7 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106231 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 5
3: 53
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106231 Original CRISPR CCTGGCACGGGGCCGGGCTG AGG Intergenic
900000279 1:11045-11067 AGTCGCACGGCGCCGGGCTGGGG + Intergenic
900019984 1:181559-181581 AGTCGCACGGCGCCGGGCTGGGG + Intergenic
900106231 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG + Intergenic
900119846 1:1043900-1043922 CCACACACGGGGCCGGGCGGGGG - Exonic
900120353 1:1046243-1046265 CCTGGCACGGGCCCAGGCTCTGG - Exonic
900159599 1:1217291-1217313 CGGGGCGCGGGGCTGGGCTGTGG - Exonic
900223837 1:1523611-1523633 CCTGGAGCTGGGCCGGGCTGTGG + Intronic
900386323 1:2412620-2412642 GCTGGGGCGGGGCCGGACTGGGG + Intronic
900393500 1:2443842-2443864 CCGGGCTCGGGCTCGGGCTGGGG - Intronic
900401946 1:2476267-2476289 CCTGGGGCTGGGCGGGGCTGAGG + Intronic
900431844 1:2606411-2606433 ACCGACAAGGGGCCGGGCTGGGG - Intronic
900593840 1:3471577-3471599 CCTGGCTGGGGGCAGAGCTGGGG - Intronic
900690798 1:3979097-3979119 GCTGGCCCGGGGCCGGGCCCTGG - Intergenic
900917868 1:5651063-5651085 CCTGTCACAGGGCAGGGCTATGG + Intergenic
900979947 1:6040660-6040682 CCTGGGAGGGGGCCTGGGTGAGG - Intronic
900983791 1:6061351-6061373 CCCAGCACCGGGCCGGGCGGGGG + Intronic
901025660 1:6277527-6277549 GCTAGGACGGGGCAGGGCTGGGG - Intronic
901034302 1:6327116-6327138 CATGGCTCAGGGCGGGGCTGGGG + Intronic
901063697 1:6485305-6485327 CCAGGTACGGGGCCGGGACGGGG - Intronic
901638251 1:10680258-10680280 GATGGCACGGGGCGGGGCGGCGG + Intronic
901650508 1:10740290-10740312 ACTGGAACGGGGCAGAGCTGGGG - Intronic
901758033 1:11453283-11453305 GCTGGCTGGGGGCTGGGCTGGGG - Intergenic
901844122 1:11971270-11971292 TCTGGCAAGGGGAGGGGCTGGGG + Intronic
902311587 1:15585199-15585221 CCTGGCACAGTGCCGGCCAGTGG - Intronic
902392588 1:16115094-16115116 CCTGGAAGGGGGCTTGGCTGGGG + Intergenic
902481186 1:16712765-16712787 ACTGGCAGTGGGGCGGGCTGCGG - Intergenic
902562187 1:17284489-17284511 CAAGGCTAGGGGCCGGGCTGTGG + Intergenic
902772547 1:18653987-18654009 CCTGCGACAGGGCTGGGCTGGGG - Intronic
902786717 1:18737282-18737304 GCTGGCCCAGGGCTGGGCTGGGG - Intronic
902931452 1:19734541-19734563 CCTGGCACTGTGCCAGGCTAAGG - Intronic
903035714 1:20491382-20491404 AATGGCATGGGGCCGGGCAGGGG + Intergenic
903164144 1:21509304-21509326 GCGGGGCCGGGGCCGGGCTGGGG + Intergenic
903222893 1:21878682-21878704 CAGGGCATGGGGCAGGGCTGGGG + Intronic
903325704 1:22567445-22567467 CCTGGCGTGGGGCCGGCTTGGGG + Intronic
904221714 1:28975823-28975845 CCGGGCATGGTGGCGGGCTGAGG + Intronic
904418758 1:30378191-30378213 CCTGGGAGGGGGCCTGGCAGTGG + Intergenic
904458816 1:30663434-30663456 CCTGCCAAGGGGCCTGGCAGTGG - Intergenic
904616553 1:31753186-31753208 ACTGGCACGGAGGCTGGCTGAGG - Intronic
905630379 1:39515056-39515078 CTTGGCACGGGGCCGGGGACTGG - Intronic
906062537 1:42958186-42958208 CCGGGGCCGGGGCCGGGCCGGGG + Intronic
906390213 1:45408698-45408720 CCTGGCAAGTGGCAGGGTTGAGG + Intronic
906536983 1:46556458-46556480 CCTCCCACTAGGCCGGGCTGGGG + Intergenic
906551472 1:46669323-46669345 CCTCGCACAGGGCAGGGCTCAGG - Intronic
907258357 1:53197117-53197139 CCTGGGACGGCGGCGGGCGGCGG - Intronic
907502077 1:54887928-54887950 CCTGGCACAGAGCGGGCCTGGGG - Intergenic
910257046 1:85259144-85259166 CCTCACAAGGGGCGGGGCTGCGG + Intronic
910981078 1:92961030-92961052 CCTGGAGCGGCGCAGGGCTGCGG + Intronic
911042381 1:93600880-93600902 CCAGGCACTGGGCCAGGCTCTGG - Intronic
913489412 1:119364907-119364929 CCAGGCTCTGGGCCGGGCAGTGG + Intergenic
914916254 1:151821166-151821188 GCTGGCACAGGGCCAGGCTCTGG - Intronic
915367326 1:155323519-155323541 GGTGGCCCGGCGCCGGGCTGCGG + Intronic
915599699 1:156914415-156914437 CCTGGGAGGTGGGCGGGCTGAGG + Intronic
915625581 1:157112124-157112146 CCTGGCACCGGGCAGGGTGGGGG + Intergenic
915903484 1:159862454-159862476 CCAGGTACGGGGCTGGGCAGGGG - Exonic
916365080 1:164017421-164017443 TCTGGCACTGGGCCAGTCTGAGG - Intergenic
920190680 1:204191757-204191779 CCTTGCCCAGGGCCTGGCTGAGG + Intronic
921029706 1:211326773-211326795 CCTGGGGCGGGGCCGGGGCGCGG - Intronic
922502873 1:226110021-226110043 CCGGGCGCGCGGCCGGGCGGGGG + Intergenic
922698499 1:227744085-227744107 CCTGCCACGGTGGCGTGCTGTGG + Intronic
922720800 1:227899345-227899367 CAGGGCACTGGGCCAGGCTGAGG + Intergenic
924948547 1:248862766-248862788 CCTGGAGCTGGGCTGGGCTGAGG - Intergenic
1062879647 10:967653-967675 CCTGACACTGGGCCAGGCGGAGG + Intergenic
1063458761 10:6202727-6202749 CCAGGCCCGGGGCAGGGCGGCGG + Intronic
1064392552 10:14954247-14954269 CCTTGCACTGGGCAGGGCTCAGG - Intronic
1064981895 10:21173920-21173942 CCTGGCAGGCGGGAGGGCTGCGG + Intronic
1065187126 10:23179179-23179201 CCTGGGATGAGGCTGGGCTGTGG + Intergenic
1067038228 10:42934342-42934364 CCTGGCAGGGTCCAGGGCTGGGG + Intergenic
1067448437 10:46367087-46367109 CCTGGCTCTGGGCTGGGCAGTGG + Intergenic
1067478014 10:46578949-46578971 CCTGGGCCAGGGACGGGCTGGGG + Intronic
1067588938 10:47493679-47493701 CCTGGCTCTGGGCTGGGCAGTGG - Intergenic
1067636064 10:48001770-48001792 CCTGGCTCTGGGCTGGGCAGTGG - Intergenic
1067877424 10:50018555-50018577 CCTGGCTCTGGGCTGGGCAGTGG + Intergenic
1069856833 10:71445706-71445728 CCTGGCATGGGGCATGCCTGTGG + Intronic
1070132624 10:73665777-73665799 CCTGGCTCTGGGCTGGGCAGTGG - Intergenic
1070827363 10:79399081-79399103 CCTGACACTGGACTGGGCTGAGG - Intronic
1072803748 10:98411039-98411061 CATGGCATGGGGACGGGCAGCGG - Intronic
1072881620 10:99234307-99234329 CCTGGCCCGGGTCGGGTCTGCGG - Intronic
1073206199 10:101770732-101770754 CCAGGCAGGGGGTGGGGCTGCGG - Intronic
1075334177 10:121597229-121597251 TCGGCCACGGGGCCGCGCTGGGG - Intronic
1075903275 10:126060681-126060703 GCTGGCCAGGGGCCTGGCTGAGG + Intronic
1076107979 10:127839496-127839518 CCTGTCATGGGGCAGGGGTGAGG + Intergenic
1076108829 10:127845832-127845854 CATGGGAAGGGGCCAGGCTGAGG - Intergenic
1076139068 10:128065112-128065134 CCTGGCTCCGGGCGGGGCTGCGG - Intronic
1076350430 10:129811508-129811530 CCTGGCACGGACCAGGGCGGTGG - Intergenic
1076603862 10:131676999-131677021 CCTGGGGCGGGGCCGGGGGGAGG - Intergenic
1076700844 10:132271859-132271881 CCTGGGAAGGGGCAGGGCCGTGG - Intronic
1076841411 10:133047662-133047684 CCTCGCACGGGCCGGGGGTGGGG - Intergenic
1077060333 11:615067-615089 CCCGGGGCGGGGCGGGGCTGGGG + Intronic
1077100128 11:818985-819007 GCGGGCGCGGGGCAGGGCTGAGG + Intronic
1077105124 11:838909-838931 CCTGACACTGGGCGGGGCGGGGG - Intronic
1077229750 11:1453468-1453490 CCTGGCATGGGGCTGGGGTAAGG + Intronic
1077408829 11:2394217-2394239 CCTGGGCCGGGGAGGGGCTGGGG + Intronic
1077506158 11:2930841-2930863 CCTGGCAGTGGGCAGGGATGTGG + Intergenic
1078301172 11:10133435-10133457 CCTCCCACGGGGCAGGGCTCGGG - Intronic
1078428610 11:11270444-11270466 CCTGGCGAGGGGCTGGGCCGGGG + Intergenic
1078541467 11:12216915-12216937 CCTGGCACAGTGCCCGGCAGAGG + Intronic
1079102986 11:17552943-17552965 CCAGGGAGGGGGCAGGGCTGTGG + Intronic
1079122517 11:17695908-17695930 CCGGGGCCGGGGCCGGGCCGGGG + Intergenic
1081598066 11:44473010-44473032 CCTGGCACAGTGCCGGGCTCAGG + Intergenic
1081734738 11:45394840-45394862 CCTGGCAGGGGCTGGGGCTGGGG + Intergenic
1081989778 11:47331688-47331710 CCTGGCACGGGGCTGGCATCCGG + Exonic
1083214034 11:61207394-61207416 CCTGGCCCTGGGACGGGCTCTGG - Intronic
1083216918 11:61226223-61226245 CCTGGCCCTGGGACGGGCTCTGG - Intronic
1083219800 11:61245049-61245071 CCTGGCCCTGGGACGGGCTCTGG - Intronic
1083254910 11:61489983-61490005 CCTGGCACACGGCCTGGATGAGG - Intronic
1083331352 11:61899899-61899921 CCTGGCATGGAGCAGGCCTGAGG - Intronic
1083637515 11:64128536-64128558 CCTGGCACGCCGCCCGCCTGAGG + Intronic
1083849005 11:65354694-65354716 CTTGGGCCGGGGCGGGGCTGCGG + Intergenic
1083933929 11:65860653-65860675 CCTGGCCCAGGGCGGGGCGGGGG - Exonic
1083941819 11:65900126-65900148 CCGGAGTCGGGGCCGGGCTGGGG - Intronic
1084176257 11:67423882-67423904 CCAGGCATTGGGCTGGGCTGGGG + Exonic
1084603621 11:70160590-70160612 CCTGGGATGGGGCAGGGCTTTGG - Intronic
1084892779 11:72244565-72244587 CCTCGCTGGGGGCGGGGCTGAGG - Intronic
1084973059 11:72781777-72781799 CCCGGGGCGGGGCCGGGCGGCGG - Intronic
1085120681 11:73965529-73965551 CCTGGCACAGGGCTGGGCCATGG - Intronic
1085724375 11:78941578-78941600 CCTGGCACGGCGCCGGGGCGGGG + Intronic
1087014599 11:93543180-93543202 CCGGGCACCGGGCGGGGGTGCGG - Intronic
1089011571 11:115136119-115136141 CCTGCCACCGGGCCGTCCTGTGG - Intergenic
1089572700 11:119420843-119420865 CCCGGCATGGGGCAGGACTGGGG - Intronic
1089606060 11:119642077-119642099 CCAGGCACTGTGCAGGGCTGGGG - Intronic
1089678947 11:120108887-120108909 CCTGGCACGTGGGCGGGCCTTGG - Intergenic
1089742954 11:120597489-120597511 CCTGCCACGGGGCTCAGCTGGGG - Intronic
1090788401 11:130069688-130069710 CCGGGGGCGGGGCCGGGCGGGGG + Intergenic
1091373364 12:11173-11195 AGTCGCACGGCGCCGGGCTGGGG + Intergenic
1091459140 12:630806-630828 AGGGGCACGAGGCCGGGCTGGGG - Intronic
1093090409 12:14913764-14913786 ACTGGCAGTGGGACGGGCTGAGG - Intergenic
1094025749 12:25958661-25958683 CTGGGCTGGGGGCCGGGCTGGGG - Intergenic
1095097399 12:38155831-38155853 CCTGGCCCGGGGGCGGGGGGGGG + Intergenic
1096796760 12:54082598-54082620 CCGGGGCCGGGGCCGGGCTGGGG + Intergenic
1097249489 12:57624733-57624755 CCTGGCACTTGGACAGGCTGAGG + Intronic
1097793996 12:63843732-63843754 CGGCGCGCGGGGCCGGGCTGCGG + Intergenic
1099968358 12:89474987-89475009 CCTGGCACTGGGCACTGCTGTGG + Intronic
1102006985 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG + Intronic
1102030523 12:109737673-109737695 ACTGGCACAGGGCTTGGCTGTGG - Intronic
1103074203 12:117969091-117969113 CCGGGGCCGGGGCCCGGCTGGGG - Intergenic
1103363807 12:120368739-120368761 CAGGGCGCAGGGCCGGGCTGGGG + Intronic
1103509942 12:121467298-121467320 CCTGGCTCGGGCTCGGGCTCGGG + Intronic
1103713087 12:122927684-122927706 ACTGGAACGGGGCTGGGCTGGGG + Intronic
1103839167 12:123848753-123848775 CCTGGCACAGTGCGGGGCTTGGG + Exonic
1103894097 12:124261902-124261924 CATGGCTCGGGGCCGGCCTGGGG - Intronic
1104443919 12:128818511-128818533 CATGGCAGGAGGCCTGGCTGGGG - Intronic
1104568310 12:129903972-129903994 CCCGGCCCCGGGCCCGGCTGGGG + Intergenic
1104658498 12:130591949-130591971 CCTGGGACGTGGCTCGGCTGGGG - Intronic
1104902353 12:132196407-132196429 ACAGGCAAGGGGCTGGGCTGCGG + Exonic
1105308945 13:19189446-19189468 CCTGGCACCTGCCCGGGGTGTGG + Intergenic
1105528655 13:21198705-21198727 CCTGGCACCTGCCCGGGATGTGG - Intergenic
1106157294 13:27171176-27171198 CCCGGCCCGGGGCCGCGCTCTGG + Intronic
1106570703 13:30924672-30924694 CATGGCACTGGGTGGGGCTGGGG + Exonic
1107831995 13:44382788-44382810 CCTGGCACTGTGCCGGGCTTTGG + Intronic
1108555182 13:51584629-51584651 CGCGCCGCGGGGCCGGGCTGAGG - Exonic
1108703124 13:52960451-52960473 CCTGGTACGGGGCGAGACTGAGG + Intergenic
1109175242 13:59147208-59147230 CCTGTCAGGGGGTGGGGCTGGGG + Intergenic
1113589202 13:111486449-111486471 CCAGGCACGGGCCTGGGCAGAGG - Intergenic
1114031490 14:18584102-18584124 CCGGGCTCGGGCCCCGGCTGAGG + Intergenic
1114189629 14:20430447-20430469 CCAGGCAACGGGCAGGGCTGAGG + Exonic
1114292411 14:21299250-21299272 CCTAGCACTTTGCCGGGCTGAGG - Intronic
1114556997 14:23567781-23567803 CCTGGTACGGGGCCGAGCAGGGG + Exonic
1114656276 14:24317455-24317477 CCTGGCACAGGGTGGGGCTGAGG + Exonic
1116817544 14:49598276-49598298 ACTAGGACGGGGCCCGGCTGGGG - Intronic
1117548022 14:56809046-56809068 CGTGGCTCGGGGCCGGGCGGGGG - Intronic
1119473199 14:74911899-74911921 CCTGGGAGGGGGTCAGGCTGGGG - Intronic
1119709720 14:76812879-76812901 CCGGGGGCGGGGCCGAGCTGAGG - Exonic
1121507735 14:94489549-94489571 CCTGGCTCTGGCCCCGGCTGGGG + Intronic
1121832392 14:97063508-97063530 CCAGGCCCAGGGCCAGGCTGGGG - Intergenic
1122275205 14:100587431-100587453 GCTGGCGGGGAGCCGGGCTGGGG - Intergenic
1122293491 14:100692334-100692356 CCCTGCCCGGCGCCGGGCTGGGG + Intergenic
1122307760 14:100776499-100776521 CCTGGCCAGGGGCCTGGCTTAGG + Intergenic
1122399510 14:101458559-101458581 CCAGCCACGGGGGCGGGCTGGGG + Intergenic
1122637833 14:103138586-103138608 CCTGGCAGAGGGGCGGGCTCCGG + Intergenic
1122838343 14:104442363-104442385 CCTGGGCCTGGGCAGGGCTGGGG + Intergenic
1122849084 14:104517045-104517067 CCTGGGGAGGTGCCGGGCTGTGG - Intronic
1122899932 14:104778229-104778251 CCTGGGACAGGGCCTTGCTGGGG - Intronic
1122929282 14:104926023-104926045 CCTCCCACGGGTCAGGGCTGAGG - Intronic
1124440925 15:29685750-29685772 GCTGGGACGGGGCCAGGGTGTGG - Intergenic
1125534533 15:40435854-40435876 CCTGGCAAGGGGCTGGGGTGAGG - Intronic
1126342241 15:47653941-47653963 CCTGGCACTGTGCTGGGCTCTGG + Intronic
1128370411 15:67035600-67035622 CATGGCACGGGGTGGGGGTGGGG + Intergenic
1128634407 15:69293941-69293963 CCTGGCACAGGGCACGCCTGGGG + Intergenic
1129194429 15:73955659-73955681 CCTGGCAGGGGGCACAGCTGTGG + Intergenic
1129245893 15:74278474-74278496 CCCAGCACAGGGCGGGGCTGCGG - Intronic
1129258564 15:74348846-74348868 CCAGGTACTTGGCCGGGCTGAGG - Intronic
1129326711 15:74803689-74803711 CCTGGCACATGGCAGGGGTGGGG - Intergenic
1129458940 15:75690320-75690342 CCAGGCAGGGGGCCGGCGTGGGG - Exonic
1129666223 15:77580931-77580953 CCTGGCAGAGGGCCTGGCAGAGG - Intergenic
1129724869 15:77896572-77896594 CCAGGCAGGGGGCCGGCGTGGGG + Intergenic
1130086253 15:80780177-80780199 GCTGGCGCGGGGCCGAGCTGAGG + Intronic
1131149343 15:90037103-90037125 CCTGGCAGGGGCTCGGGGTGGGG + Intronic
1131466026 15:92655505-92655527 CCGGGCCCCGGGCCGGGCGGTGG + Exonic
1131830975 15:96354361-96354383 GCTCGCTCGGGGCCCGGCTGCGG - Intergenic
1132153407 15:99478043-99478065 CCTGGCTCAGAGCCTGGCTGGGG + Intergenic
1132453228 15:101979900-101979922 AGTCGCACGGCGCCGGGCTGGGG - Intergenic
1132578762 16:675764-675786 CCTGGCCGGGGGCCGGGGTCCGG - Exonic
1132641856 16:981709-981731 CCGGGCGCGGGGCGGGGCCGCGG + Intergenic
1132720783 16:1314639-1314661 CCGGGCACAGGGCTGAGCTGTGG + Intronic
1132828921 16:1918246-1918268 CCGGGCAAGGGGCCGCTCTGCGG - Exonic
1132831851 16:1932344-1932366 CCAGGCACAGGGCCAGGCAGGGG - Intergenic
1136141657 16:28292599-28292621 CCTGGCCCGGGCTCCGGCTGCGG - Exonic
1136234264 16:28904619-28904641 CCTGGGCAGGGGACGGGCTGGGG + Exonic
1136385426 16:29922995-29923017 CCTGGCATGAGGCTGGGGTGGGG + Intronic
1136996089 16:35188874-35188896 CCTGGCCATGCGCCGGGCTGGGG + Intergenic
1137563943 16:49521804-49521826 CCTGGCATGGGGCCAGCCTATGG + Intronic
1137977190 16:53041914-53041936 CCTGGGACAGGGCAGGGCTTTGG + Intergenic
1138190382 16:55009429-55009451 CCAGGCACTGAGCCGGGCTGGGG + Intergenic
1138349071 16:56336879-56336901 CCGGGCAGGGGGCAGCGCTGAGG + Intronic
1138536602 16:57663648-57663670 CCTGGGGCTGGGCCGGGCTCGGG - Exonic
1138555117 16:57766362-57766384 CCTGGAAGGGGGCAGGGTTGGGG + Intronic
1139472895 16:67187658-67187680 CGAGGCACTGGGCCAGGCTGTGG - Exonic
1140469417 16:75206038-75206060 CCTGGGTAGGGGCCAGGCTGGGG - Intronic
1140472367 16:75222901-75222923 CCTGGGTAGGGGCCAGGCTGGGG + Intronic
1141406923 16:83802811-83802833 GCTGGCACGAGGAGGGGCTGGGG - Intergenic
1141640386 16:85337638-85337660 CCTGGCGCAGGGATGGGCTGGGG + Intergenic
1141651174 16:85393929-85393951 ACTGGGGCGGGGCTGGGCTGGGG + Intergenic
1141807158 16:86349313-86349335 TCTGTGACGGGGCCGGGGTGGGG + Intergenic
1141888854 16:86912957-86912979 ACTGGCATGGGGCAGGTCTGTGG - Intergenic
1142286280 16:89172754-89172776 CCAGGGACTGGGCTGGGCTGGGG + Intronic
1142670591 17:1485862-1485884 CCTCCCGCGCGGCCGGGCTGGGG + Intronic
1143013628 17:3879965-3879987 CCTGGCATGGGGCCGGGGCATGG - Intronic
1143499214 17:7329248-7329270 CCTGGACCGGGGCCGGGCGGGGG - Exonic
1143973466 17:10812854-10812876 CTTGGCACTGGGCCTGGCTGCGG - Intergenic
1144793642 17:17876618-17876640 CCTGGCGCAGGGCTGGGCTTAGG - Intronic
1145795631 17:27653875-27653897 CCTTGCATGGGGCCAGGCTTAGG + Intergenic
1145810066 17:27759207-27759229 CCTTGCAAGGGGCCAGGCTCAGG + Intronic
1145912894 17:28552634-28552656 CCCGGCCGGGGGCGGGGCTGCGG - Exonic
1146551085 17:33780976-33780998 CTTGGCACAGGGCCGGGCTCAGG + Intronic
1146884845 17:36464075-36464097 CCTGGAGCGGGCCCAGGCTGGGG + Intergenic
1147659106 17:42107827-42107849 CAGGGCAGGGGGCGGGGCTGTGG - Intronic
1147793039 17:43025177-43025199 CCTGGCTGGGGGCGGGGCGGAGG + Intergenic
1148089357 17:45013619-45013641 CCAGGATAGGGGCCGGGCTGGGG - Intergenic
1148119144 17:45197524-45197546 CCAGGCAGGGGGATGGGCTGGGG + Intergenic
1148142388 17:45338088-45338110 CCTGGCACAGGGCGGGGGTGCGG + Intergenic
1148158267 17:45435780-45435802 CCTGGCACGGGGGAAGGCTTGGG - Intergenic
1148206857 17:45784631-45784653 CGCGGGACGGGGCTGGGCTGTGG + Intronic
1148262365 17:46194089-46194111 CCCGGCGCGGGCCCTGGCTGGGG - Intronic
1149685393 17:58531917-58531939 GCGGGCGCGGGGCAGGGCTGGGG - Intronic
1150463291 17:65370970-65370992 CCAGGCACGGGGCCGGGGAAGGG - Intergenic
1150611882 17:66739808-66739830 CCTGGTAAGGAGCCTGGCTGTGG + Intronic
1150617568 17:66784135-66784157 CCTGGCAGGGAGCGGGGCAGAGG - Intronic
1150643743 17:66965624-66965646 CCTGGGGCGGGGCCGGCCGGGGG + Intronic
1151161657 17:72171095-72171117 ACTGGCAGGGGGCCAGGCTGTGG - Intergenic
1151537779 17:74748573-74748595 CCGGGGGCGGGGCCGCGCTGAGG - Intergenic
1151703533 17:75755395-75755417 CCTCCCAGGGGGCGGGGCTGGGG + Intronic
1151805961 17:76405477-76405499 CCAGGCCCGGGGCTGGGGTGGGG + Intronic
1151972457 17:77465860-77465882 CCTGGAAGGAGGCTGGGCTGAGG + Intronic
1151974016 17:77474349-77474371 CCAGCTACTGGGCCGGGCTGGGG - Intronic
1152375978 17:79919263-79919285 CCTGGCAGGGCGCCGGGCGAGGG - Intergenic
1152427114 17:80224091-80224113 CCTGGAACAGGGCCTGGCTTGGG - Intronic
1152638828 17:81441112-81441134 ACTGGCACTGGGCCAGGCAGGGG + Intronic
1152658205 17:81529712-81529734 CATGGCACCAGGCCAGGCTGTGG - Intronic
1152809886 17:82376379-82376401 CAGGGTCCGGGGCCGGGCTGGGG - Intergenic
1152927240 17:83092837-83092859 CCTGGGACATGGCCGGACTGAGG + Intronic
1153043049 18:832173-832195 CGTGGCAGGGGTCCGAGCTGGGG + Intergenic
1154161115 18:11981439-11981461 CTCGGCACGGGGCGGGGCGGAGG + Exonic
1154333597 18:13449357-13449379 CATGGCAGGGGGCTGGGCTGTGG + Intronic
1155315571 18:24567453-24567475 CCTGGCTGGGGGCTGGGTTGGGG + Intergenic
1156491609 18:37499653-37499675 CCTGGCACAGGGCCTGGCATGGG + Intronic
1157410838 18:47461721-47461743 CTTGGCAGGGGGCAGGGATGGGG + Intergenic
1157567662 18:48690603-48690625 CCTGGCTCGGGGATTGGCTGTGG + Intronic
1160454546 18:78991619-78991641 CCTGACAGGGGGCCGCGCTGTGG - Intronic
1160584125 18:79903469-79903491 TCTGGCACGGGGGAGGGCTGGGG - Exonic
1160665705 19:327084-327106 CCTGGCAGGGGGCCTGGCTGCGG + Intronic
1160740991 19:685747-685769 CCAGGCAGGGGGCCGGGCTGGGG + Exonic
1160794946 19:940953-940975 CCTGGCACGGGCACGGGCCGGGG - Intronic
1160805693 19:991448-991470 TGTGGGGCGGGGCCGGGCTGGGG + Intronic
1160805829 19:991806-991828 CGTGGGGCGGGGCCTGGCTGGGG + Intronic
1160965110 19:1744044-1744066 GCTGGTGTGGGGCCGGGCTGGGG - Intergenic
1160991582 19:1862524-1862546 CCTGGCGTGGGGCCAGGATGGGG - Intronic
1161014781 19:1978226-1978248 CCTGCCTCGGGGGTGGGCTGGGG + Intronic
1161052023 19:2169137-2169159 CCTGGCCTGGAGCCCGGCTGTGG + Intronic
1161102211 19:2426786-2426808 GCTGGCAGGGGGCAGGGCGGGGG + Exonic
1161221733 19:3120938-3120960 CCTTGCCCTGGGCCGGGCTGGGG + Intronic
1161401303 19:4067150-4067172 GCTGGCACGGCGCCGCGCGGCGG - Intergenic
1161427209 19:4210180-4210202 CCAGGCACGGGGAGGGGCTCTGG + Intronic
1161457647 19:4377547-4377569 GGTGGCACGGGGCAGGGCAGGGG + Intronic
1161513650 19:4684886-4684908 CTGGGGACCGGGCCGGGCTGGGG + Intronic
1161838931 19:6667072-6667094 CCTGGCAAGGGGCAGGGGTCAGG - Intronic
1162150370 19:8640806-8640828 CCTTGCAAGGGGCAGGGGTGAGG + Intergenic
1162403685 19:10461238-10461260 CCGGGCAGGAGGCGGGGCTGGGG + Intronic
1163010037 19:14419233-14419255 CCGGGCGCGGGGCCGCGGTGTGG - Intronic
1163228263 19:15980020-15980042 CCAGGGATGGGGCCGGGATGCGG - Intergenic
1163523775 19:17807972-17807994 CATGGCACGGGGCCGGGGCTGGG - Exonic
1163813995 19:19452670-19452692 CCTGGGCTGGGGCTGGGCTGAGG + Intronic
1164735934 19:30540901-30540923 CCTGGCCTGGGGCCAGTCTGAGG - Intronic
1165284884 19:34833282-34833304 CCTGGAAGGGGGCCGGGGAGAGG - Intergenic
1165487285 19:36103487-36103509 CCTGGCACGGGAGCTGGCAGTGG - Exonic
1165642687 19:37403395-37403417 CCTGGGATGGTGCGGGGCTGTGG + Intergenic
1166303233 19:41923745-41923767 GCTGGGACGGGGCTGTGCTGGGG + Intronic
1166739437 19:45105080-45105102 CGTGGCACTGGGCCTGGCTCTGG + Intronic
1166752054 19:45168942-45168964 CCTGGCAAGGGGCCAGGCAGAGG - Intronic
1166817909 19:45557874-45557896 CCTGGCACTGGGCAGTGCTGGGG - Intronic
1166853632 19:45771735-45771757 CCGGGGCCGGGGCCGGGATGCGG - Intronic
1166934065 19:46320558-46320580 CTTGGTATGGGGCAGGGCTGGGG + Exonic
1166994036 19:46710817-46710839 CCTGGCACGGGGACAGCGTGGGG - Intronic
1167070931 19:47221657-47221679 CCTGTCCCGGGGGCGGGCCGGGG - Exonic
1167457642 19:49605781-49605803 GCTGGCACGGGGCAGGGGAGGGG + Intronic
1167470025 19:49670394-49670416 GCCGGCGCGTGGCCGGGCTGGGG + Exonic
1168316474 19:55486782-55486804 CCGGGCTCGGGCCTGGGCTGGGG + Exonic
1168401502 19:56088248-56088270 CCCAGCACGGGGACGGGCTCGGG - Exonic
925905257 2:8536312-8536334 CCTGGCACTGGGCTAGGATGTGG - Intergenic
926678862 2:15649177-15649199 CCTGGCACAGGGAAGTGCTGGGG + Intergenic
927038520 2:19204887-19204909 CCTGGCCCTGGGCTGGGATGTGG - Intergenic
927207818 2:20621128-20621150 CCTGGGGCAGGGCCGGGCAGGGG + Intronic
927485467 2:23485738-23485760 GCTGGAAAGGGGCAGGGCTGGGG - Intronic
927488573 2:23505601-23505623 CCTGGCAAGGGACCTGGGTGGGG - Intronic
927713793 2:25340855-25340877 CCGGGCCCGGGCCCGGGCCGCGG - Intronic
927881441 2:26692656-26692678 GCGGGCGCGGGGCCGGGCGGAGG + Intergenic
929452972 2:42048568-42048590 CCAGGCGCGGGCCCGGGCCGGGG - Exonic
929535992 2:42784421-42784443 CTTGGCAAGGGGTGGGGCTGTGG + Intronic
929574408 2:43042934-43042956 CCGGGGCCGGGGCCAGGCTGTGG + Intergenic
929994645 2:46817620-46817642 CCTGGCCCTGGGCCAAGCTGGGG - Intronic
930063621 2:47310990-47311012 CCTGGCACAGTGCCCGCCTGTGG + Intergenic
931256863 2:60581702-60581724 GCTCGCGCGGGGCCGGGCTTTGG + Intergenic
932396786 2:71454105-71454127 CCTCGCCCGGGGTCGGGGTGGGG + Intronic
932747384 2:74345063-74345085 CCTGGCACAGGGCAGGTTTGGGG + Intronic
933758868 2:85661177-85661199 CCTGGGACAGGGCAGGGCGGGGG + Intronic
935229568 2:101084064-101084086 CCTGGCCCGGGTCAGGCCTGAGG + Intronic
935692816 2:105745432-105745454 CAGGGCAGGGGGCCCGGCTGCGG + Intronic
935744839 2:106181262-106181284 CCTGGCTCAGGGCGGGGCTCTGG + Intronic
936266716 2:111016641-111016663 CCTAGCACGGGGCCTGGCCCAGG - Intronic
937234436 2:120421955-120421977 GCTGGGCCGGGGCTGGGCTGGGG + Intergenic
937370433 2:121293766-121293788 CCTGGCTGGGGGCACGGCTGAGG + Intergenic
938065736 2:128281089-128281111 CCTGCCAAGGGGCTGGGCTGAGG - Intronic
938493111 2:131776265-131776287 CCAGACATGGGGTCGGGCTGGGG - Intergenic
941003135 2:160221906-160221928 CCTGGGAGGGAGCCGGGCTGAGG - Intronic
942047639 2:172109054-172109076 CCTGTCAGGGGGCGGGGGTGGGG + Intergenic
943222866 2:185132841-185132863 CCTCCCACGGGGCAGGGCTCAGG + Intergenic
945119648 2:206444039-206444061 CCAGGCGCGGGGCCGGGACGAGG - Exonic
945245249 2:207711704-207711726 CCCTGCCCGGGGCCGGGCCGCGG + Intronic
947500693 2:230668754-230668776 CCTGGGGCCGGGCCGGGCAGAGG - Intergenic
947985623 2:234445346-234445368 CCTGACAGGGGGTGGGGCTGGGG + Intergenic
947998648 2:234549120-234549142 TCTGGAAAGGGGGCGGGCTGGGG + Intergenic
948393337 2:237627568-237627590 CCGGGGCCGGGGCCGGGCCGGGG + Intronic
948697345 2:239738268-239738290 GCTGGGCCGGGGCTGGGCTGGGG - Intergenic
948761705 2:240196457-240196479 CCTGGCTAGGGGCAGGGCTCAGG - Intergenic
948781085 2:240322378-240322400 ACAGGCAGGGGTCCGGGCTGAGG - Intergenic
948825176 2:240570557-240570579 CCTGGCACAGGGACAGGCTTAGG - Intronic
948916839 2:241038812-241038834 GCTGGCCAGGGGCCTGGCTGCGG + Intronic
949045392 2:241870445-241870467 GCTGGCACCCGGCCGAGCTGTGG - Intronic
1168963340 20:1883583-1883605 CCTGGCTCCGGGCAGGGCAGTGG - Intergenic
1168992003 20:2103028-2103050 CCTGGCGCGGCGACGGCCTGAGG + Exonic
1169216305 20:3796541-3796563 CCTGGCGCGGGCTCCGGCTGGGG - Exonic
1171420949 20:25017345-25017367 CCTGGAATGGGTCTGGGCTGTGG + Intronic
1171848206 20:30290587-30290609 CCGGGGGCGGGGCCGGCCTGGGG + Intergenic
1172100932 20:32483642-32483664 CCGGGCACGGGGCGGGGGCGGGG + Intronic
1172116706 20:32577258-32577280 CCAGCCAGGGGGCCGGGCGGGGG + Intronic
1172775672 20:37405292-37405314 CCTGGCTCTGGGCCGGGCCTGGG + Exonic
1172844025 20:37919094-37919116 CCTGGCACGGGGCCTGGCTTAGG + Intronic
1172941125 20:38655505-38655527 CCTGGCACTGGGCTAGGCTGGGG + Intergenic
1173167711 20:40697643-40697665 CCTGGCACAGGGCCAGGAGGGGG - Intergenic
1174417802 20:50379144-50379166 CCTGGCTCAGGGTCGGGCTGGGG - Intergenic
1174743729 20:53040863-53040885 CTTGGCACCGTGCCAGGCTGTGG - Intronic
1175410297 20:58763260-58763282 CCTGGTACGGGGGTGGGCTCAGG - Intergenic
1175545706 20:59776442-59776464 CTTGGCACAGGGCCTGGCTCAGG + Intronic
1175721941 20:61292999-61293021 CCTGCCTAGGGGCCTGGCTGTGG + Intronic
1175941410 20:62539095-62539117 CCTGGAGCGGGGCAGGGATGGGG - Intergenic
1175955435 20:62606709-62606731 CCTAGCACGGGGTCAGGGTGTGG - Intergenic
1178722634 21:35023489-35023511 CATGGCAGGGGGCTGGACTGTGG + Intronic
1178806894 21:35846811-35846833 CCAGGCAGGGGGCAGGGGTGGGG - Intronic
1178889453 21:36509123-36509145 CCTGGCCCTGGGCATGGCTGCGG + Intronic
1178915828 21:36705135-36705157 CCTTGCAGGGGGTCGTGCTGCGG + Intronic
1179189947 21:39115259-39115281 CCTGGCAGGGGGCTGTGCTGAGG - Intergenic
1179435503 21:41359610-41359632 CCTGTCACGGGGCGGGTGTGAGG - Intergenic
1180188943 21:46153683-46153705 GCTGGCCAGGGGCTGGGCTGTGG - Intronic
1180200886 21:46223389-46223411 CCTGGCACGGGACAGGTCTCAGG + Intronic
1180455602 22:15511159-15511181 CCGGGCTCGGGCCCCGGCTGAGG + Intergenic
1181514369 22:23402677-23402699 GCGGGCGCGGGCCCGGGCTGGGG + Intergenic
1181979258 22:26754206-26754228 CCTGGCAAGCTGCAGGGCTGAGG - Intergenic
1182439738 22:30356250-30356272 CCTGGCACGGTGTCTGGCTTGGG + Intronic
1182485336 22:30635643-30635665 CCTGGGGCGGGGCTTGGCTGGGG + Exonic
1183187080 22:36298264-36298286 CCTCTCAAGGGGCAGGGCTGGGG + Intronic
1183380399 22:37487829-37487851 CCTGTGAAGGGGCCTGGCTGGGG - Intergenic
1183708123 22:39487519-39487541 CCTGGCTCGGGGCTGGCCTGGGG - Exonic
1183963904 22:41429702-41429724 CTTGGCAGAGGGCAGGGCTGGGG + Intergenic
1183994219 22:41620943-41620965 CCGAGCCCGGGCCCGGGCTGAGG + Exonic
1184278594 22:43424920-43424942 TCTGGCGGGGGGCCGGGCTGCGG + Exonic
1184411390 22:44328414-44328436 CCTGGCTCGGGGCAGGCCTTCGG + Intergenic
1184429045 22:44430509-44430531 CCTGGCATGGAGCCGGCCTTCGG - Intergenic
1184432527 22:44449855-44449877 CCAGGCACTGGGCAGGGATGTGG - Intergenic
1184647234 22:45903032-45903054 CCTGGCCCTGGGCCGGGCTGGGG + Intergenic
1184737440 22:46407739-46407761 CCTGGCACGGGAGTGGCCTGTGG - Intronic
1185014578 22:48335510-48335532 CCTGCCACAGGGCCCAGCTGAGG - Intergenic
1185038202 22:48490348-48490370 ACTGGCGCGGGCGCGGGCTGGGG + Intronic
1185208617 22:49554269-49554291 CCTGGCACAGGGACAGGGTGGGG + Intronic
1185275702 22:49949459-49949481 CCTGGGACGCGGCCGTGGTGTGG - Intergenic
1185313786 22:50170349-50170371 CCAGGGCGGGGGCCGGGCTGCGG + Intergenic
1185326475 22:50228173-50228195 CCTGGCCCGGTGGCGGGGTGTGG - Intronic
1185333469 22:50261693-50261715 CCTGGGTCGGGGTCGGGCCGGGG - Exonic
949414231 3:3799287-3799309 CCCAGCACGGGGCCGCGCCGAGG + Intronic
950639088 3:14336496-14336518 CCTGGCACATGGCGGGGATGGGG - Intergenic
953748640 3:45593829-45593851 CCAGGGGCGGGGCCGGGCTGAGG + Intronic
954211237 3:49098647-49098669 CCTGGCTTGGGGCCAGCCTGTGG - Exonic
954279198 3:49563985-49564007 CCTGCCACGTGCCAGGGCTGAGG + Intronic
954327182 3:49869937-49869959 CCCGGGCCGGGGGCGGGCTGGGG + Exonic
954414953 3:50388729-50388751 TCTGGAAAGGGGCCTGGCTGTGG + Intronic
955021929 3:55130269-55130291 CCTGTCACGGGGCAGGTCAGGGG - Intergenic
955210311 3:56934695-56934717 CCTCCCACGGGGCAGGGCTTGGG + Intronic
956167182 3:66405718-66405740 CCCGGCACAGGGCCGGCCCGTGG + Intronic
958900096 3:99876080-99876102 CCTGCGCCGGGGCCGGGCGGGGG + Intronic
960925982 3:122795242-122795264 CCGGGCTCGGGCCTGGGCTGGGG + Exonic
960974525 3:123161588-123161610 CCAGGCCCTGGGCCTGGCTGAGG + Intronic
961081669 3:124033441-124033463 CGGGGCCCGGGGCCGGGGTGCGG - Intergenic
961222777 3:125212926-125212948 CCTGGGTAGGGGCAGGGCTGGGG + Intergenic
961314449 3:126025143-126025165 CCTGGCACGGTGTAGTGCTGGGG - Intronic
961470007 3:127105623-127105645 CCCTGCACGGGGCAGAGCTGGGG + Intergenic
961529086 3:127528921-127528943 GCTGGGATGGGGCTGGGCTGAGG - Intergenic
961644166 3:128383688-128383710 CCTGGCACGAGGCCAGGAAGGGG - Intronic
961646912 3:128397620-128397642 GCTGGCCCTGGGCGGGGCTGAGG - Intronic
961862145 3:129925734-129925756 CCTGGCATGGGGCGGGGAGGGGG + Intergenic
962251382 3:133838132-133838154 CCTGGCACGGGGCCCGGCACGGG - Intronic
964246484 3:154659794-154659816 CCAGGCAGGGGCCAGGGCTGAGG + Intergenic
966748617 3:183301502-183301524 CCTGAGACTAGGCCGGGCTGTGG + Intronic
966884515 3:184369119-184369141 CCTGGCACTGGCCCTGGCTCTGG - Intronic
968258135 3:197297863-197297885 CGTGGAGCGGGGCCGGGCTGGGG - Intronic
968478588 4:824299-824321 CCTCGAAAAGGGCCGGGCTGGGG + Intronic
968578255 4:1377878-1377900 CATGGCAGCGGCCCGGGCTGGGG + Intronic
968582887 4:1403131-1403153 CCTGGCACGGGGCTGCCCGGCGG - Exonic
968624129 4:1618851-1618873 CCTCTCACTGGGCTGGGCTGAGG + Intronic
968729331 4:2262203-2262225 GCGGGCGCCGGGCCGGGCTGGGG + Exonic
968819066 4:2836578-2836600 CCTGGCAGGGAGCCAGGCAGGGG - Exonic
968913054 4:3485488-3485510 TCTGGCCCGAGGGCGGGCTGGGG - Intronic
969266227 4:6065848-6065870 CCAGACACGGGGCAGGCCTGGGG + Intronic
969435300 4:7185914-7185936 CCTGGCATGGAGCAGGGCTCAGG + Intergenic
969519921 4:7670741-7670763 CCTGCCATGGGGCCGGGGTGGGG - Intronic
969610886 4:8227320-8227342 CCTGGCACAGGCCCGGGGGGCGG + Exonic
969611702 4:8231300-8231322 CCTGGCACGTGGCCTGTCTTGGG + Intronic
976247039 4:83014595-83014617 CCTGGCACTTTGCGGGGCTGAGG + Intergenic
980930048 4:139176675-139176697 CGGGGCGCGGGGCAGGGCTGAGG - Intronic
982484741 4:155953644-155953666 CCTGTCCCGGGTCTGGGCTGCGG - Intronic
983637693 4:169914757-169914779 CCTGGCAGGGGGCAGAGCTTGGG + Intergenic
985085141 4:186305619-186305641 CATTGCATGGGGCCAGGCTGGGG - Intergenic
985504566 5:271694-271716 CAAGGCACGCGGCTGGGCTGAGG - Exonic
985566394 5:620471-620493 CCTGGGAGGGCGCAGGGCTGGGG + Intronic
985576669 5:676448-676470 CTTTGCAAGGGGCCGGGCCGTGG - Intronic
985818389 5:2143761-2143783 CCGGGCAAGGTGCAGGGCTGAGG - Intergenic
985895718 5:2749165-2749187 CCTGTCACGTGGCCGGGTGGGGG - Intronic
986321684 5:6636907-6636929 CCTGGAAGGGGACAGGGCTGGGG + Intronic
987321566 5:16774974-16774996 CCTGGCACTGAGCAGGGCTGGGG - Intronic
988577944 5:32444575-32444597 CCAGGGAGGGGGCCGGGCAGAGG + Intronic
992104092 5:73436364-73436386 CCTCGCTGGGGGCCGGGCGGGGG - Intergenic
992796091 5:80256125-80256147 GCGGGCACGGGGCGGGGCTGGGG - Intergenic
994999700 5:107111663-107111685 CCTGGCAGGGGCCGGGGGTGGGG + Intergenic
998385278 5:141753740-141753762 ACTGGAAGGGGACCGGGCTGGGG + Intergenic
998417276 5:141955218-141955240 CCTGGAACGTGGCTGGCCTGTGG + Exonic
999321859 5:150620040-150620062 CCTCTCACGGGCCCAGGCTGGGG + Intronic
999693533 5:154168808-154168830 CCTGGCACCAGGCCTGGCAGCGG + Intronic
1000030833 5:157399745-157399767 CCTGCCATGGGGCAGGGGTGGGG - Intronic
1000209887 5:159099239-159099261 GCTGCCGCGGGGCCGGGCGGCGG - Intronic
1000266234 5:159640895-159640917 GCTGGCAGGGGGGCGGGCTGAGG + Intergenic
1000349922 5:160345177-160345199 CCAAGCTCTGGGCCGGGCTGAGG - Intronic
1002131733 5:177086558-177086580 CCTGGCCTGGGGCCTGGGTGGGG + Intergenic
1002170358 5:177371109-177371131 CCGGGGCCGGGGCCGGGCGGAGG + Intronic
1002196550 5:177504494-177504516 CGTGGCAGGGGGCAGGGCTGGGG + Exonic
1002277484 5:178113480-178113502 CGGGGGCCGGGGCCGGGCTGTGG + Exonic
1002368404 5:178730494-178730516 CCCGGCACGGGGACTGCCTGCGG - Intronic
1002440018 5:179259393-179259415 CCGGGCACTGGGCCAGGCTCTGG - Intronic
1002497072 5:179622963-179622985 GCTGGCGGGCGGCCGGGCTGGGG - Intronic
1005978210 6:30816427-30816449 CTTCGCACGGGGCAGGGCTCGGG - Intergenic
1006161139 6:32041110-32041132 ACTGGCTCTGGCCCGGGCTGTGG - Exonic
1006299296 6:33185308-33185330 CCTGGGGCGGGGCCAGGCAGTGG + Intronic
1006443367 6:34065595-34065617 CCTGGCAGGAGGCTGGGCAGGGG - Intronic
1006790536 6:36698366-36698388 CCTGGCATGGGCCCTGCCTGGGG - Intronic
1007760929 6:44133445-44133467 TCTGCCTCGGGGGCGGGCTGTGG - Intronic
1007784652 6:44272608-44272630 CCTGGAAGGGGTCTGGGCTGGGG + Intronic
1008054922 6:46936242-46936264 CCTGGGATGGGGGCTGGCTGGGG + Intronic
1008544984 6:52576589-52576611 GCTGGCACGGCGCGGAGCTGGGG + Intronic
1011281125 6:85678901-85678923 CCGGGCGCGCGGCCGGCCTGCGG - Intergenic
1016955502 6:149622755-149622777 CCTGGCAGGGGGGCGGGGGGTGG + Intronic
1017497539 6:154995217-154995239 CCTGACGCTGGGCGGGGCTGGGG + Intronic
1018402490 6:163439105-163439127 CCTGGCAGTGGGCCAAGCTGTGG - Intronic
1019147717 6:169985635-169985657 CCGGGCACGGGTCTGGGCTCGGG - Intergenic
1019175756 6:170158585-170158607 CCAGGAAAGGGGCCGGGCAGAGG + Intergenic
1019294659 7:267344-267366 CTGGGCTCTGGGCCGGGCTGAGG - Intergenic
1019575046 7:1733595-1733617 GCTGGGACGGGGCTGGGATGCGG - Intronic
1019700280 7:2471505-2471527 CCTGGCCCTGGGCGGGACTGGGG - Intergenic
1019733662 7:2640270-2640292 CGTGGCGCGTGGCTGGGCTGAGG - Intronic
1019734931 7:2645903-2645925 CCTGAGACGGGGACGGGCTCTGG + Intronic
1019915623 7:4130367-4130389 GCTGGGGCGGGGCCGAGCTGTGG + Intronic
1020006284 7:4785236-4785258 GGTGGGACAGGGCCGGGCTGGGG - Intronic
1020080363 7:5283198-5283220 CCCGGGACAGGGGCGGGCTGGGG - Intronic
1020088493 7:5324232-5324254 CCTGCCGCGTGGCGGGGCTGTGG - Exonic
1020213341 7:6171166-6171188 CCTGGCAAGGGGCCAGGCTGTGG + Intronic
1022437936 7:30408075-30408097 CCTGGCACTTTGCGGGGCTGAGG - Intronic
1023868839 7:44252025-44252047 CCCGCCACGGGGAGGGGCTGTGG + Intronic
1023981671 7:45074077-45074099 CCTGGCACGGGGCCACCCAGAGG - Intronic
1024552907 7:50578368-50578390 CCTGGCCCTGGGACGGGCTCCGG + Intergenic
1024637464 7:51302075-51302097 CCTAGGATGGGGCCAGGCTGTGG - Intronic
1024940519 7:54759004-54759026 CCTGGCTCAGGGCCGGGGTCTGG - Intronic
1024971813 7:55078314-55078336 CCTGGCACCGCTCTGGGCTGTGG - Intronic
1025198552 7:56948981-56949003 CCCGGGACAGGGGCGGGCTGGGG + Intergenic
1025205816 7:56992882-56992904 CCTGCCACGTGGCGGGGCTGCGG + Intergenic
1025666124 7:63584056-63584078 CCTGCCACGTGGCGGGGCTGCGG - Intergenic
1025673399 7:63627952-63627974 CCCGGGACAGGGGCGGGCTGGGG - Intergenic
1026942241 7:74293828-74293850 CCTGTCCCGGGGCAGGGCTGGGG - Intronic
1026977330 7:74506678-74506700 CCTGGCACTGGGGCAGCCTGTGG + Intronic
1026979547 7:74518335-74518357 GCCGGCCCGGGGCTGGGCTGGGG + Intronic
1027233123 7:76283205-76283227 CCTGGCACGGGGATGGGGGGGGG + Intronic
1029173226 7:98645409-98645431 CCTGGCACCAGGCTGGGCTCAGG - Intergenic
1029264014 7:99324733-99324755 CCTGGCATGGCGCTGGGCGGCGG + Intergenic
1029461038 7:100694056-100694078 CCTGCCCCGGGGCTGGGCTGCGG + Intergenic
1029598165 7:101548669-101548691 GGTGGGAAGGGGCCGGGCTGAGG + Intronic
1033345892 7:140525604-140525626 CCCAGGACGGGGCTGGGCTGAGG - Intronic
1033653126 7:143356726-143356748 CCTGGCAAGGGGCCCTGCTGAGG - Exonic
1034392788 7:150799988-150800010 CCTGGGACGGGGCCAGGGAGCGG - Intronic
1035113529 7:156504679-156504701 CCTGGCACGGAGCTGGACTTAGG - Intergenic
1035168299 7:157004200-157004222 CATGGCGCTGGGCCTGGCTGCGG + Intronic
1035579454 8:731040-731062 CCTGGAAAGGGGCCGGGGTCGGG + Intronic
1035625448 8:1067449-1067471 CCTGGGAGGGGGCCACGCTGAGG + Intergenic
1036208787 8:6825370-6825392 CGTGACACGGAGCCAGGCTGTGG + Intronic
1037832455 8:22197505-22197527 CCTGGCACCAGGGAGGGCTGGGG - Intronic
1041851228 8:62395272-62395294 CATTGCGCGGGGCCGGGCGGAGG + Intronic
1042235911 8:66613155-66613177 CCTGTGGCGGAGCCGGGCTGGGG - Exonic
1042448686 8:68919971-68919993 CCTGGCATGGGGCTGGGGTGAGG + Intergenic
1044978863 8:97694669-97694691 CCTGGCACTTTGCAGGGCTGAGG + Intronic
1048574871 8:135682522-135682544 CAGGGCAGGGGGCTGGGCTGAGG + Intergenic
1048969415 8:139636399-139636421 CTTGGCAGGGGGCCGGGGTATGG - Intronic
1048991988 8:139765870-139765892 CCTGGCACAGACCCCGGCTGGGG - Intronic
1049321699 8:142000245-142000267 CCTGGCACGGTCCAGGGCTGGGG + Intergenic
1049471703 8:142777628-142777650 CCGGGGACGGGTCCGGGCCGAGG - Intronic
1049624823 8:143615234-143615256 TCTGGCCCTGGGCTGGGCTGGGG + Intronic
1049684021 8:143932098-143932120 CCTGGGTAGGGGCGGGGCTGCGG - Intronic
1049720547 8:144113565-144113587 CGAGGCAAGGGGCAGGGCTGGGG + Intronic
1049752317 8:144291202-144291224 GCGGGCACGTGGCCGCGCTGGGG - Intronic
1049781400 8:144430658-144430680 CCTGCTACTGGGCCAGGCTGAGG - Intronic
1049883072 9:11147-11169 AGTCGCACGGCGCCGGGCTGGGG + Intergenic
1050287531 9:4118378-4118400 CCGGGCACCGGGCGCGGCTGGGG + Exonic
1052362223 9:27573480-27573502 GCGGGCCCGGGGCGGGGCTGCGG - Intronic
1053313807 9:37035768-37035790 CCTGGGCTGGGGCTGGGCTGCGG - Intergenic
1053420662 9:37975517-37975539 CCTGGCACTGGTGTGGGCTGAGG + Intronic
1053547890 9:39042487-39042509 CTTCCCACGGGGCAGGGCTGGGG - Intergenic
1055730816 9:79277868-79277890 CAGGGCACGGGGCCGGGGAGGGG + Intergenic
1055943635 9:81673521-81673543 CCTGGCATGGGGGCGCTCTGAGG - Intronic
1059451056 9:114371770-114371792 CCTGGGAGGGAGCCGCGCTGGGG - Intronic
1059455651 9:114398503-114398525 CCGGGCGCGGGGCGGGGCGGTGG + Intergenic
1060200996 9:121651742-121651764 CCGGGCACCGGGCCGGGCCTGGG - Intronic
1060596731 9:124853163-124853185 CAGGGCGCGGGGCCGGGCTCTGG + Intergenic
1060656252 9:125374526-125374548 CCAAGCACAGGGCCGGGATGAGG + Intergenic
1061016057 9:127981194-127981216 CCTAGGGCGGGGCGGGGCTGAGG + Intergenic
1061514814 9:131082876-131082898 CCGGGCAGTGGGCAGGGCTGGGG - Intronic
1061575419 9:131503146-131503168 CCTGGCTTGCGGACGGGCTGGGG + Intronic
1061627856 9:131852041-131852063 CTGGGCCTGGGGCCGGGCTGTGG + Intergenic
1062084335 9:134641216-134641238 ATTGGCACGGGACCGAGCTGGGG - Intergenic
1062306170 9:135908002-135908024 CCGGCCAGGGGGCCGGGCTGTGG - Intergenic
1062351913 9:136143565-136143587 GCTGGCCGGGGGCCGGGGTGGGG + Intergenic
1062435913 9:136546482-136546504 CCGGGCCCGGGGCAGGGCTCTGG + Intergenic
1062449609 9:136609981-136610003 CCTCCCACCGGGCCGGGCAGTGG + Intergenic
1062562532 9:137147992-137148014 CGAGGCCCGGGGCGGGGCTGGGG - Intronic
1062637577 9:137499693-137499715 CCGGGCAAGGGGCAGGGGTGGGG - Intronic
1187442489 X:19332719-19332741 CCTGGCACTGGGCTGCGCTTTGG - Intergenic
1189599020 X:42601556-42601578 CCTGGCAGGGGGCAGGGCATGGG + Intergenic
1189846786 X:45145813-45145835 CCTGGCTGAGGGCTGGGCTGGGG + Intergenic
1190881523 X:54495585-54495607 GCTGGCCCGGGCCCGGGCTGGGG - Exonic
1192151818 X:68717472-68717494 CCTGGCCCTGGGTGGGGCTGAGG - Exonic
1192180395 X:68912394-68912416 GCCGGCAGAGGGCCGGGCTGGGG - Intergenic
1192265635 X:69535763-69535785 CCTGGGCCTGGGCCTGGCTGAGG - Intergenic
1192795504 X:74421752-74421774 ACTGGCACGGGCTCGGGCTCGGG - Exonic
1193442892 X:81565086-81565108 CCTGGGGTGGGGCAGGGCTGTGG - Intergenic
1195864023 X:109410006-109410028 TGTGGCAGGGGGCAGGGCTGGGG - Intronic
1198800135 X:140439718-140439740 CCGGGGGCGGGCCCGGGCTGGGG + Intergenic
1199974641 X:152886048-152886070 CCAGGCTCGGGGCGGGGCTGTGG - Intergenic
1200091607 X:153638657-153638679 CCTGGAAGGGGGACGGGGTGGGG + Intergenic
1200402729 X:156028994-156029016 AGTCGCACGGCGCCGGGCTGGGG - Intergenic