ID: 900106232

View in Genome Browser
Species Human (GRCh38)
Location 1:982271-982293
Sequence GGCACGGGGCCGGGCTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 583}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106222_900106232 9 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106232 1:982271-982293 GGCACGGGGCCGGGCTGAGGTGG 0: 1
1: 0
2: 2
3: 59
4: 583
900106223_900106232 6 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106232 1:982271-982293 GGCACGGGGCCGGGCTGAGGTGG 0: 1
1: 0
2: 2
3: 59
4: 583
900106220_900106232 10 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106232 1:982271-982293 GGCACGGGGCCGGGCTGAGGTGG 0: 1
1: 0
2: 2
3: 59
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106232 Original CRISPR GGCACGGGGCCGGGCTGAGG TGG Intergenic
900000280 1:11048-11070 CGCACGGCGCCGGGCTGGGGCGG + Intergenic
900106232 1:982271-982293 GGCACGGGGCCGGGCTGAGGTGG + Intergenic
900435623 1:2629293-2629315 GGCACGGGGACAGGCGGGGGCGG + Intronic
900543143 1:3214040-3214062 GACAAGGGGCGGGGCTGTGGTGG - Intronic
900619111 1:3578882-3578904 CGCTGGGGGCCGGGCTGAGGAGG - Intronic
900690797 1:3979094-3979116 GGCCCGGGGCCGGGCCCTGGCGG - Intergenic
900778300 1:4600743-4600765 TGCAGGGCTCCGGGCTGAGGTGG - Intergenic
900975093 1:6011800-6011822 GGCAGGGGGGTGGGCTGAAGGGG + Intronic
900979944 1:6040657-6040679 GGGAGGGGGCCTGGGTGAGGGGG - Intronic
900984757 1:6066781-6066803 GGCCCTGGGCCTGGCTCAGGTGG - Intronic
901063696 1:6485302-6485324 GGTACGGGGCCGGGACGGGGCGG - Intronic
901242811 1:7704784-7704806 GGCGCGGGGCCGGGCTGGGCCGG + Intronic
901319826 1:8333075-8333097 GGGATGGGGCCGGGCAGAGCAGG - Intronic
901638254 1:10680261-10680283 GGCACGGGGCGGGGCGGCGGGGG + Intronic
901690488 1:10969998-10970020 GCCACGTGGAGGGGCTGAGGCGG - Exonic
901930795 1:12595397-12595419 GGCGCGGGGCGGGGCCGCGGGGG + Intronic
902315730 1:15617316-15617338 GGGGCGGGGCCGGGAAGAGGAGG - Intergenic
902394531 1:16125365-16125387 GGGAGGGGGCCGGGCTGGGTGGG + Intronic
902786034 1:18733373-18733395 GGCAGGAGGCTGGGCTGGGGAGG - Intronic
902822223 1:18950349-18950371 GGAAGGGGGCTGGGCTGGGGTGG + Intronic
902995819 1:20223813-20223835 GGCACGGGGCGGGGTTGGTGGGG - Intergenic
903019990 1:20387034-20387056 TGCCCGAGGCAGGGCTGAGGGGG + Intergenic
903164145 1:21509307-21509329 GGGCCGGGGCCGGGCTGGGGAGG + Intergenic
903777229 1:25800582-25800604 TGCCTGGGGCCGGGCTGATGGGG + Intronic
904204076 1:28841324-28841346 GGCAAGGGGCCGGGCTGGGCTGG - Intronic
904437188 1:30506605-30506627 GGCAGGGGGCGGGGCTGCAGTGG - Intergenic
904676764 1:32203694-32203716 GGCACTGGGAAGGGGTGAGGAGG - Intronic
905091353 1:35433617-35433639 GGAACAGGGCCAGGGTGAGGGGG + Exonic
905271834 1:36792458-36792480 AGCAAGTGGCCGGGCTGTGGTGG - Intergenic
905630378 1:39515053-39515075 GGCACGGGGCCGGGGACTGGTGG - Intronic
905846992 1:41241851-41241873 GGCTCGGGGCCGGGCTGACACGG + Intronic
907069285 1:51519278-51519300 GGCTCGGGGCGGGGAGGAGGCGG + Exonic
907239997 1:53076006-53076028 GGCAAGGGGAGGGGCTGAGGTGG + Intronic
907336042 1:53700263-53700285 GGCACAGGGCTGTGATGAGGGGG - Intronic
907364164 1:53945966-53945988 GCGAGGGGGCGGGGCTGAGGCGG - Intergenic
907422433 1:54356486-54356508 GGCACGGGGCCTGGCCGGGAGGG - Intronic
907461788 1:54609576-54609598 GGCACCAGGCTGGCCTGAGGAGG - Exonic
907463206 1:54618215-54618237 GCCACCGCGCCCGGCTGAGGAGG - Intronic
908195609 1:61743079-61743101 TGCTCAGAGCCGGGCTGAGGGGG + Intronic
912514566 1:110210065-110210087 GGCGCGGAGCAGGGCTGAGGGGG + Intergenic
912726522 1:112063701-112063723 GACAAGGGGCCGAGCTCAGGCGG + Intergenic
913186456 1:116373839-116373861 GCCTCGGGGCCGGGAGGAGGGGG + Intronic
914803060 1:150974476-150974498 GCCGCGGGGCCGGGGCGAGGAGG - Intronic
915322617 1:155064024-155064046 GGCGCGCGGCCAGGCTCAGGCGG - Intronic
915599700 1:156914418-156914440 GGGAGGTGGGCGGGCTGAGGTGG + Intronic
915835736 1:159173215-159173237 GGCACAGGGCGGGGCGGGGGTGG + Intronic
916070468 1:161166904-161166926 GGCAGGGGGCCCGGCTCAGGTGG - Exonic
916344399 1:163771527-163771549 GGCAGGGGGTGGGGGTGAGGGGG + Intergenic
916528048 1:165630456-165630478 GGCTCGAGGCCGGGTGGAGGAGG - Intergenic
916792505 1:168136693-168136715 GGCGCGGGCCCGGGCGGAGAGGG - Intronic
917291574 1:173477175-173477197 GGCGCGGGGCGGGGCTGGGCCGG - Intergenic
917790473 1:178496004-178496026 GCCAGGGGCCAGGGCTGAGGAGG + Intergenic
919621202 1:199866297-199866319 GGGATGGGGCGGGGCTGGGGAGG - Intergenic
920363086 1:205432720-205432742 GCCACTGTGCCTGGCTGAGGTGG - Intronic
921881123 1:220255405-220255427 GGCACAGAACCAGGCTGAGGTGG + Intronic
922550034 1:226488107-226488129 GGCACAGGGCAGGGCCGAGTAGG - Intergenic
922775608 1:228213085-228213107 GGGAGAGGGCGGGGCTGAGGAGG - Intronic
923631159 1:235650107-235650129 GGCGCGGGCCCGGGCTGGGGCGG - Intronic
1062843796 10:689735-689757 GTGGCGGGGCCGCGCTGAGGAGG - Intronic
1062873982 10:931216-931238 GGGAAGGGCCAGGGCTGAGGAGG - Intronic
1062873998 10:931255-931277 AGGCCGGGGCCGGGTTGAGGAGG - Intronic
1062910126 10:1206770-1206792 AACACGAGGCCGGGCTGAGTGGG - Intronic
1063115074 10:3067384-3067406 GGCAGGGGCCGGGGCTGGGGCGG - Intronic
1064981694 10:21173140-21173162 GGCAGGGGGCAGGGCTGGAGGGG + Intronic
1065068988 10:22003177-22003199 CGCGCGGGGCCGGGCGGAGAGGG - Intronic
1066180754 10:32958420-32958442 AGCCCCGGGCCGGGCTGACGCGG - Intronic
1066281774 10:33924714-33924736 GGTGGGGGGCAGGGCTGAGGTGG - Intergenic
1066464199 10:35639445-35639467 GGCGGGGGGCCGGGCGGCGGCGG - Exonic
1066694963 10:38069222-38069244 GGCAGGGGTCCTGGCTTAGGTGG - Intergenic
1067153234 10:43753472-43753494 GGCCCAGGGCCCGGCTGAGGAGG - Intergenic
1067453637 10:46397882-46397904 GGCCAGGCGCAGGGCTGAGGTGG - Intergenic
1067478077 10:46579190-46579212 GGGCCGGGGCTGGGCTGGGGAGG - Intronic
1067583592 10:47461864-47461886 GGCCAGGCGCAGGGCTGAGGTGG + Intronic
1067616663 10:47762597-47762619 GGGCCGGGGCTGGGCTGGGGAGG + Intergenic
1067633595 10:47987212-47987234 GGCCAGGCGCAGGGCTGAGGTGG + Intergenic
1068989186 10:63133544-63133566 GGGACGGGGCCGGGCTCCTGAGG - Intronic
1069761833 10:70816320-70816342 GGCGCGGGGCCGCGGTGGGGCGG + Intronic
1070162547 10:73874656-73874678 GGCCGGGGGCCGGGCGGGGGGGG - Intergenic
1070314092 10:75294660-75294682 GGCAGGGGACAGGGCGGAGGGGG + Intergenic
1070727669 10:78803252-78803274 GCCACGGGGCCCTGCTGCGGGGG + Intergenic
1070754256 10:78981872-78981894 GGAGCAGGGCTGGGCTGAGGTGG - Intergenic
1070942742 10:80360870-80360892 GGTTGGGGGCAGGGCTGAGGTGG - Intronic
1072731557 10:97850147-97850169 GCCGCGGGCCCGGGCTCAGGTGG - Intergenic
1073177727 10:101566667-101566689 GGCACGGGGTGGGGGTGGGGGGG - Intergenic
1074150551 10:110755883-110755905 AGCTCAGGGCCAGGCTGAGGTGG - Intronic
1075325753 10:121531073-121531095 TGCAGGGGGCCTGGGTGAGGTGG - Intronic
1075748432 10:124743984-124744006 GACCCGGGGCCGGGCGGCGGCGG - Intronic
1075802277 10:125160737-125160759 GGCGCGGGGCCGGGACGCGGGGG - Intronic
1076035650 10:127196623-127196645 GGCGCGGGGCCGGGCCGGGCCGG + Intronic
1076214398 10:128681148-128681170 GGCACTGGGTGGGGTTGAGGGGG + Intergenic
1076587030 10:131556296-131556318 GGCACAGGGCTGTGCTGATGAGG + Intergenic
1076603859 10:131676996-131677018 GGGGCGGGGCCGGGGGGAGGGGG - Intergenic
1076701850 10:132277359-132277381 GGGAGGTGGCCAGGCTGAGGAGG + Intronic
1076869607 10:133186923-133186945 GGAGCCGGGCAGGGCTGAGGAGG - Intronic
1077010184 11:376178-376200 GGCGCGCGGCCGGGCTAATGCGG + Intronic
1077076870 11:706029-706051 GGCAGGGGGCGGGGCGGAGCTGG + Intronic
1077095697 11:798154-798176 CGAACGCGGCCGGGCTGCGGGGG - Exonic
1077239419 11:1502810-1502832 GCCACAGGTCCGGGCTGTGGTGG - Intergenic
1077300314 11:1843751-1843773 GGGACGGAGCCGGGCTCAGAGGG - Intergenic
1077491332 11:2862333-2862355 GGCAGGGGGCCGGGCCGGGCCGG - Intergenic
1077527338 11:3075101-3075123 GGCAGTGGGCCAGGCTGATGGGG - Intergenic
1077551729 11:3203441-3203463 GGCACAGGACCGGCCGGAGGAGG - Intergenic
1078901091 11:15643620-15643642 GGCAGGGGGCAGGGCTGTGAGGG - Intergenic
1080735516 11:35010175-35010197 GGCACAGGGTGGGGCTGAGCTGG - Intronic
1082004788 11:47413559-47413581 GGCAGGAGGCAGGGCTGAGTGGG - Intronic
1083173748 11:60937050-60937072 GACAAGGGGCAGGGCAGAGGGGG - Exonic
1083180459 11:60981802-60981824 GGCAGGATGCAGGGCTGAGGAGG + Intronic
1083208292 11:61166577-61166599 GGGTCGCGGCCGGGCAGAGGCGG + Intergenic
1083306631 11:61765087-61765109 AGCACGAGGCCTGGCTGAGTGGG - Intronic
1083615013 11:64021923-64021945 GGCAGGGGGCCGGGGGGGGGGGG + Intronic
1083826011 11:65204597-65204619 TGCACAGGGACGTGCTGAGGAGG + Intronic
1083829269 11:65221012-65221034 CACACGGGGCCGGACTGTGGCGG + Intergenic
1083849006 11:65354697-65354719 GGGCCGGGGCGGGGCTGCGGCGG + Intergenic
1083885880 11:65573301-65573323 GGGGCGGGGCTGGGCTGGGGTGG + Intronic
1083886194 11:65574527-65574549 CGCGCGGGGCGGGGTTGAGGCGG + Intergenic
1083900506 11:65641109-65641131 GGCACGGGGGCTGGCTGGCGTGG - Exonic
1084008417 11:66334990-66335012 AGCACGGGGACGGGGGGAGGTGG + Exonic
1084030844 11:66479895-66479917 GGATCGGGCCAGGGCTGAGGTGG - Intergenic
1084039762 11:66535320-66535342 GGGATGGGGGTGGGCTGAGGTGG - Intronic
1084046087 11:66568409-66568431 GGCTCGGGGCTGGGCGGGGGCGG + Exonic
1084169902 11:67396063-67396085 GGCCCCGGGCTGGGCTGAGCTGG - Intronic
1084270511 11:68026941-68026963 GGCAGGGAGGCGGGTTGAGGAGG - Intronic
1084758405 11:71252814-71252836 AGCCCGGGGCGGGGCAGAGGCGG - Intergenic
1084960162 11:72712357-72712379 GATGGGGGGCCGGGCTGAGGAGG + Intronic
1084968072 11:72754779-72754801 GGCACCGGGCCAGGCCCAGGCGG - Exonic
1085205810 11:74731313-74731335 GGCTCGGGGTCGGGCCGCGGGGG + Intronic
1085307567 11:75496611-75496633 GGCACTGTGCCAGGCTGAGCAGG - Intronic
1085724376 11:78941581-78941603 GGCACGGCGCCGGGGCGGGGTGG + Intronic
1089543565 11:119205990-119206012 GGGGCGGGGCCAGGCTGGGGCGG - Intergenic
1089776018 11:120836564-120836586 GGTAGGGGGCCAGGCGGAGGTGG + Intronic
1090236861 11:125154681-125154703 TGCACGGGGCGGGGGTGTGGTGG + Intergenic
1091216069 11:133903000-133903022 GGCAGGGGGTTGGGCTGGGGAGG - Intergenic
1091447283 12:551270-551292 ATCACGGGGCTGGGCTGAGTTGG - Intronic
1091695608 12:2626196-2626218 GGCAGGGCGCTGGGCAGAGGTGG - Intronic
1091695830 12:2627556-2627578 GGCAGGGCGCTGGGCAGAGGTGG - Intronic
1092171344 12:6375603-6375625 GGCGGGGGGAGGGGCTGAGGAGG + Intronic
1093452818 12:19335139-19335161 TACTCGGGGCAGGGCTGAGGTGG - Intronic
1094536085 12:31324168-31324190 GGCGCCGGGCCGGGCTGGCGCGG - Intronic
1095945321 12:47750307-47750329 GGTACGGGGCAGGGCTGGGAGGG + Intronic
1096389419 12:51217577-51217599 GGGAGGGGGCCGGGCAGGGGAGG - Intronic
1097981517 12:65741644-65741666 GGGGCGGGGCCGGGCGGCGGGGG + Intergenic
1101131725 12:101697597-101697619 GGCTGGGGGCGGGGCGGAGGGGG - Intronic
1101605994 12:106247999-106248021 GGAAGGAGGCCGGGCCGAGGAGG + Intronic
1101946283 12:109139806-109139828 GCCCTGGGGCCTGGCTGAGGAGG - Exonic
1102016761 12:109653240-109653262 TGCCCAGGGCAGGGCTGAGGAGG + Intergenic
1102084345 12:110124178-110124200 GGGACGGGGCGGGGCGGACGGGG - Intergenic
1102186106 12:110950474-110950496 GGCTGGTGGCCGGGCAGAGGGGG + Intergenic
1102278336 12:111599330-111599352 GGGCCGGGGCCGGGCGGGGGAGG + Exonic
1102490603 12:113287761-113287783 GGCAGGGGGCGGGACGGAGGCGG - Intronic
1103074202 12:117969088-117969110 GGGCCGGGGCCCGGCTGGGGCGG - Intergenic
1103626952 12:122226774-122226796 GGCTCTGATCCGGGCTGAGGAGG + Intronic
1103918941 12:124389590-124389612 GGCAGGGGGCAGAGCTCAGGTGG - Intronic
1104136496 12:125944621-125944643 GGTGCAGGGCGGGGCTGAGGTGG + Intergenic
1104821944 12:131682322-131682344 GGGACGGGGCGGGGAAGAGGTGG + Intergenic
1104857827 12:131910140-131910162 GGCACCTGCCCGGGCGGAGGTGG - Intronic
1104860294 12:131919919-131919941 GACACGGGGCAGGGCTGGAGTGG - Intronic
1104989676 12:132618661-132618683 GGGGCGGGGCCGGGGCGAGGCGG + Intergenic
1105004328 12:132711347-132711369 GGGCCGGGGCGAGGCTGAGGTGG + Intronic
1105405326 13:20128186-20128208 GGCCAGGGCCCGGGCGGAGGGGG + Intergenic
1105459175 13:20567375-20567397 GGCCCCGGGGCGGTCTGAGGCGG + Intronic
1105492620 13:20902966-20902988 GGCACCGGGCGAGGCCGAGGCGG + Intronic
1106408703 13:29496302-29496324 GCCACGGGGCAGGTCTGAGCAGG + Intronic
1106735666 13:32586268-32586290 CGGACGGGGCGGGGCTGAGGAGG + Intergenic
1107250033 13:38349472-38349494 GGCCGGGGGCGGGGCTGGGGCGG - Intergenic
1108555678 13:51589318-51589340 GGGAAGGGGCTGGGATGAGGGGG + Intronic
1110356754 13:74575889-74575911 GGCCTGGGGCCGGGCCGGGGCGG - Intergenic
1110558399 13:76885733-76885755 GGCCCCGGGCCGGGCTGCTGGGG + Exonic
1111445856 13:88345481-88345503 GGCGCGGGGATGGGCGGAGGGGG + Intergenic
1112024835 13:95402545-95402567 GGCACTTTGCGGGGCTGAGGCGG - Intergenic
1112326049 13:98443524-98443546 GGCACGGGACTGGGGAGAGGAGG - Intronic
1113453866 13:110433292-110433314 ACCAGGCGGCCGGGCTGAGGAGG + Intronic
1113543076 13:111123868-111123890 GGCAGGGGGCGGGGCCGGGGGGG - Intronic
1113909090 13:113833491-113833513 GGCACAGGCCCAGGCTGAAGAGG + Intronic
1114031491 14:18584105-18584127 GGCTCGGGCCCCGGCTGAGGAGG + Intergenic
1114292410 14:21299247-21299269 AGCACTTTGCCGGGCTGAGGTGG - Intronic
1114529458 14:23386657-23386679 GGCACAGGGCAGGGTTGAGAGGG + Intronic
1115119962 14:29927523-29927545 GGCGCAGGGCCGGGCAGCGGAGG + Exonic
1116452842 14:45083987-45084009 GGGGCGGGGCGGGGCTGCGGGGG + Intergenic
1118389089 14:65281180-65281202 GCCAGGGGGCCCGGCTGTGGTGG - Intergenic
1119611981 14:76071132-76071154 GGAACGGGGGCCGGGTGAGGTGG + Intronic
1119808676 14:77498907-77498929 GGCACGGGGCCGCGCGGGGCGGG + Intergenic
1121027770 14:90629039-90629061 GGCATGGTGCCAGGCTCAGGAGG - Intronic
1121257649 14:92542929-92542951 GGAAGGGGGCAGGGCTGGGGAGG + Intronic
1121473430 14:94174195-94174217 GGGAAGGGGCGGGGCCGAGGCGG + Intronic
1121473448 14:94174249-94174271 GGCTCGCGGGCGGGCTGCGGGGG - Intronic
1121645864 14:95516679-95516701 GGGGCGGGGCAGGGCTGGGGCGG + Intronic
1122211704 14:100178056-100178078 GGCACTGGGCTGGGCTGGGCTGG - Intergenic
1122466649 14:101938329-101938351 GGGAAGGGGCAGGGCTGGGGTGG - Intergenic
1122558226 14:102592778-102592800 GGCGCGGGGCCGGGCGGGCGCGG - Exonic
1122602582 14:102929014-102929036 GGGGCGGGGTCGGGCCGAGGTGG - Intronic
1122768916 14:104088538-104088560 TGCAAGGAGCCGGGCTCAGGAGG - Intronic
1122840768 14:104461611-104461633 GGGACGGGGCGGGGCGGGGGCGG + Intergenic
1123084573 14:105711490-105711512 TGGACTGGGCCGGGCTGAGCTGG - Intergenic
1125748615 15:42013838-42013860 GCAACTGGGCCGGCCTGAGGAGG - Intronic
1125950304 15:43746283-43746305 AGCGCGGGGCGGGGCCGAGGCGG - Intergenic
1126686362 15:51252009-51252031 GGCACAGGGAAGGGCTGGGGAGG - Intronic
1126821484 15:52508616-52508638 GGCAGGGGGTGGGGGTGAGGCGG - Intronic
1128733167 15:70034420-70034442 GGCACAGGGCAGGGCTGCTGGGG + Intergenic
1128999260 15:72319471-72319493 GGAAGGGGGCTGGGCTGAGGTGG + Intronic
1128999455 15:72320070-72320092 GGGGCGGGCCCGGGCCGAGGTGG + Exonic
1129192599 15:73946330-73946352 GGCTGGGGGTGGGGCTGAGGGGG + Intronic
1129658729 15:77541523-77541545 GGACCGGGGCAGGGCTGGGGAGG - Intergenic
1129807837 15:78479244-78479266 GCCACTGGACCTGGCTGAGGGGG + Intronic
1130381911 15:83378962-83378984 GGAACGGGGTGGGGGTGAGGAGG + Intergenic
1130968109 15:88711968-88711990 GGCACAGTGCTGGGGTGAGGTGG + Intergenic
1131058650 15:89391154-89391176 GGCAGGGGACAGGGCTGAGAAGG + Intergenic
1131199952 15:90388089-90388111 AGGGCGGGGCCGGGCTGAGGGGG + Intergenic
1131331093 15:91500168-91500190 GACACGGGGCCGGGAGGTGGGGG + Intergenic
1131475385 15:92734218-92734240 GGCGCGCGGCGGGGCGGAGGCGG - Intronic
1132121393 15:99179075-99179097 GGCACAGAGCAGGGCTGAGAAGG + Intronic
1132453227 15:101979897-101979919 CGCACGGCGCCGGGCTGGGGCGG - Intergenic
1132467467 16:84052-84074 GGCACGGGGCTGTGGTGATGAGG + Intronic
1132525887 16:414501-414523 GCCACGGCGCCTGGCCGAGGTGG + Intergenic
1132553489 16:563119-563141 GGCACGTTGCAGGGCAGAGGCGG + Intronic
1132588177 16:715212-715234 GGCGCGGGTCCGGGCGGCGGCGG - Exonic
1132668704 16:1094076-1094098 GGGTCGGGGCCGGGCTGGGCAGG + Intronic
1132690275 16:1178940-1178962 GGCACGGGGCCAGCCTGCTGGGG - Intronic
1132741368 16:1414828-1414850 GGCCGGGGGCGGGGCTGCGGGGG - Intergenic
1132860818 16:2070919-2070941 GGCACAGGGCAGAGCTGAGAGGG + Intronic
1132907813 16:2292311-2292333 GGCACTGTGCCTGGCCGAGGGGG - Intronic
1132957553 16:2603515-2603537 GGCTCGGGGCGGGGTTGGGGTGG + Intergenic
1132987869 16:2777343-2777365 GGCACGGGGCGGGGCTGCGCCGG - Intergenic
1133006007 16:2882396-2882418 GGCGCGGAGCCAGGCTTAGGGGG + Intergenic
1134020224 16:10916271-10916293 GGCAGGTGCCAGGGCTGAGGAGG + Intronic
1136296808 16:29308677-29308699 GGCAGAGGGACGGGCAGAGGGGG - Intergenic
1136460604 16:30407880-30407902 AGCGTGGGGCCGGGCTGGGGTGG + Intronic
1137719917 16:50621909-50621931 GGGCTGGGGCTGGGCTGAGGGGG - Intronic
1138398888 16:56730010-56730032 GGCCGGGGGCGGGGCGGAGGTGG - Intronic
1139917843 16:70439146-70439168 GGGGAGGGGCCGGGCTGAGGCGG - Intronic
1141461639 16:84181487-84181509 GGCAGGGGGACAGGCTGATGGGG + Intronic
1141641499 16:85344229-85344251 GGTACGGTCCCTGGCTGAGGAGG + Intergenic
1141648116 16:85378147-85378169 AGCTTGGGGCAGGGCTGAGGAGG + Intergenic
1141662505 16:85449040-85449062 GGCAGGTGGCCGGGCGCAGGAGG + Intergenic
1141690449 16:85593571-85593593 GCTAAGGGGCCGGGCTGGGGAGG - Intergenic
1141888853 16:86912954-86912976 GGCATGGGGCAGGTCTGTGGAGG - Intergenic
1141996329 16:87638577-87638599 GGACAGGGGCAGGGCTGAGGTGG + Intronic
1142221389 16:88856720-88856742 GGGACGGGGCAGGGCCGGGGTGG - Intronic
1142434520 16:90047870-90047892 GGGGCGGGGCCGCGGTGAGGGGG + Intergenic
1142808641 17:2385051-2385073 GCCACGGGGTCTGGCGGAGGTGG + Exonic
1143400759 17:6640611-6640633 GGCTCGGGCCGGGGCTGGGGGGG - Intronic
1143499213 17:7329245-7329267 GGACCGGGGCCGGGCGGGGGTGG - Exonic
1144847109 17:18225774-18225796 GGCCCGGGCCCGGGCTCGGGCGG + Intronic
1145286664 17:21511471-21511493 GGCAGGGCGCCGGCCTGCGGGGG + Intergenic
1145388306 17:22435251-22435273 GGGACGGGGCGGGGCGGAGGGGG - Intergenic
1145750629 17:27353244-27353266 AGCACGTTGCCGAGCTGAGGCGG + Intergenic
1146179375 17:30687538-30687560 GGCGCGGGGCGGGGGTGGGGTGG - Intergenic
1146277297 17:31523866-31523888 AGCAGGGGGCCGGGGTGGGGTGG - Intronic
1146304504 17:31720567-31720589 GGAAAGGGGAGGGGCTGAGGAGG + Intergenic
1146322667 17:31859024-31859046 GTCGCGGGGCCGGGCTGGGCGGG - Intronic
1147123726 17:38352006-38352028 GGCTGGGAGCCGGGCTGGGGTGG - Intergenic
1147142231 17:38466315-38466337 GTCACTGGGCAGTGCTGAGGTGG - Exonic
1147450371 17:40500475-40500497 GGCACGGGGCGGGGGCAAGGAGG + Intronic
1147793042 17:43025180-43025202 GGCTGGGGGCGGGGCGGAGGGGG + Intergenic
1148081195 17:44968391-44968413 GGGGCGGGGCCCGGCCGAGGGGG - Intergenic
1148119145 17:45197527-45197549 GGCAGGGGGATGGGCTGGGGAGG + Intergenic
1148489222 17:48012520-48012542 GGTAGTGGGCCGGGCGGAGGAGG - Intergenic
1148495064 17:48048578-48048600 GGCCCAGGGCCGGGCTCTGGCGG - Intronic
1148777970 17:50106122-50106144 GGCCCAGGGCCGGGCTGCTGAGG + Intronic
1149006958 17:51816058-51816080 AGCAGGGGGCCGGGGGGAGGTGG - Intronic
1149994570 17:61399961-61399983 TGCGCGGGGCCGGGCTGGGCCGG - Exonic
1150002828 17:61452197-61452219 GGCACTGGGCCGCGCGGTGGAGG + Intergenic
1150163433 17:62918826-62918848 GGCACTTTGCAGGGCTGAGGTGG + Intergenic
1150463290 17:65370967-65370989 GGCACGGGGCCGGGGAAGGGAGG - Intergenic
1151412175 17:73938260-73938282 TGGACAGGGCGGGGCTGAGGCGG - Intergenic
1151783838 17:76265640-76265662 GCCGCGGGGCCGGGCCGCGGGGG + Intronic
1152108018 17:78342023-78342045 GGCGCGGGGCCAGCCCGAGGCGG + Intergenic
1152357865 17:79815341-79815363 GGCACGGGGCCGGGTGCAGAAGG - Intergenic
1152381538 17:79944877-79944899 GGCAGGGGCCAGGGCTGGGGAGG - Intronic
1152385504 17:79971865-79971887 GGCATGGGGGCTGGCTGTGGGGG + Intronic
1152419054 17:80182351-80182373 GGGACCGGGACGGGGTGAGGAGG - Intronic
1152426275 17:80220366-80220388 GGCAGGGGGCGGGGCCGAGCGGG - Exonic
1152609447 17:81308376-81308398 GGCAGGCAGCCGGGCTGGGGCGG - Intergenic
1152631856 17:81414088-81414110 GGCACGGGTCAGGGCTCAGAAGG - Intronic
1152645870 17:81468274-81468296 GGGAGGGGGCCTGGCTGAAGGGG + Intergenic
1152703134 17:81829322-81829344 GGCAGGGGGCCGGGCTGGATGGG - Intronic
1152710626 17:81869142-81869164 GGCCCCGGGCAGGGCAGAGGGGG - Intronic
1152742105 17:82022930-82022952 GGCGCGGGGCGGGGCTCCGGGGG - Intronic
1153949470 18:10045865-10045887 GACAGGAGGCCGGGCCGAGGAGG + Intergenic
1154370826 18:13761845-13761867 GGCTTGGGGCCGGGGGGAGGGGG - Exonic
1157128661 18:44982277-44982299 GGCAGAGTGCCGGGCTGGGGAGG + Intronic
1157496666 18:48161717-48161739 GGAGCGGGGCGGGGCTGGGGCGG - Intronic
1160567862 18:79798218-79798240 GGCTCGGGGCCGGGCGGGGCTGG + Intergenic
1160665706 19:327087-327109 GGCAGGGGGCCTGGCTGCGGTGG + Intronic
1160865480 19:1254096-1254118 GGGACTGGGCCGGGCTGGGCTGG + Intronic
1160918867 19:1510575-1510597 GGCCAGGGGCCGGGCTGGGCCGG + Intronic
1160937771 19:1605303-1605325 GGCGCGGGGCTGGGCCGAGGCGG + Intronic
1160948743 19:1655661-1655683 GCCTCGGGGCTGGGCAGAGGTGG - Intergenic
1160965109 19:1744041-1744063 GGTGTGGGGCCGGGCTGGGGTGG - Intergenic
1160966544 19:1749304-1749326 GGGAAGGGTCCGGGCTCAGGCGG - Intergenic
1160995687 19:1881070-1881092 GGGACGAGGCCGGCCTGACGGGG + Intronic
1161069264 19:2252324-2252346 GGCAAGGGGCGGGACTGAGCCGG - Exonic
1161074486 19:2278731-2278753 GGCACGGAGCCGGGCATAGATGG + Exonic
1161149949 19:2702451-2702473 GGGACGGGGCTGCGCTTAGGGGG - Intronic
1161256936 19:3314880-3314902 GGCCCGGGGCCGGGGGCAGGAGG + Intergenic
1161285399 19:3465874-3465896 TGCACGGGGCAGGGGAGAGGGGG - Intronic
1161295520 19:3518259-3518281 GGCACTGTGGGGGGCTGAGGTGG - Intronic
1161337426 19:3721937-3721959 GGGAGGGGCTCGGGCTGAGGTGG + Intronic
1161492079 19:4567668-4567690 GGGACTGGGCTGGGCTGAGCTGG - Intergenic
1161620151 19:5293289-5293311 GGCAAGGGGCGGGGCTGTAGGGG + Intronic
1161696703 19:5772755-5772777 GGCACGGGGCAGGGCTGTGCAGG - Intronic
1161699175 19:5785577-5785599 GGCACCGGGGCTGGCTGGGGTGG - Intronic
1161983938 19:7643970-7643992 GGCACGGGGCCTTGGAGAGGTGG + Intronic
1162477273 19:10908158-10908180 GGGAGGCGGCCTGGCTGAGGGGG - Intronic
1162720125 19:12657259-12657281 GGAACGGGGCGGGGCTTTGGAGG - Intronic
1162905003 19:13818068-13818090 GGCTAGGGGCGGGGCTGGGGCGG - Intronic
1162976457 19:14209382-14209404 GGCGAGGGGCGGGGGTGAGGGGG - Intergenic
1163012169 19:14433262-14433284 GGGAGGGGGCGGGGCCGAGGGGG - Intronic
1163029852 19:14537095-14537117 AGGAGGGGGCAGGGCTGAGGTGG + Intronic
1163117911 19:15199761-15199783 GCCCCGGGGCTGGGCTGGGGAGG + Intronic
1163519633 19:17784246-17784268 CGCATGGGGCCGGGAGGAGGTGG + Intronic
1163523774 19:17807969-17807991 GGCACGGGGCCGGGGCTGGGCGG - Exonic
1163686747 19:18716103-18716125 GGCACTGGGCAGGGCAGCGGGGG - Intronic
1163727213 19:18929532-18929554 GGAGCGGGCGCGGGCTGAGGTGG - Exonic
1166066025 19:40359458-40359480 GGCATTGAGACGGGCTGAGGAGG + Intronic
1166365143 19:42274364-42274386 GGCACGGGGGCTGGCAGAGGTGG - Intronic
1166718651 19:44985142-44985164 GGCAGGGGTCCGGGCTCTGGAGG + Intronic
1166721809 19:45001437-45001459 GGCGCGGGGCCGGGCCGGGCGGG - Exonic
1166948494 19:46411757-46411779 GGCAGGGGCCCCAGCTGAGGAGG - Exonic
1167264181 19:48475202-48475224 GGCCCTGAGCTGGGCTGAGGAGG + Intronic
1167521430 19:49958392-49958414 GGCCCAGGGCCCGGCTGAGCTGG + Exonic
1167523944 19:49972327-49972349 GGCCCAGGGCCCGGCTGAGCTGG - Intergenic
1167637943 19:50666393-50666415 GCCAAGGGCCCGGGCAGAGGTGG + Exonic
1167643790 19:50695269-50695291 GGCGCGGGGTCGGGCCGCGGCGG + Intronic
1167679390 19:50909836-50909858 GGCATGGGGGTGGGCTGAGAAGG + Intronic
1167696534 19:51018745-51018767 GGAGCGGGGCCGGGATGGGGCGG + Intronic
1167706557 19:51084522-51084544 GGCTAGGGGAGGGGCTGAGGAGG - Intergenic
1167756119 19:51414930-51414952 GGCCCAGGGCCCGGCTGAGCTGG + Exonic
1167991579 19:53365568-53365590 GGGGCGGGGCTGGGCTGGGGCGG - Intergenic
1168303677 19:55421854-55421876 GCCACTGCGCCCGGCTGAGGTGG - Intergenic
1168408064 19:56120999-56121021 GGCGCGCGGCCGGGGTGACGCGG - Intronic
1168436055 19:56317704-56317726 GGCAGGTGGCAGGGCTGGGGCGG + Intronic
1168669704 19:58231193-58231215 GGCATTGGGCTGGGCTGGGGTGG + Intronic
925003691 2:426137-426159 GGCACGGCGCCCTGCTGAGTGGG - Intergenic
926131393 2:10304855-10304877 GGCATGGGGTTGGGCTGCGGAGG + Intronic
926202641 2:10812735-10812757 GGCACGCTGCAGGGCTGAAGCGG - Intronic
927679771 2:25131916-25131938 GGCGCGGGGCCGGGCCGGGGCGG + Intronic
927713790 2:25340852-25340874 GGCCCGGGCCCGGGCCGCGGGGG - Intronic
927812019 2:26185446-26185468 GGCACTGGGGCGGGCGGTGGCGG + Intronic
927863409 2:26574342-26574364 GGCACATGGCTGGGCTCAGGTGG + Intronic
927881442 2:26692659-26692681 GGCGCGGGGCCGGGCGGAGGAGG + Intergenic
928093743 2:28392100-28392122 GGCACGGCGCCGGGCGGGGCTGG - Intergenic
928928068 2:36598185-36598207 GGGGCGGGGCCGGGCTGGGCGGG - Exonic
929535993 2:42784424-42784446 GGCAAGGGGTGGGGCTGTGGAGG + Intronic
929607233 2:43242896-43242918 GGCACTGGGCAGGGTGGAGGAGG - Intronic
929765907 2:44843885-44843907 GGCACGGGGCTGGGCACAAGGGG + Intergenic
929979390 2:46664500-46664522 GGCATGTGGCCAGGGTGAGGTGG - Intergenic
930022169 2:47008071-47008093 GGGACAGGGCCGGGAGGAGGTGG + Intronic
930660068 2:54044472-54044494 GGCACAGTGCCAGGCTGAGGTGG + Intronic
931762847 2:65432242-65432264 GGCTCGGGAGCGGGCAGAGGGGG + Intronic
932215166 2:69961714-69961736 GGCAGGAGGGCGGGGTGAGGAGG - Exonic
932578909 2:72980828-72980850 GGCAGGGGGCCTGGCTGGGCTGG - Intronic
932831081 2:74990711-74990733 GGCCCAGGGCAGGGCAGAGGAGG + Intergenic
934059961 2:88284285-88284307 AGCACAGGGCCAGGCGGAGGCGG - Intergenic
935186044 2:100733869-100733891 GGAACGGGGTGGGGGTGAGGCGG + Intergenic
935397018 2:102619749-102619771 TGCACGGGGCAGGGCGGAGCGGG + Exonic
936006950 2:108897575-108897597 CCCATGGGGCTGGGCTGAGGAGG + Intronic
936104687 2:109614288-109614310 GGCGCGGGGCGGGGGTGCGGGGG + Intergenic
937150936 2:119685200-119685222 GGGGGGGGGGCGGGCTGAGGAGG - Intronic
937311529 2:120906060-120906082 GGCAGGAGGCTGGGCTCAGGTGG - Intronic
940145675 2:150542498-150542520 GGCGGGGGGCCGGGGAGAGGCGG + Intergenic
942134313 2:172910057-172910079 GGCAAGGGGCTGGACTGATGGGG - Intronic
942305105 2:174599555-174599577 GGCATGGGGCTGGACAGAGGTGG + Intronic
945119647 2:206444036-206444058 GGCGCGGGGCCGGGACGAGGCGG - Exonic
945955408 2:216081859-216081881 GGGGCGGGGCCGGGCCGGGGAGG - Exonic
946306514 2:218859727-218859749 GGCAGGGGGCCGGAGGGAGGTGG - Intergenic
946313259 2:218894614-218894636 GGCGCTGGGCTGGGCTGAGCTGG - Intronic
946354967 2:219178652-219178674 GGGGCGGGGCCGGGATGAGCGGG + Intronic
946399177 2:219459848-219459870 GGCTGGGGGCCGGGCAGAGGAGG - Intronic
947123697 2:226844278-226844300 GGCAAGGGGCCGGGGGGCGGGGG - Intronic
947749589 2:232525433-232525455 GGCAGGGGCCCGGGCTGGAGAGG + Exonic
948393338 2:237627571-237627593 GGGCCGGGGCCGGGCCGGGGCGG + Intronic
948483959 2:238268263-238268285 GGCATGGGGCCCAGGTGAGGAGG - Intronic
948508686 2:238448627-238448649 TGCACCGGGCAGGGCTGGGGAGG - Exonic
948753750 2:240146791-240146813 GGCACAAGGCTGGGCTGGGGTGG + Intergenic
948887690 2:240892336-240892358 GGCAGGGGGCAGGGGGGAGGAGG - Intronic
948910274 2:240999152-240999174 GGCACCGGGGCGGCCCGAGGTGG + Intronic
948911104 2:241003108-241003130 GGCCCGGGGGAGGGCGGAGGGGG - Intronic
948988699 2:241541220-241541242 GGCGAGGGGCGGGGCCGAGGCGG + Intergenic
1168802381 20:651909-651931 AGCACGGCGCCTGGCTGAGATGG - Intronic
1169073763 20:2749574-2749596 GTCAGGGGACCGCGCTGAGGTGG - Intronic
1172008439 20:31832775-31832797 GCCACTGTGCCTGGCTGAGGTGG + Intronic
1172100935 20:32483645-32483667 GGCACGGGGCGGGGGCGGGGGGG + Intronic
1172116707 20:32577261-32577283 GCCAGGGGGCCGGGCGGGGGTGG + Intronic
1172457109 20:35086024-35086046 GGAAGGGGGCAGGGCTGAGGTGG - Intronic
1172637771 20:36421557-36421579 GGCCTGGGGCAGGGCTGTGGAGG + Intronic
1172874280 20:38154817-38154839 GCCACCGTGCCCGGCTGAGGTGG - Intronic
1172973142 20:38888119-38888141 GCCATAGGGCAGGGCTGAGGTGG - Intronic
1174287703 20:49484022-49484044 GTCCCGGGGCCGGGCTGAGCCGG + Intergenic
1174365258 20:50052982-50053004 GGGAGGGGGCGGGGCTGAGAGGG - Intergenic
1175141005 20:56860188-56860210 GGGACGGGGAGGGGCTGAGAGGG - Intergenic
1175206554 20:57316092-57316114 GTCACGGGGCTGGGGTGGGGAGG + Intergenic
1175215822 20:57391332-57391354 GGCTGGGGGCGGGGCTGAGCTGG + Intergenic
1175429529 20:58891686-58891708 GGGGCGCGGCCGGGCTGCGGCGG - Intronic
1175553023 20:59829102-59829124 GGCACGGAGCAGGTGTGAGGAGG + Intronic
1175800521 20:61798604-61798626 AGCAAGGGGCCTGGCCGAGGTGG - Intronic
1175831098 20:61965877-61965899 GGCCGGGGGCAGGGCCGAGGCGG - Intronic
1175847503 20:62066193-62066215 TGCGCTGGGCCGGGCCGAGGCGG + Intergenic
1175862115 20:62156151-62156173 AGCACGGGGCCGGGATGGGCCGG - Intronic
1176062692 20:63179156-63179178 GCCGCGGGGCGGGGCGGAGGCGG + Intergenic
1176265877 20:64209094-64209116 GGCCTGGGGCTGGGCTGACGTGG + Intronic
1176284545 21:5012515-5012537 GTGAGGGGGCAGGGCTGAGGGGG - Intergenic
1177457163 21:21355328-21355350 GGGACGGGGCCGGGAAAAGGGGG + Intronic
1178629393 21:34246027-34246049 GGTGAGGGGCCAGGCTGAGGTGG + Intergenic
1178703947 21:34857683-34857705 GGCAAGGGGCCTGGCTGGGAGGG - Intronic
1179470229 21:41605483-41605505 GGAAAGGGGCTGGGCTGACGAGG - Intergenic
1179788817 21:43743899-43743921 GGCACGGAGGCGTGCAGAGGAGG - Intronic
1179872636 21:44250960-44250982 GTGAGGGGGCAGGGCTGAGGGGG + Intronic
1179902578 21:44401707-44401729 GGCACGGGCGCGGGCCGCGGGGG - Exonic
1179972895 21:44846055-44846077 AGCACGGGGCACGGCTGTGGAGG - Intergenic
1180205254 21:46255768-46255790 GGCAGAGGTCTGGGCTGAGGGGG + Intronic
1180455603 22:15511162-15511184 GGCTCGGGCCCCGGCTGAGGAGG + Intergenic
1181478113 22:23180873-23180895 CGCCCGGGGCCGGGCTGGCGAGG + Exonic
1181571981 22:23772775-23772797 GGCGGGGGGCGGGGCCGAGGCGG + Intronic
1181590820 22:23883920-23883942 TGGACGGGGCGGGGGTGAGGTGG - Intronic
1181747562 22:24966425-24966447 GGCACTGGGCAAGGCTGAGCGGG - Intronic
1182049021 22:27299195-27299217 GGAAGGGGGCCGAGCTGGGGAGG + Intergenic
1182195239 22:28508903-28508925 GCCACGGTGCCTGGCTTAGGTGG - Intronic
1182550192 22:31096770-31096792 GGCACGGGGCCGGCCAGGGGAGG + Exonic
1183185473 22:36289234-36289256 GGAGCGCGACCGGGCTGAGGCGG - Exonic
1183256242 22:36764220-36764242 GGCAGGAGGCAGGGCTGGGGCGG + Intronic
1183520442 22:38293638-38293660 GGCAGGTGGCCTGGCAGAGGTGG - Intronic
1183535624 22:38398930-38398952 GGCGCGGGGGCGGGGTGGGGCGG - Intergenic
1183598614 22:38827024-38827046 GGCCAGAGGCAGGGCTGAGGAGG + Intronic
1183650828 22:39152464-39152486 GGCCCGGGGCCGGGCCGGGCCGG + Exonic
1183702483 22:39457934-39457956 GGCGCGGCGCGGGGCTGGGGTGG + Intronic
1183865902 22:40703959-40703981 GGCTGGCGGCCAGGCTGAGGCGG - Intergenic
1184037694 22:41926387-41926409 GGGACGGGGAGGGGCGGAGGGGG + Intronic
1184066748 22:42125736-42125758 GGCACTGGGGCGGGCAGAGAAGG - Intergenic
1184069216 22:42137888-42137910 GGCACTGGGGCGGGCAGAGAAGG - Intergenic
1184278595 22:43424923-43424945 GGCGGGGGGCCGGGCTGCGGTGG + Exonic
1184515133 22:44957076-44957098 GGGAGGGGGCGGTGCTGAGGTGG - Intronic
1184767038 22:46577406-46577428 GGCTCGGGCCCGGGCGGCGGCGG - Intronic
1185038203 22:48490351-48490373 GGCGCGGGCGCGGGCTGGGGTGG + Intronic
1185288113 22:50011279-50011301 GGCAAGGGCAGGGGCTGAGGCGG - Intronic
1185313787 22:50170352-50170374 GGGCGGGGGCCGGGCTGCGGCGG + Intergenic
1185332243 22:50257021-50257043 GCCTCGGGGCTGGGCAGAGGAGG - Intronic
1185337950 22:50279130-50279152 GGCTCGGAGCCGGGCTGGCGGGG - Intronic
1185346693 22:50313578-50313600 GGCACGGGGCTGGGGGGATGGGG - Intronic
1185346949 22:50314575-50314597 GGCAAGAGGCGGGGCAGAGGCGG + Intronic
1185400439 22:50612886-50612908 GGGGCGGGGCCGGGCAGGGGCGG - Intronic
1185403019 22:50628146-50628168 GTCACGGGGCGGGGCCGAGGCGG - Exonic
949414343 3:3799678-3799700 TGCACGGGGCTGGGCTCAGTCGG - Exonic
950012281 3:9731996-9732018 GGCAGGGGGCCGGGGTGGCGAGG + Exonic
950078410 3:10203906-10203928 GCCACCGCGCCTGGCTGAGGAGG + Intronic
950683911 3:14603012-14603034 GGGCCGGGGCCGGGCTGGCGAGG - Intergenic
951543672 3:23806198-23806220 GGCACGGGGCCGGCGCGGGGGGG + Intronic
951881493 3:27484547-27484569 GGCCCGCGGGCGCGCTGAGGAGG - Intergenic
952980180 3:38727838-38727860 GGCAGGGGGCCAGGCTGGGGCGG + Intronic
953035075 3:39204018-39204040 GCCAGGTGGCGGGGCTGAGGAGG + Intergenic
953390040 3:42528561-42528583 GGCACGGGGACGGGGGGAGTAGG - Intronic
953930965 3:47005456-47005478 GGCACGGGGCCAAGGTGAGGTGG - Intronic
954145502 3:48632407-48632429 GGCACGGGGCAGGTCTGAAGAGG + Intronic
954198036 3:49007806-49007828 GGAACGCGGCCGCGCGGAGGCGG + Intronic
954198072 3:49007907-49007929 GAGACGGGGCCGAGCTGGGGGGG + Intronic
954378717 3:50208185-50208207 GCCAGGGGGCCCAGCTGAGGGGG - Intronic
954539289 3:51383071-51383093 GGCCCAGGGCCTGGCTGTGGAGG - Exonic
954800921 3:53186488-53186510 GGGACAGGCCCTGGCTGAGGTGG - Intronic
955161483 3:56468463-56468485 GGCGCGGGGCCGGGCGGGGCCGG + Intergenic
955380456 3:58433947-58433969 GCCGCGGGGCCGGGCTGAGGTGG + Intergenic
955492728 3:59499367-59499389 TGCACGGCACTGGGCTGAGGCGG + Intergenic
959012938 3:101099244-101099266 TGAACAGGGCTGGGCTGAGGAGG - Intergenic
959984968 3:112561986-112562008 AGAAAGGGGCCGGGCTGGGGCGG + Intronic
961545283 3:127629077-127629099 GGCACGCGGCCGGGCGGGGCCGG + Intergenic
961650946 3:128416376-128416398 GGAGCTGGGCGGGGCTGAGGTGG - Intergenic
961696604 3:128709642-128709664 GGCGCGGGGGCGGGGTGTGGCGG - Intergenic
962259769 3:133895233-133895255 GGGGCGGGGTCGGGCTGGGGAGG - Intronic
963028454 3:140942387-140942409 CCCGCGGGGCCGGGGTGAGGCGG + Intronic
963416139 3:144998440-144998462 GGCACAGAACGGGGCTGAGGCGG - Intergenic
963604920 3:147405745-147405767 GGCAAGGAGCCGCCCTGAGGTGG + Intronic
967025635 3:185561512-185561534 GGCACGTGACCGTGGTGAGGCGG - Intergenic
968063952 3:195747965-195747987 GGGGCGGGGCCGGGCTGGGGCGG - Intronic
968536506 4:1133937-1133959 GGCACTGGCTCAGGCTGAGGAGG - Intergenic
968548923 4:1212662-1212684 GGCACGGGGCCTGTGGGAGGAGG - Intronic
968610971 4:1556838-1556860 GGCAGGGGGTGGGGCCGAGGAGG - Intergenic
968650623 4:1758960-1758982 GGCACAGGGCTGGCCTGGGGTGG - Intergenic
968701323 4:2059463-2059485 GGGACGCGGCCGGGCGGCGGCGG - Intergenic
969263353 4:6047435-6047457 GGCACGGGGCGGGGCACATGGGG - Intronic
969269929 4:6092481-6092503 TGCACGGGGCTTGGCAGAGGTGG + Intronic
969330746 4:6472371-6472393 GGCAGGGGGACGGGCGGGGGCGG + Intronic
969712026 4:8850020-8850042 GGCACATGGGTGGGCTGAGGGGG - Intronic
971713004 4:30141333-30141355 GGCAGGGGGCAGGGTTGAGATGG + Intergenic
972727149 4:41754730-41754752 GGCACGGGGTGGGGGTGGGGTGG + Intergenic
973532117 4:51844199-51844221 GGTCCGGAGCCGGGCTAAGGGGG + Intronic
973532151 4:51844311-51844333 AGGAGGGGGCGGGGCTGAGGTGG + Intronic
973894176 4:55395907-55395929 GGGACGGGGCCGGGAGGAGTCGG + Intergenic
974000546 4:56506884-56506906 GGGGCGGTGCCAGGCTGAGGTGG - Intronic
977173391 4:93790109-93790131 GGCACGGGGTAGGGGTGGGGTGG - Intergenic
980075293 4:128287810-128287832 GGCAGGGGGCGGGGAGGAGGAGG - Exonic
983940033 4:173528696-173528718 GGCAGGCGGTGGGGCTGAGGGGG - Intronic
984462865 4:180058685-180058707 GGCGCGGGGCCGGGCGGGCGGGG - Intergenic
984911692 4:184679715-184679737 GGCAGGAGGCGGAGCTGAGGTGG - Intronic
985085140 4:186305616-186305638 TGCATGGGGCCAGGCTGGGGCGG - Intergenic
985475987 5:79389-79411 GGCAGGGAGCCGTGCTGAGCAGG + Intergenic
985580534 5:693399-693421 GGCCCGGGACCGGGCTGGGCGGG - Intergenic
985589428 5:756962-756984 GGCTCGGAGCCTGGCTGTGGGGG + Intronic
985718202 5:1474704-1474726 GCCACGAGGCTGGGCTGACGGGG - Intronic
986172250 5:5324497-5324519 AGGATGGGGCCAGGCTGAGGGGG + Intergenic
986631960 5:9782457-9782479 GGGGCGGGGCGGGGCTGGGGGGG + Intergenic
986647123 5:9928389-9928411 GGGAGGGGGCAGGGCAGAGGAGG - Intergenic
987132421 5:14871879-14871901 GCCCCGGGGGCGGGCTGGGGAGG + Intergenic
988825332 5:34929750-34929772 GGCCCGGGCCCGGGCCGAAGCGG - Exonic
991967442 5:72107271-72107293 GGCAGGGAGCCGGGAGGAGGAGG - Exonic
992376932 5:76197498-76197520 GGCTGGGGACAGGGCTGAGGGGG + Intronic
995499714 5:112791443-112791465 GGCAGGAGGCAGGGCTCAGGTGG - Intronic
995735645 5:115296821-115296843 GGCAAGGTGCCGGGCGGAGCCGG + Exonic
996759752 5:126975239-126975261 GCCACTGGGCCTGGCTGAAGTGG + Intronic
998385279 5:141753743-141753765 GGAAGGGGACCGGGCTGGGGCGG + Intergenic
999379207 5:151108610-151108632 GGCACTGGGTGGGGCTGAGGAGG - Intronic
999384016 5:151141577-151141599 GGCACGGAGACGGGGAGAGGGGG - Intronic
999478666 5:151925031-151925053 GGCTCTGGGCCGGCCTGAGGGGG + Intergenic
1001057386 5:168461040-168461062 GCCACGGGGCCCGGCTGGGTTGG - Intronic
1001314714 5:170633743-170633765 GGCGGGGGGCGGGGCGGAGGGGG + Intronic
1001342596 5:170861833-170861855 GGGACGGGGCGGGGCTGGGAGGG - Intergenic
1002366636 5:178717533-178717555 GGAAAGGGGCAAGGCTGAGGGGG + Intronic
1002497071 5:179622960-179622982 GGCGGGCGGCCGGGCTGGGGCGG - Intronic
1002576883 5:180179006-180179028 GGCCTGGGGCCGGGAGGAGGCGG + Intronic
1003107649 6:3228081-3228103 GGCAGGTGGGAGGGCTGAGGTGG + Intronic
1003280509 6:4686888-4686910 GCCAAGGGGCCGGGCGGGGGAGG + Intergenic
1003868513 6:10383694-10383716 GGGACGGGGTGGGGCTGTGGGGG + Intergenic
1004167998 6:13273907-13273929 GGCACGGGGCGGGGCGGGGCGGG - Intronic
1004660644 6:17706465-17706487 GGGCCGGGGCCGGGCGGCGGGGG - Exonic
1006300979 6:33193382-33193404 GGGGCGGGGCCGGCCGGAGGAGG - Intergenic
1006366914 6:33621403-33621425 GGCCCGGGGTCCGGGTGAGGAGG - Exonic
1006369415 6:33634662-33634684 GGCATGGGGAGGGGCTGAGCTGG + Intronic
1006396043 6:33788510-33788532 GGCGAGGGCCCGGCCTGAGGTGG - Exonic
1006414068 6:33893058-33893080 GGGGCGGGGCCGGGGCGAGGGGG + Intergenic
1006441824 6:34058042-34058064 GGACCGGGGCTGGGCAGAGGTGG + Intronic
1006442150 6:34059469-34059491 GGACCGGGGCTGGGCAGAGGTGG - Intronic
1006460682 6:34155883-34155905 GGCACAGGGCTGGGCGTAGGGGG - Intergenic
1006461608 6:34162357-34162379 GTCACGGGGGCGGGCTCAGAAGG + Intergenic
1006775130 6:36586610-36586632 GGCACAGAGCAGGGCTGAGAAGG - Intergenic
1007255283 6:40523995-40524017 GGCAGGGGGAGGGGCTGGGGAGG + Intronic
1007290654 6:40783634-40783656 GGCACAGGGCAGGGTGGAGGAGG + Intergenic
1007665460 6:43510524-43510546 GGCAGGCGGCAGGGCTGAGTGGG + Exonic
1007729882 6:43939423-43939445 GGCAGGGGGTGGGCCTGAGGGGG - Intergenic
1007937069 6:45741896-45741918 GGCGCGGGGCGGGGCTGGGGTGG - Intergenic
1010703214 6:79077524-79077546 GGCCGGGGGCCGGGCTCACGGGG - Intronic
1011427587 6:87247241-87247263 GGCAGGGGGCGGTGGTGAGGGGG - Intronic
1012334592 6:98039629-98039651 GGCAGAAGGCAGGGCTGAGGTGG - Intergenic
1013117692 6:107115157-107115179 GGCGCGGGGCCGGGGAGTGGGGG + Intronic
1013409773 6:109873454-109873476 GGCATGGGGCCGGGGAGAGGAGG + Intergenic
1015201215 6:130583458-130583480 GGCAGGAGGCCGAGCTCAGGTGG + Intergenic
1017428025 6:154342614-154342636 GGCAGGGTGAGGGGCTGAGGAGG + Intronic
1019112050 6:169724380-169724402 GGCGAGCGGCGGGGCTGAGGCGG - Intronic
1019175757 6:170158588-170158610 GGAAAGGGGCCGGGCAGAGGTGG + Intergenic
1019179171 6:170176359-170176381 GGGACGGGGCTGAGCTGGGGAGG - Intergenic
1019409555 7:900632-900654 GGCACAGGCTTGGGCTGAGGAGG + Intronic
1019538930 7:1542935-1542957 GGGACGGGGCAGGGCGGCGGCGG - Exonic
1019733661 7:2640267-2640289 GGCGCGTGGCTGGGCTGAGGAGG - Intronic
1020106356 7:5423940-5423962 GGCCGGGGGCCGGGCTGGGGGGG - Intronic
1021716816 7:23469193-23469215 GGGACGGTGCCGGGCGGAGCAGG - Intronic
1022091993 7:27113889-27113911 GGCAGGGGGCGGGGGTGTGGGGG - Intronic
1022096028 7:27142346-27142368 CGCCCGGGGCAGGGCGGAGGGGG - Intronic
1023806743 7:43877873-43877895 AGCACAGGGCTGAGCTGAGGCGG - Exonic
1023850279 7:44146293-44146315 GGCCCGGGGCGGGGCACAGGGGG - Intronic
1023937172 7:44748548-44748570 GGGGCGGGGCCGGGCGGCGGAGG - Intergenic
1023951268 7:44847988-44848010 GGCGCGCGGCCGAGCGGAGGCGG - Exonic
1025829843 7:65038857-65038879 GGGCCGGGGCCGGGCTGGGCAGG + Intergenic
1026323072 7:69284321-69284343 GGTTCAGGGCCAGGCTGAGGTGG - Intergenic
1026360528 7:69598364-69598386 GGCGCGGGGTTGGGCTGAGGCGG + Intergenic
1026458889 7:70596167-70596189 GGGCCGGGGCGGGGCTGGGGCGG + Intronic
1027046602 7:74995149-74995171 GGCAGGGGGTCGGGGTAAGGAGG + Intronic
1027111327 7:75442301-75442323 GGAGCGGGGGCGGGCTGCGGCGG + Intronic
1027283568 7:76626860-76626882 GGAGCGGGGGCGGGCTGCGGCGG + Exonic
1027473233 7:78598345-78598367 GGTACGGGGAGGTGCTGAGGAGG + Intronic
1027745447 7:82068241-82068263 GGCAGGGGGCGGGGCTGGAGGGG - Intronic
1029453611 7:100656116-100656138 GGCCCGGGGCCAGGTGGAGGTGG + Intronic
1029609483 7:101619053-101619075 GGCCCAGGGCCGGGCCCAGGAGG - Intronic
1029696987 7:102220071-102220093 GGCACAGGGCCGGGCACAGTGGG + Intronic
1030138695 7:106284551-106284573 GGCGCGGCGGGGGGCTGAGGCGG - Intronic
1030354347 7:108526157-108526179 GGAGCGGGGCGGGGCTGAGTGGG - Exonic
1031134905 7:117873606-117873628 GGCGCGGGGCGGGACCGAGGCGG - Intronic
1032274260 7:130440808-130440830 GGGAAGGGGCCGGCGTGAGGAGG - Intronic
1033361287 7:140640582-140640604 GGCTCGGGGGCGGGCGGCGGCGG + Exonic
1033653125 7:143356723-143356745 GGCAAGGGGCCCTGCTGAGGAGG - Exonic
1033870973 7:145752601-145752623 GGGACGGGGCGGGGCGGAGTGGG + Intergenic
1034426791 7:151018262-151018284 GGCGCGACGGCGGGCTGAGGAGG - Intronic
1034475992 7:151282307-151282329 AGCAAGGGGCATGGCTGAGGCGG + Intergenic
1034496982 7:151428896-151428918 AGCAGGGGGCTGGGGTGAGGGGG + Intronic
1035113528 7:156504676-156504698 GGCACGGAGCTGGACTTAGGAGG - Intergenic
1035127142 7:156616777-156616799 GGCGCGGGGTCGGGGCGAGGAGG - Intergenic
1036643166 8:10596650-10596672 GGCACAGGGCCGGGGTGGGGAGG - Intergenic
1036786732 8:11692811-11692833 GGCGCCAGGCCGGGCAGAGGCGG + Intronic
1037620880 8:20562459-20562481 GCCACGGGGCCGGGCGGGGGGGG - Intergenic
1037779042 8:21855266-21855288 AGCATGGGGCCTGGCTTAGGAGG - Intergenic
1037947751 8:22999788-22999810 CGCGCGGAGCCGGGCTGCGGAGG - Intronic
1039067053 8:33617840-33617862 GCCACGGGGCTGTGCTGAGGTGG + Intergenic
1040423398 8:47260909-47260931 GGGACGGCGGCGCGCTGAGGAGG + Exonic
1041792865 8:61715620-61715642 GGCATGGGGCCGGGGGGAGGCGG - Intergenic
1042448687 8:68919974-68919996 GGCATGGGGCTGGGGTGAGGAGG + Intergenic
1042465815 8:69129411-69129433 GGCAGGGGGGCGGGGAGAGGCGG + Intergenic
1043463740 8:80486113-80486135 GGCTTGGGGCTGGGCTGGGGTGG - Intronic
1045305173 8:100951801-100951823 GTGGCGGCGCCGGGCTGAGGCGG - Intronic
1045379415 8:101608407-101608429 GGCACTGGGCCAGGCGGTGGAGG + Intronic
1046125674 8:109903865-109903887 AGCACGTGGGGGGGCTGAGGTGG + Intergenic
1047780313 8:128105643-128105665 GCCATGGGGCAGGGCTGTGGAGG + Intergenic
1048029446 8:130617077-130617099 GGCTCTGAGCCGGGCTGAGATGG + Intergenic
1048547639 8:135402583-135402605 GGCACTGGGCTGGGCTGAGAAGG - Intergenic
1048967368 8:139624625-139624647 GACATGGGGCTGGGCTGAGCTGG - Intronic
1049438747 8:142599632-142599654 GGCCCCGGCCCAGGCTGAGGAGG + Intergenic
1049639360 8:143707632-143707654 CGCCCGCGGCCGGGGTGAGGCGG - Intronic
1049752316 8:144291199-144291221 GGCACGTGGCCGCGCTGGGGCGG - Intronic
1049761123 8:144332412-144332434 GGCCCGGGGCAGGGCGGAAGCGG + Exonic
1049774158 8:144397011-144397033 GGTAAGGGGCGGGGCTGAGATGG + Intronic
1049774207 8:144397129-144397151 GGGAAGGGGCGGGGCTGTGGGGG + Intronic
1049966716 9:786490-786512 GGCACGGCGGGAGGCTGAGGGGG + Intergenic
1050343330 9:4662533-4662555 TGCACGGAGCCGGGCGCAGGTGG - Exonic
1051249546 9:15145633-15145655 GGCATGGGCCCAGGCTGGGGTGG - Intergenic
1051894607 9:21974746-21974768 GGCCCGGGGTCGGGTAGAGGAGG - Exonic
1052901633 9:33798747-33798769 GGAAGGTGGCGGGGCTGAGGCGG + Intronic
1052901648 9:33798799-33798821 GGAAGGTGGCGGGGCTGAGGAGG + Intronic
1053009192 9:34623809-34623831 GGCACGGGTTCGGCCTGGGGCGG - Intronic
1053430866 9:38040938-38040960 GACACGTGGCAGGGCTGGGGTGG + Intronic
1055683460 9:78743072-78743094 GGCACGGTGCCCGGCTCAGCTGG + Intergenic
1056213689 9:84388747-84388769 GGCACGGGGCCTGGCTGGCATGG + Intergenic
1057187021 9:93062676-93062698 GGCATGGGGAGGGGCTCAGGAGG + Intronic
1057752423 9:97803551-97803573 GGGACGGGGCGGGGCGGCGGGGG - Intergenic
1057869817 9:98709060-98709082 CGCACGGGGGCGGGCGGAGGCGG - Exonic
1057995853 9:99821450-99821472 GGCACGGAGCCAGGGCGAGGGGG - Intergenic
1058528723 9:105885439-105885461 GGCACGTGGCCTGGGTGAGGTGG - Intergenic
1058689504 9:107507479-107507501 GGGACAGGGCCTGGCTGCGGAGG + Intergenic
1059115981 9:111600121-111600143 GGCAAGCGGCAGGGCTGACGGGG - Intergenic
1059429339 9:114240639-114240661 GGCACGGGGCAGGGCTGTATAGG - Intronic
1059855967 9:118397488-118397510 GGCACAGAGCGGGGCTGAGGAGG + Intergenic
1060700900 9:125747913-125747935 GGGAGGGGGCCGGGCTGCGAGGG - Intronic
1060759659 9:126236457-126236479 GGCCCCGGGCCTGGCTGAGCTGG - Intergenic
1060811239 9:126612618-126612640 GGCGCGGAGCCGGGCGGGGGCGG - Intergenic
1060897104 9:127225107-127225129 GGTTCGGGGCGGGGCTGGGGCGG + Intronic
1061144099 9:128787186-128787208 GGGGCGGGGCGGGGCTGAGGCGG + Exonic
1061348219 9:130043289-130043311 GGGAGGGGGCCGGGCCGGGGTGG - Intergenic
1061514813 9:131082873-131082895 GGCAGTGGGCAGGGCTGGGGAGG - Intronic
1186496217 X:10014823-10014845 GGCCCGGGGGCGGACTGACGCGG + Intergenic
1187358565 X:18602192-18602214 GGCCCAGGGCCGGGCTCATGGGG + Intronic
1189284167 X:39839986-39840008 GACACAGGGCTGGGGTGAGGGGG + Intergenic
1189351648 X:40280095-40280117 GGATGGGGGCGGGGCTGAGGGGG - Intergenic
1189376123 X:40467365-40467387 GGCACAGGGCAGGGAGGAGGGGG + Intergenic
1192151817 X:68717469-68717491 GGCCCTGGGTGGGGCTGAGGAGG - Exonic
1192180393 X:68912391-68912413 GGCAGAGGGCCGGGCTGGGGAGG - Intergenic
1196807941 X:119605604-119605626 GGGACGGGGGCGGGATGCGGAGG - Intronic
1199649721 X:149939535-149939557 GGCGCGGGGCGGGGCTTCGGAGG + Intergenic
1200003160 X:153072388-153072410 GTCACGCGGCCGGGGTGCGGCGG - Intergenic
1200004563 X:153077621-153077643 GTCACGCGGCCGGGGTGCGGCGG + Intergenic
1200076717 X:153554824-153554846 GGCAGGGAGCAGGGCTGAGCAGG + Intronic
1200165256 X:154031119-154031141 GCCAGGGGGCAAGGCTGAGGGGG - Exonic
1201894153 Y:18975984-18976006 GGCACTTTGCGGGGCTGAGGTGG - Intergenic