ID: 900106234

View in Genome Browser
Species Human (GRCh38)
Location 1:982273-982295
Sequence CACGGGGCCGGGCTGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 392}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106223_900106234 8 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106234 1:982273-982295 CACGGGGCCGGGCTGAGGTGGGG 0: 1
1: 0
2: 0
3: 43
4: 392
900106222_900106234 11 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106234 1:982273-982295 CACGGGGCCGGGCTGAGGTGGGG 0: 1
1: 0
2: 0
3: 43
4: 392
900106220_900106234 12 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106234 1:982273-982295 CACGGGGCCGGGCTGAGGTGGGG 0: 1
1: 0
2: 0
3: 43
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106234 Original CRISPR CACGGGGCCGGGCTGAGGTG GGG Intergenic
900000282 1:11050-11072 CACGGCGCCGGGCTGGGGCGGGG + Intergenic
900019987 1:181564-181586 CACGGCGCCGGGCTGGGGGCGGG + Intergenic
900106234 1:982273-982295 CACGGGGCCGGGCTGAGGTGGGG + Intergenic
900150735 1:1178269-1178291 CACTGTGCCCGGCTTAGGTGAGG - Intronic
900372166 1:2336912-2336934 CACAGGGCTGTGCTGAAGTGTGG + Intronic
900392115 1:2438279-2438301 CACTGGGCCCGGCTGGCGTGGGG + Intronic
900619109 1:3578880-3578902 CTGGGGGCCGGGCTGAGGAGGGG - Intronic
900778298 1:4600741-4600763 CAGGGCTCCGGGCTGAGGTGGGG - Intergenic
900785654 1:4648427-4648449 CACAGGGCCAGGCTGATGTTGGG - Intergenic
901001635 1:6151796-6151818 CGCAGGGCTGGGGTGAGGTGAGG + Intronic
901023942 1:6269339-6269361 CCGAGGGCCGGGGTGAGGTGAGG - Intronic
901473408 1:9473107-9473129 CACTGGGCAGGGGTGGGGTGGGG + Intergenic
902998070 1:20243087-20243109 CACGGGGCAGGGCGGAGGACGGG - Intergenic
903164147 1:21509309-21509331 GCCGGGGCCGGGCTGGGGAGGGG + Intergenic
903222894 1:21878687-21878709 CATGGGGCAGGGCTGGGGTCAGG + Intronic
903251024 1:22053083-22053105 CGCCGGGCCGGGCTGGGGGGAGG - Intronic
903777232 1:25800584-25800606 CCTGGGGCCGGGCTGATGGGGGG + Intronic
904204074 1:28841322-28841344 CAAGGGGCCGGGCTGGGCTGGGG - Intronic
904322594 1:29707267-29707289 GGCGGGGCCGGGAGGAGGTGGGG + Intergenic
904376644 1:30086072-30086094 GGCGGGGCCGGGAGGAGGTGGGG - Intergenic
904400055 1:30250314-30250336 CACGAGGCTGGGCAGAGATGAGG - Intergenic
904494485 1:30878898-30878920 CACAGGGCAGGGGTGGGGTGTGG + Intronic
904616552 1:31753181-31753203 CACGGAGGCTGGCTGAGGTCAGG - Intronic
904847498 1:33431026-33431048 CGAGGGGGCGGGCTGAGGGGCGG - Intronic
905416719 1:37808744-37808766 CCCTGGGCTGGGCTGGGGTGGGG + Intronic
905656834 1:39691109-39691131 CATGGGCCTGGACTGAGGTGGGG + Intronic
906321933 1:44822596-44822618 CAGGGAGGCGGGCTTAGGTGGGG - Exonic
906524733 1:46487566-46487588 CTCAGGCCCGGGCTGAGTTGAGG + Intergenic
906650694 1:47510489-47510511 CAGGGGGCCGGGGTGAAGTTGGG - Intergenic
907364162 1:53945964-53945986 GAGGGGGCGGGGCTGAGGCGGGG - Intergenic
907618749 1:55953565-55953587 CATGGTGCAGGTCTGAGGTGAGG - Intergenic
908544214 1:65148222-65148244 CCCGGCGCTGGGCTGAGGGGAGG + Intronic
914050517 1:144126611-144126633 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
914128665 1:144838834-144838856 CACAGTGCAGGGCTGTGGTGGGG - Intergenic
914246013 1:145886168-145886190 CGAGGGGCGGGGCTGAGGCGGGG - Intergenic
914796830 1:150926685-150926707 CACGGGGGTGGGCTGGTGTGTGG + Intronic
915448611 1:155989422-155989444 AACAGGGCTGGGCTGAGGCGAGG - Intronic
915459694 1:156062471-156062493 GGAGGGGCCGGGCTGAGGTTGGG - Intronic
916220555 1:162440631-162440653 TACTTGGCAGGGCTGAGGTGGGG - Intergenic
918388819 1:184037291-184037313 CGCGGAGCAGGGCTGAGGAGAGG + Exonic
920002168 1:202807743-202807765 CACGGAGCCTGGCGGAGGCGCGG - Intronic
921866600 1:220093960-220093982 CACGGGGGCGGGGAAAGGTGGGG - Intergenic
923631157 1:235650105-235650127 CGCGGGCCCGGGCTGGGGCGGGG - Intronic
1063430655 10:5985283-5985305 GACGGGGCCAGGCAGAGGGGAGG + Intergenic
1063978756 10:11437427-11437449 CCCTGGGCAGGGCTGAGGAGAGG - Intergenic
1065020112 10:21496250-21496272 CACTGGGGAGGGCTGGGGTGCGG - Intronic
1066157795 10:32696967-32696989 CATGGACCAGGGCTGAGGTGGGG + Intronic
1067531925 10:47080495-47080517 CATGGGGGAGGGCTGAGGTCTGG - Intergenic
1067704430 10:48596454-48596476 CAGGGAGCCGGGGTGAGGTGAGG + Intronic
1068112359 10:52694963-52694985 CACCGGGCCGGGCCAAAGTGGGG - Intergenic
1070827360 10:79399076-79399098 CACTGGACTGGGCTGAGGGGAGG - Intronic
1071490404 10:86132302-86132324 CGCGGGGCCTGGCTGAGTTCAGG - Intronic
1073249832 10:102114654-102114676 CAGGGGGCCGGCCTGGGGGGCGG + Intronic
1075049886 10:119175681-119175703 CACAGTGCCTGGCTGAGATGGGG + Intronic
1076107982 10:127839501-127839523 CATGGGGCAGGGGTGAGGGGAGG + Intergenic
1076156726 10:128210759-128210781 AACGCGGCGGGGCGGAGGTGGGG - Intergenic
1076802431 10:132836714-132836736 CCTGGGGTGGGGCTGAGGTGTGG + Intronic
1076997867 11:307776-307798 CACGGCGCCCGGCAGAGGTGAGG + Intronic
1077000791 11:321218-321240 CGCGGCGCCCGGCAGAGGTGAGG - Intronic
1077099503 11:815858-815880 AACGGGGCAGGGGTGAGGCGGGG + Intergenic
1077173451 11:1178502-1178524 CGCGGAGCCGGTCTGTGGTGGGG + Intronic
1077178081 11:1199603-1199625 CATGGGGCCAGGCTCAGGAGTGG - Intronic
1077424417 11:2467652-2467674 CACCGGGCCTGGCCCAGGTGAGG + Intronic
1077486011 11:2838739-2838761 CCCGTGGCCGGGCTGGGGTTTGG + Intronic
1078539299 11:12200444-12200466 CACGTGCCCGGGCAGAGGAGTGG - Intronic
1081044282 11:38251687-38251709 CACTGCGCCCCGCTGAGGTGGGG - Intergenic
1082928875 11:58579128-58579150 CTCGGAGCCGGGCGGAGGGGAGG + Exonic
1083885879 11:65573298-65573320 CAGGGGGCGGGGCTGGGCTGGGG + Intronic
1083900504 11:65641107-65641129 CACGGGGGCTGGCTGGCGTGGGG - Exonic
1084125261 11:67095097-67095119 CAGGGGGCGGGGGTGGGGTGGGG + Intergenic
1084683349 11:70679776-70679798 CAGAGGGCCTGGCTGGGGTGTGG - Intronic
1085724378 11:78941583-78941605 CACGGCGCCGGGGCGGGGTGGGG + Intronic
1088794462 11:113256082-113256104 CACGGGGCAGGGGTGGGATGGGG + Intronic
1089302600 11:117507669-117507691 CACTCGGGCAGGCTGAGGTGTGG - Intronic
1089534030 11:119149737-119149759 CAAGGGGACGGGCTGGGGTCAGG + Intronic
1089626610 11:119755045-119755067 GAGGGGACCGGGCTGAGGTGAGG + Intergenic
1090236863 11:125154683-125154705 CACGGGGCGGGGGTGTGGTGGGG + Intergenic
1090727029 11:129537501-129537523 CAGGGGGCTGGGCTGAGGCTGGG + Intergenic
1090831144 11:130421714-130421736 CACTGAGCCTGGGTGAGGTGGGG + Intronic
1090922160 11:131215957-131215979 CACGGGGCCACGTTGAGATGGGG + Intergenic
1091373367 12:11178-11200 CACGGCGCCGGGCTGGGGGCGGG + Intergenic
1092526518 12:9313142-9313164 CACGGCGCCGGGCGGTGGTGTGG - Intergenic
1092540757 12:9418640-9418662 CACGGCGCCGGGCGGTGGTGTGG + Intergenic
1092769251 12:11881941-11881963 CCAGGGGATGGGCTGAGGTGGGG - Intronic
1094512292 12:31103844-31103866 CACGGCGCCAGGCAGTGGTGTGG - Exonic
1096844678 12:54399613-54399635 CAGGGGTCAGGGCTGAGGTAAGG + Intronic
1098288476 12:68933104-68933126 CGCGGGGCCGGGCGCAGCTGTGG - Intronic
1098317647 12:69209053-69209075 CACTTTGCGGGGCTGAGGTGGGG - Intergenic
1102948483 12:117011220-117011242 CCCGGGGCCGGGCCCAGGGGAGG - Intronic
1103002260 12:117394137-117394159 CGCGGGGCCAGGCTGGGGGGTGG - Intronic
1103023938 12:117558460-117558482 CTAGGGGCAGGGGTGAGGTGGGG - Intronic
1104030947 12:125065521-125065543 CAGGGGCCGGGGCTGAGGCGAGG - Exonic
1104042863 12:125141798-125141820 CAGGGGGCGGGGGTGGGGTGTGG + Intronic
1104136498 12:125944623-125944645 TGCAGGGCGGGGCTGAGGTGGGG + Intergenic
1104747456 12:131219413-131219435 CAAGGGGGCTGGCTGGGGTGGGG - Intergenic
1104821946 12:131682324-131682346 GACGGGGCGGGGAAGAGGTGGGG + Intergenic
1106303903 13:28494306-28494328 CCCGGGGCTGGGCTGAGGCCGGG - Intronic
1110558604 13:76886619-76886641 CACGGGGCGGGGCTGGTGGGTGG - Intergenic
1112504644 13:99968640-99968662 TTCGGGGCCGGGCTGGGGAGCGG + Intronic
1113552626 13:111204998-111205020 CACGGGGGCGGGGCGGGGTGGGG - Intronic
1116806803 14:49501567-49501589 CACGGGACAGGACAGAGGTGGGG + Intergenic
1116817543 14:49598271-49598293 GACGGGGCCCGGCTGGGGAGTGG - Intronic
1117500305 14:56344670-56344692 CTCAGGGCTGGGCAGAGGTGAGG - Intergenic
1119406188 14:74401221-74401243 CAGTGGGCAGGGCTGGGGTGAGG - Intergenic
1119736250 14:76984637-76984659 CAGGGGGCGGGGGTGGGGTGGGG + Intergenic
1121104714 14:91272786-91272808 CCCGGGGCAGGGCTGCAGTGAGG - Exonic
1121249930 14:92491945-92491967 CACGCCAGCGGGCTGAGGTGAGG - Intronic
1121270833 14:92637062-92637084 CACGGGCCAGGGGTGGGGTGGGG + Intronic
1121834285 14:97077896-97077918 CGGTGGGCAGGGCTGAGGTGTGG + Intergenic
1122602580 14:102929012-102929034 GGCGGGGTCGGGCCGAGGTGGGG - Intronic
1122649905 14:103220585-103220607 CCGGGGGCGGGGCTGGGGTGGGG + Intergenic
1122937307 14:104966209-104966231 GGCGGGGCCGGGATGACGTGGGG - Intronic
1122954994 14:105066375-105066397 GACAGGGCCGGGCTGAGGGAAGG + Intergenic
1123420392 15:20125921-20125943 CACGGTGCAGGGCTGTGGTGGGG + Intergenic
1123445467 15:20327603-20327625 CATGGTGCAGGGCTGTGGTGGGG - Intergenic
1123529616 15:21132457-21132479 CACGGTGCAGGGCTGTGGTGGGG + Intergenic
1123700402 15:22910493-22910515 GCTGGGGCCGGGCTGTGGTGGGG - Intronic
1124123422 15:26912060-26912082 CACGGGAGCAGTCTGAGGTGGGG - Intronic
1124404295 15:29380054-29380076 CAAGGGGCTGGGGGGAGGTGGGG + Intronic
1124632920 15:31347471-31347493 CAGGGGGCTGGGCTGGGGAGGGG + Intronic
1125506334 15:40269866-40269888 CACGTGGACAGGCTGAGGTAGGG - Intronic
1125534532 15:40435849-40435871 CAAGGGGCTGGGGTGAGGTGCGG - Intronic
1125721058 15:41845413-41845435 CACGGGACCTGGCTCAGGAGAGG - Intronic
1128999262 15:72319473-72319495 AAGGGGGCTGGGCTGAGGTGGGG + Intronic
1130105501 15:80925709-80925731 CACGGGGCCTGGCTGCGCGGCGG + Exonic
1130274528 15:82469510-82469532 CACGGGGGCACCCTGAGGTGGGG + Intergenic
1130334175 15:82944639-82944661 CACGGGGTGGGGCTGAGGGCAGG - Intronic
1130466876 15:84196884-84196906 CACGGGGGCACCCTGAGGTGGGG + Intergenic
1130497388 15:84476652-84476674 CACGGGGGCACCCTGAGGTGGGG - Intergenic
1130589170 15:85201477-85201499 CACGGGGGCACCCTGAGGTGGGG + Intergenic
1130968111 15:88711970-88711992 CACAGTGCTGGGGTGAGGTGGGG + Intergenic
1131477196 15:92750032-92750054 CACTGTGCCCGGCTGATGTGTGG + Intronic
1131661885 15:94526098-94526120 CACGGGAGAGGGCTGAGATGGGG - Intergenic
1132231120 15:100184892-100184914 CATGGGGCCGGGAGGAGGAGAGG - Intronic
1132453225 15:101979895-101979917 CACGGCGCCGGGCTGGGGCGGGG - Intergenic
1132547101 16:538385-538407 CACGGGGCCAGTGTGGGGTGCGG - Intronic
1132605608 16:792530-792552 GACGGCGCCGGGCAGAGGGGGGG + Exonic
1132606345 16:795374-795396 CACGGGGCCGGGGGCAGGCGTGG - Intronic
1132615763 16:840492-840514 CACTGGGCTGGGCTGGGCTGGGG + Intergenic
1132731915 16:1366927-1366949 CAGGGGGCTGTGCTGGGGTGGGG + Intronic
1132903004 16:2268478-2268500 CTCCGGGCCGGGCTGTGCTGAGG + Intergenic
1132987867 16:2777341-2777363 CACGGGGCGGGGCTGCGCCGGGG - Intergenic
1133219603 16:4314175-4314197 CAGGAGACCGGGGTGAGGTGAGG + Intergenic
1134018721 16:10907121-10907143 CCCGGGGCCGGGCTGTGAGGAGG - Exonic
1134096636 16:11423081-11423103 CACAGGGGCCGTCTGAGGTGTGG - Intronic
1135091912 16:19524119-19524141 GACGGGTCCGGGCTGAGAGGTGG + Intronic
1135667125 16:24345410-24345432 CACCTTGCCCGGCTGAGGTGTGG - Intronic
1136381433 16:29897876-29897898 CATGGGGCCCTGCTGAGGAGGGG - Exonic
1136630722 16:31487981-31488003 CGCGGGGCGGGGCCGAGGGGAGG + Intronic
1138398885 16:56730008-56730030 CCGGGGGCGGGGCGGAGGTGGGG - Intronic
1138492549 16:57384714-57384736 CTCAGGGCCTGGCTCAGGTGGGG + Exonic
1138506208 16:57479529-57479551 CGCGGGGCCTGGCAGAGGCGAGG + Exonic
1141464090 16:84195430-84195452 CGCAGGGCCCTGCTGAGGTGAGG + Exonic
1141499884 16:84436657-84436679 CCCGAGGCCAGGCTGAGGAGGGG - Intronic
1142120392 16:88383832-88383854 CGCGGGGCTGGGCGGGGGTGCGG - Intergenic
1142221387 16:88856718-88856740 GACGGGGCAGGGCCGGGGTGGGG - Intronic
1142376786 16:89710764-89710786 CACGGGGCCGGGTTGGAGTGGGG + Exonic
1142418381 16:89955414-89955436 CAGGAGCCCTGGCTGAGGTGGGG - Intronic
1142607961 17:1092388-1092410 CACGGGGGTGGGCTGCAGTGGGG - Intronic
1142808890 17:2386144-2386166 CAGGAGGGCAGGCTGAGGTGGGG - Exonic
1143027247 17:3948095-3948117 CACGGGGCCGGGCACAGAGGAGG + Intronic
1143147363 17:4785492-4785514 CAGGGGCCTGGGCTGAGCTGGGG - Exonic
1143220370 17:5256289-5256311 TTGGGGGCCGGGATGAGGTGAGG + Intergenic
1143499211 17:7329243-7329265 ACCGGGGCCGGGCGGGGGTGGGG - Exonic
1143668711 17:8381637-8381659 CACCGCGCCCGGCTGAGATGGGG - Intronic
1144207771 17:12991100-12991122 CACGGGCTCGGCCTGCGGTGTGG + Exonic
1145190581 17:20840708-20840730 CAGGAGGCCGGGCAGGGGTGCGG + Intronic
1145845174 17:28032409-28032431 CATGGGTCAGGGCTGAGGTTTGG + Intergenic
1145906922 17:28521416-28521438 CTCTGGGCCGGGGTGAGGTGTGG + Intronic
1146251125 17:31345333-31345355 CCCGGCGCTGGGCTGAGGGGAGG + Intronic
1146255997 17:31391820-31391842 GAGGGGTCCGGGCTGAGCTGCGG + Exonic
1146274778 17:31509724-31509746 CCCCGGGGCTGGCTGAGGTGTGG + Intronic
1146322665 17:31859022-31859044 CGCGGGGCCGGGCTGGGCGGGGG - Intronic
1147123724 17:38352004-38352026 CTGGGAGCCGGGCTGGGGTGGGG - Intergenic
1147967208 17:44199723-44199745 CGCGCGGGCGGGGTGAGGTGAGG - Intronic
1148061046 17:44836695-44836717 CACCGTGCCCGGCTGAGGTTAGG - Intergenic
1148242902 17:46012030-46012052 CAAGGGCCCGGGCAGGGGTGGGG - Intronic
1148945734 17:51260401-51260423 CACGGGGCGGGGCTGGGTAGGGG + Intergenic
1149610400 17:57954969-57954991 CCGGGGCCCGGGATGAGGTGGGG + Intronic
1151404447 17:73877670-73877692 CAATGGGCCGGGCTGGAGTGAGG - Intergenic
1151565267 17:74893942-74893964 CTCGGGGCGGGGCGGGGGTGGGG - Intergenic
1151763851 17:76122147-76122169 CTCCGTGCCGGGCTGCGGTGGGG + Intergenic
1151970389 17:77454648-77454670 CTCTGGGAGGGGCTGAGGTGGGG - Intronic
1153001351 18:458431-458453 CACGTGGGTGGGCTGAGGAGGGG + Intronic
1154161118 18:11981444-11981466 CACGGGGCGGGGCGGAGGGTGGG + Exonic
1157839666 18:50944907-50944929 CACGTGGCCTGCCTGATGTGAGG - Intronic
1158786260 18:60715536-60715558 CAAGGGGCAGGACTGAGGAGGGG - Intergenic
1158883230 18:61801025-61801047 CAGGGGGCAGGGCTGGGGTGAGG - Intergenic
1159135898 18:64336495-64336517 CAGGGGTCGGGGCTGGGGTGGGG + Intergenic
1159958916 18:74540505-74540527 CAGGGGGCCAGGCTGAGGCAGGG - Intronic
1160500093 18:79397125-79397147 GCCGGGGACGGGCTAAGGTGGGG - Intronic
1160513100 18:79463468-79463490 CACGGGAACGGGCTGTGGGGAGG - Intronic
1160768200 19:818046-818068 CCCGGGGAGGGTCTGAGGTGGGG + Intronic
1160865482 19:1254098-1254120 GACTGGGCCGGGCTGGGCTGGGG + Intronic
1160887115 19:1355166-1355188 CGCCGGGCGGGGCTGAGGCGAGG + Intronic
1160965107 19:1744039-1744061 TGTGGGGCCGGGCTGGGGTGGGG - Intergenic
1160982255 19:1821795-1821817 CAGGGGGCCGGGCCAGGGTGAGG + Intronic
1160996734 19:1885430-1885452 CAGGAGGCCGGGCAGGGGTGCGG - Exonic
1161337428 19:3721939-3721961 GAGGGGCTCGGGCTGAGGTGGGG + Intronic
1163236670 19:16034076-16034098 ATCGGGGCCTGGCAGAGGTGGGG + Intergenic
1163466440 19:17470765-17470787 CACGGTGCAGGGCTGGGTTGCGG + Intronic
1163659402 19:18567800-18567822 CAGGGAGCTGGGCTGAGGGGAGG + Intronic
1163807082 19:19405930-19405952 CGCGGGGCCGGGCGGCGGAGGGG - Intronic
1164402106 19:27909741-27909763 CAGGGGGCAGGGCAGAGCTGAGG - Intergenic
1164468254 19:28506406-28506428 CAGGGGGCTGGGGTGAGGGGTGG - Intergenic
1164595245 19:29527647-29527669 CAAGCGACCAGGCTGAGGTGTGG - Intronic
1165394688 19:35557911-35557933 AACGGGGCGGGGCTGAGGAGAGG + Intronic
1166043594 19:40217158-40217180 GGCGGGGCGGGGCAGAGGTGAGG - Intronic
1166219960 19:41357856-41357878 CCCGGGTCCAGGCTGAGGGGAGG - Intronic
1166259330 19:41626936-41626958 CACGGGGAGCGGCTGAGGGGGGG + Exonic
1166365141 19:42274362-42274384 CACGGGGGCTGGCAGAGGTGGGG - Intronic
1166746644 19:45145002-45145024 TACGGGGCCGGGCCAGGGTGCGG + Intronic
1166806738 19:45492221-45492243 CACTGGTCAGGGCTGAGGTTGGG - Intronic
1167166433 19:47802831-47802853 CGAGGGGCCCCGCTGAGGTGCGG + Exonic
1167521433 19:49958394-49958416 CCCAGGGCCCGGCTGAGCTGGGG + Exonic
1167523941 19:49972325-49972347 CCCAGGGCCCGGCTGAGCTGGGG - Intergenic
1167594090 19:50418357-50418379 CCCTTGGCCGGGCTGAGGAGTGG - Intronic
1167708159 19:51094078-51094100 CACAGGGGAGGCCTGAGGTGGGG - Intergenic
1167756122 19:51414932-51414954 CCCAGGGCCCGGCTGAGCTGGGG + Exonic
1167926056 19:52821692-52821714 AGCGGGGCCCGGGTGAGGTGTGG + Intronic
1167930240 19:52857678-52857700 AGCGGGGCCCGGGTGAGGTGTGG + Intergenic
1168350788 19:55674607-55674629 CACGGGGCTGGGCGCAGGTCGGG - Intronic
1168407871 19:56120419-56120441 CACGGGGCAGGGCGAAGGCGGGG - Intronic
1168669706 19:58231195-58231217 CATTGGGCTGGGCTGGGGTGGGG + Intronic
1202689924 1_KI270712v1_random:79249-79271 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
924997905 2:380791-380813 CCAGGGGCTGGGCTGGGGTGGGG + Intergenic
927193515 2:20532872-20532894 TACAGGGCTGGGGTGAGGTGAGG - Intergenic
927572854 2:24175158-24175180 CCCGGAGCTGGCCTGAGGTGGGG + Exonic
927679773 2:25131918-25131940 CGCGGGGCCGGGCCGGGGCGGGG + Intronic
928258052 2:29742111-29742133 CACAGGCCCTGCCTGAGGTGAGG - Intronic
929979388 2:46664498-46664520 CATGTGGCCAGGGTGAGGTGGGG - Intergenic
930022171 2:47008073-47008095 GACAGGGCCGGGAGGAGGTGGGG + Intronic
932396401 2:71451771-71451793 CACTGGGCAGGACTGAGGTGGGG - Intergenic
932515967 2:72349664-72349686 CATAGGGCTTGGCTGAGGTGGGG - Intronic
933728035 2:85437560-85437582 CAGGGGGCCAGGCGGAGCTGCGG + Intergenic
933956494 2:87376774-87376796 CACAGTGCAGGGCTGTGGTGGGG - Intergenic
934079240 2:88452855-88452877 CCCGGGCCCGGGCAGAGGGGCGG - Intergenic
934240640 2:90268800-90268822 CACAGTGCAGGGCTGTGGTGGGG - Intergenic
934272552 2:91547959-91547981 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
934765582 2:96878383-96878405 CAAGGGGCAGGGCTGTGGTGGGG - Intronic
934855110 2:97724696-97724718 CACTGGGCCGGGCGAAGGCGAGG + Intronic
936006953 2:108897577-108897599 CATGGGGCTGGGCTGAGGAGGGG + Intronic
936148600 2:109997871-109997893 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
936196078 2:110373497-110373519 CACAGTGCAGGGCTGTGGTGGGG - Intergenic
936992433 2:118380375-118380397 CACTGGGCCAAGCTGAGGTAAGG + Intergenic
937378993 2:121358478-121358500 CAGGGGGTCTGGCTGAGATGAGG + Intronic
937973534 2:127567329-127567351 CACAGGGCAGGCCTCAGGTGAGG + Intronic
938020383 2:127901487-127901509 CACAGGGCAGGACTGGGGTGGGG - Intergenic
941579264 2:167274253-167274275 CACCGCGCCCGGCTGAGGTTTGG + Intergenic
945176941 2:207052649-207052671 CAGGGGGCAGGGATGAGGGGAGG - Intergenic
945245254 2:207711709-207711731 CCCGGGGCCGGGCCGCGGGGCGG + Intronic
946195017 2:218027687-218027709 CATGGGGCTTGGCAGAGGTGAGG + Intergenic
946362928 2:219229768-219229790 CGTGGGGCGGGGCTCAGGTGCGG + Exonic
946387714 2:219395234-219395256 CACTGGGCCCGGCCGACGTGGGG + Intronic
946399175 2:219459846-219459868 CTGGGGGCCGGGCAGAGGAGGGG - Intronic
947534448 2:230931966-230931988 GACGGGACCGGGCTGGGGTGGGG - Intronic
948480377 2:238246346-238246368 CTGGCTGCCGGGCTGAGGTGGGG + Exonic
949056921 2:241932769-241932791 AAAAGGGCCGGGCTGATGTGAGG - Intergenic
1168811912 20:710100-710122 CCCGGGGCCGGGAGGGGGTGTGG - Intergenic
1169019778 20:2321009-2321031 CCAGGGGCTTGGCTGAGGTGTGG - Intronic
1169073761 20:2749572-2749594 CAGGGGACCGCGCTGAGGTGGGG - Intronic
1169874720 20:10284463-10284485 CATGGGGTAGGGCTGGGGTGGGG - Intronic
1171180829 20:23089128-23089150 CTCGGGGCTGGGTGGAGGTGGGG + Intergenic
1171517771 20:25751153-25751175 GAAGGGGCGGGGCTGAGGGGAGG + Intergenic
1171869311 20:30513132-30513154 GATGGGGCCGGGGGGAGGTGGGG + Intergenic
1172008442 20:31832777-31832799 CACTGTGCCTGGCTGAGGTGGGG + Intronic
1172037120 20:32018543-32018565 CCAGGGGCGGGGCTGAGGAGAGG + Intronic
1172421957 20:34825466-34825488 GCCGGGGCCGCGCTCAGGTGAGG - Intronic
1172844027 20:37919099-37919121 CACGGGGCCTGGCTTAGGGTAGG + Intronic
1173251585 20:41366643-41366665 CGCGGGGCCGGGCAGAGGCGCGG - Exonic
1175287846 20:57849789-57849811 CACGGGACTGGGCGGGGGTGAGG - Intergenic
1175394607 20:58650157-58650179 CTGCGGGCCGGGCTGCGGTGCGG - Intergenic
1175844742 20:62052509-62052531 CACGGGCTGGGGCTGGGGTGTGG - Intronic
1175862113 20:62156149-62156171 CACGGGGCCGGGATGGGCCGGGG - Intronic
1175972474 20:62693645-62693667 CTGGGGGCCTGGCTGAGGCGTGG - Intergenic
1176180693 20:63748023-63748045 CACGCAGCCAGGCTGAGGTGTGG - Intronic
1176284543 21:5012513-5012535 GAGGGGGCAGGGCTGAGGGGGGG - Intergenic
1176411978 21:6454084-6454106 CACGCTGACGGGCTGTGGTGGGG - Intergenic
1178493598 21:33069995-33070017 GCCGGGGCCGCGCGGAGGTGCGG - Intergenic
1178707853 21:34889624-34889646 CACGGGGGCGGGGAGAGGAGCGG - Intronic
1179429504 21:41310231-41310253 TGCGGGGCCGGGGTGGGGTGAGG - Intronic
1179687472 21:43062406-43062428 CACGCTGACGGGCTGTGGTGGGG - Intronic
1179810313 21:43865530-43865552 CGCGGGGCCGGGAGGAGGTCTGG + Intronic
1179872638 21:44250962-44250984 GAGGGGGCAGGGCTGAGGGGGGG + Intronic
1179932686 21:44580568-44580590 CACGCGGCCATGCTGGGGTGGGG + Exonic
1180551491 22:16545313-16545335 CACGGTGCAGGGCTGTGGTGGGG - Intergenic
1180615437 22:17122916-17122938 CACCGCGCCCGGCTGGGGTGGGG - Intronic
1180960596 22:19760716-19760738 CTCGGGGCCGGCCTGCGGTGTGG + Intronic
1181018087 22:20082849-20082871 AACAGGGCCTGGCTGAGGTTTGG + Intronic
1181078050 22:20394439-20394461 CCCCGCGCCCGGCTGAGGTGGGG - Intronic
1181352510 22:22268610-22268632 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
1181520830 22:23448533-23448555 AACCGGGCCGGGCTCAGGAGGGG + Intergenic
1182459409 22:30473159-30473181 AATGGGGCAGGGCTGGGGTGTGG - Intergenic
1182550194 22:31096772-31096794 CACGGGGCCGGCCAGGGGAGGGG + Exonic
1182578603 22:31290723-31290745 CGCGGGGCGAGGCTGGGGTGAGG - Intronic
1182694475 22:32187414-32187436 CACCCTGCCGGGCTGATGTGGGG + Intergenic
1182716824 22:32363693-32363715 CACCCTGCCGGGCTGATGTGGGG - Intronic
1183783544 22:40015578-40015600 CACGGGCACTGGCTGAGGAGGGG - Intronic
1183994223 22:41620948-41620970 CCCGGGCCCGGGCTGAGGGGTGG + Exonic
1185284910 22:49995830-49995852 GACCGGGCCTGGCTCAGGTGGGG - Exonic
1185398551 22:50604567-50604589 CGCGGGGCCGGGTCGAGGCGCGG - Exonic
949414235 3:3799292-3799314 CACGGGGCCGCGCCGAGGGCGGG + Intronic
950012103 3:9731342-9731364 CACGGGGCGGGGCTGGGGGCAGG - Intergenic
950429486 3:12942736-12942758 CACAGTCCCGTGCTGAGGTGGGG - Intronic
950682412 3:14594304-14594326 CCCGGGGCAGGGCTGAGGGAGGG - Intergenic
950706924 3:14788577-14788599 GGCTGGGCTGGGCTGAGGTGGGG + Intergenic
951728132 3:25782962-25782984 AGCGGGGCCGGGCGGAGGAGAGG - Intronic
952287478 3:31981956-31981978 CACACGGCTGGGCTGGGGTGAGG + Intronic
953518751 3:43621850-43621872 CAAGGGGCCGGGCTCTGCTGCGG + Intronic
953877885 3:46676766-46676788 GAGGGGGCTGGGCCGAGGTGTGG - Intronic
953901217 3:46845299-46845321 CCCTGGGCAGGGCTGGGGTGCGG + Intergenic
953930963 3:47005454-47005476 CACGGGGCCAAGGTGAGGTGGGG - Intronic
954062042 3:48076206-48076228 CACTGCGCCCGGCTGAGATGTGG - Intronic
954063545 3:48088657-48088679 CACGGGGCCCGCCCGAGGCGTGG - Intronic
954367443 3:50154203-50154225 CCCGGGGCAGGGCTGAGAAGTGG + Intergenic
954497993 3:50983174-50983196 CAGGGGGTAGGGATGAGGTGGGG + Intronic
955492730 3:59499369-59499391 CACGGCACTGGGCTGAGGCGGGG + Intergenic
961368488 3:126415750-126415772 CACGGGGCGGGGTCGGGGTGTGG + Intronic
961523698 3:127483410-127483432 CAGGGAGCAGGGCTGGGGTGGGG - Intergenic
961529085 3:127528916-127528938 GATGGGGCTGGGCTGAGGTTTGG - Intergenic
963237579 3:142970898-142970920 CAGGGGTCCGGGCTGGGGTGAGG + Intronic
966862270 3:184237087-184237109 CACAGGGCCAGGCTGGGGTCAGG - Intronic
967904061 3:194486674-194486696 GATGGGGCTGGGCTGAGGCGAGG - Intronic
968063950 3:195747963-195747985 GGCGGGGCCGGGCTGGGGCGGGG - Intronic
968118242 3:196106105-196106127 CACCGGGCCTGGCCGAGATGGGG + Intergenic
968225443 3:196969558-196969580 CACGGGCACGGGCGGAGGAGAGG - Intergenic
968873622 4:3253995-3254017 CACGGGACGGGTCTGAGGTGTGG - Intronic
969437289 4:7195313-7195335 CGAGGGGCAGGGGTGAGGTGTGG + Intronic
971713006 4:30141335-30141357 CAGGGGGCAGGGTTGAGATGGGG + Intergenic
977173389 4:93790107-93790129 CACGGGGTAGGGGTGGGGTGGGG - Intergenic
984327760 4:178275143-178275165 CAGGGGGCCAGGCGGGGGTGCGG - Intergenic
985085138 4:186305614-186305636 CATGGGGCCAGGCTGGGGCGGGG - Intergenic
985607121 5:863847-863869 CACAGGGCCAGGCTGGGGTGAGG - Intronic
985747514 5:1655532-1655554 CACTGTGCCAGGCTGAGGGGAGG + Intergenic
985758091 5:1731116-1731138 CTCGGGGCGGGGATGGGGTGGGG - Intergenic
987132425 5:14871881-14871903 CCCGGGGGCGGGCTGGGGAGGGG + Intergenic
991351102 5:65721821-65721843 CACCGGGCAGGGCCGAGGCGAGG - Intronic
992796088 5:80256120-80256142 CACGGGGCGGGGCTGGGGGCGGG - Intergenic
995521247 5:113007683-113007705 CACTGCGCCCGGCCGAGGTGTGG + Intronic
997522741 5:134533654-134533676 CGCTGGGCTGGGCTGAGCTGAGG + Intronic
997811976 5:136979386-136979408 CACGGGGCAGTGCTGGTGTGTGG - Exonic
998132657 5:139659240-139659262 CCCGGGGAAGGACTGAGGTGGGG + Intronic
998875081 5:146591062-146591084 CACGGTGACAAGCTGAGGTGGGG + Intronic
999321860 5:150620045-150620067 CACGGGCCCAGGCTGGGGTCAGG + Intronic
999379205 5:151108608-151108630 CACTGGGTGGGGCTGAGGAGGGG - Intronic
1000340741 5:160275372-160275394 CACCGTGCCCGGCTGAGGTCTGG + Intronic
1000558432 5:162755993-162756015 CTCGGGGCGGGGGTGGGGTGGGG - Intergenic
1001413672 5:171528358-171528380 CAATTGGCCGGGCTGAGGAGTGG - Intergenic
1003176077 6:3752647-3752669 GGCGGGGGCGGGGTGAGGTGAGG - Intergenic
1006396041 6:33788508-33788530 CGAGGGCCCGGCCTGAGGTGGGG - Exonic
1006725471 6:36196724-36196746 CACGGAGCCCGGCCGAGGGGAGG - Exonic
1007154042 6:39725153-39725175 GAAGGGGCTGGGCGGAGGTGAGG - Intronic
1007409533 6:41653857-41653879 CTAGGGGCAGGGCTGGGGTGGGG + Exonic
1007614529 6:43172195-43172217 CCCGGGGCCCGGTTGGGGTGGGG + Intronic
1007757191 6:44107495-44107517 CACCGTGCCTGGCTGAGATGGGG - Intergenic
1008496739 6:52141725-52141747 CATGAGGCAGGGCTGGGGTGTGG + Intergenic
1009393154 6:63166526-63166548 CATGGGGCAGGGCAGAGATGAGG - Intergenic
1011517232 6:88166909-88166931 CCCGGGGCCGGGCTGAGCTTTGG + Intergenic
1011811410 6:91136218-91136240 CCGGGGACAGGGCTGAGGTGGGG + Intergenic
1017002173 6:150004436-150004458 GACAGGGCTGGGCTGAGATGGGG + Intergenic
1018222613 6:161596047-161596069 CATGGGGTCGGGGTGAGGAGTGG + Intronic
1018836801 6:167491311-167491333 CAAGGGGCTGGGGTGATGTGAGG - Intergenic
1018871651 6:167788379-167788401 CACGGGGCCGGGGGGTGGGGTGG + Intronic
1018962411 6:168458120-168458142 CCAGAGGCCGGGCTGTGGTGAGG + Intronic
1019181337 6:170188839-170188861 CACTGGGCCGGGCTGGACTGGGG + Intergenic
1019472315 7:1227515-1227537 CACGGACCCAGGCTGAGGTGGGG - Intergenic
1019492770 7:1322840-1322862 CACGGAGCCGGGCAGAGCTGCGG - Intergenic
1020106353 7:5423938-5423960 CCGGGGGCCGGGCTGGGGGGGGG - Intronic
1020257266 7:6509147-6509169 CCCGGGGCCTGGCTGTGGGGAGG + Exonic
1020278141 7:6637032-6637054 AACGAGGCCGGGCTGGGGTTCGG + Intergenic
1024003861 7:45211177-45211199 CACGGTGCCAGGCATAGGTGGGG - Intergenic
1024534686 7:50420392-50420414 CTCGGGGCCATGCTGAGCTGAGG + Intergenic
1024991211 7:55235636-55235658 CACGGGGGCAGCCTGGGGTGTGG + Intronic
1025205818 7:56992887-56992909 CACGTGGCGGGGCTGCGGAGCGG + Intergenic
1025261173 7:57418084-57418106 CATGGAGCCGGCCTGGGGTGGGG - Intergenic
1025666122 7:63584051-63584073 CACGTGGCGGGGCTGCGGAGCGG - Intergenic
1025738488 7:64175294-64175316 CATGGAGCCGGCCTGGGGTGGGG - Intronic
1027224492 7:76235310-76235332 CGCGGGGCGGGACTGGGGTGGGG + Intronic
1027239192 7:76316272-76316294 CACCGCGCCGGGCCGAGATGGGG + Intergenic
1029066610 7:97856026-97856048 CATGGGGCTGGGGTGAGGTTAGG - Intronic
1033448278 7:141440575-141440597 GACAGGGCAGGGCTGAGATGGGG + Intronic
1034433544 7:151052452-151052474 CTGGGGCCCAGGCTGAGGTGGGG - Exonic
1034716931 7:153252088-153252110 CACGTGGCAGTGCTGAGGTGAGG + Intergenic
1035573367 8:688352-688374 CGGGGGGCGGGGCCGAGGTGGGG - Intronic
1035659074 8:1333299-1333321 CACGGGGACGGGCAGGGCTGGGG + Intergenic
1036667478 8:10756984-10757006 CCTGGGGCAGGACTGAGGTGTGG - Intronic
1037832263 8:22196613-22196635 CATGGGGAAGGGCTGAGATGTGG - Intronic
1039476297 8:37841033-37841055 CAGGGGGCATGGCTGGGGTGGGG - Intronic
1039861954 8:41466727-41466749 CTCAGGGCCAGGCTGAGGAGGGG + Intergenic
1043463738 8:80486111-80486133 CTTGGGGCTGGGCTGGGGTGGGG - Intronic
1044820412 8:96152484-96152506 CACAGGGCCAGTCTGGGGTGGGG + Intronic
1045219939 8:100188980-100189002 CACGGGGCCTGGCAGAGCAGTGG - Intronic
1048574873 8:135682527-135682549 CAGGGGGCTGGGCTGAGGCTGGG + Intergenic
1048967366 8:139624623-139624645 CATGGGGCTGGGCTGAGCTGGGG - Intronic
1049054508 8:140224916-140224938 GAGGGGTCGGGGCTGAGGTGCGG + Intronic
1049129116 8:140820887-140820909 CAGGGGCCCAGGTTGAGGTGTGG + Intronic
1049469729 8:142769933-142769955 CAAGGAGCCGGGCTGGGGTCCGG + Intronic
1049639357 8:143707630-143707652 CCCGCGGCCGGGGTGAGGCGGGG - Intronic
1049744219 8:144256384-144256406 CAGGGGGAGGGGCTGAAGTGAGG - Intronic
1049774160 8:144397013-144397035 TAAGGGGCGGGGCTGAGATGGGG + Intronic
1049883075 9:11152-11174 CACGGCGCCGGGCTGGGGGCGGG + Intergenic
1050343328 9:4662531-4662553 CACGGAGCCGGGCGCAGGTGGGG - Exonic
1051249544 9:15145631-15145653 CATGGGCCCAGGCTGGGGTGGGG - Intergenic
1057032157 9:91784108-91784130 CGGGAGGCCGGGCTGTGGTGTGG - Intronic
1057275838 9:93675580-93675602 CAGGGGGACAGGCTGGGGTGGGG + Intronic
1057757233 9:97848164-97848186 CAGGCGGCCGGACTGAGCTGCGG + Intergenic
1059450409 9:114368141-114368163 CACAGGGCCTGGCTGAGATATGG + Intronic
1060104659 9:120866145-120866167 CAAGGGGCTGGACTGGGGTGGGG - Intronic
1060726369 9:126008607-126008629 CATGGGGCCAGGCTGAGGCCAGG - Intergenic
1060759656 9:126236455-126236477 CCCCGGGCCTGGCTGAGCTGGGG - Intergenic
1060796516 9:126515790-126515812 GAGGGGTCAGGGCTGAGGTGAGG + Intergenic
1061035517 9:128111948-128111970 CACCGCGCCAGGCTGAGATGGGG - Intergenic
1061185040 9:129048180-129048202 CACAGGGCCAGGCCGAGGAGAGG - Intronic
1061255329 9:129451846-129451868 CACGGGGACGGGATGATGTGGGG + Intergenic
1061330759 9:129890707-129890729 CACAGGGCGGGTCTGAGATGAGG + Intronic
1061348217 9:130043287-130043309 GAGGGGGCCGGGCCGGGGTGGGG - Intergenic
1061680736 9:132241388-132241410 TCCGGGGCCGGGCCGAGGGGCGG + Intronic
1062043379 9:134414357-134414379 CACCGGGCCGGGCTGGCGCGTGG + Intronic
1062209471 9:135355982-135356004 CTCGGGCCCAGGCTGAGCTGGGG + Intergenic
1062615053 9:137392540-137392562 CACTGGGGAGGGCTGAGCTGGGG + Intronic
1062694256 9:137865083-137865105 CACGAGGCCTGGCAGAGGGGTGG + Intronic
1186396434 X:9213332-9213354 AACTGGGCAGGTCTGAGGTGGGG - Intergenic
1186609294 X:11123474-11123496 CTCGGGGCCGGGGGGGGGTGGGG + Intergenic
1187274657 X:17806844-17806866 CACGTGGCCGGCAAGAGGTGGGG + Intronic
1189095506 X:38134532-38134554 CACAGAGCCAGGCTGAGGAGTGG + Intronic
1189492874 X:41483344-41483366 CACGGGACTGGGCTGATTTGAGG + Intergenic
1190746065 X:53322056-53322078 CCCGGGGACTGGCTGAGATGGGG - Intergenic
1192200131 X:69061281-69061303 CACGGGGCCATGTGGAGGTGTGG + Intergenic
1192227116 X:69237009-69237031 CAGTGGTCTGGGCTGAGGTGTGG + Intergenic
1195864022 X:109410001-109410023 CAGGGGGCAGGGCTGGGGTGAGG - Intronic
1196950817 X:120874821-120874843 CTCTGGGCAGGGCTGCGGTGCGG - Intronic
1198313127 X:135438904-135438926 GAGGGGGCTGGACTGAGGTGGGG - Intergenic
1198530792 X:137548497-137548519 CACCTGGCAGGGCTGGGGTGGGG + Intergenic
1199724728 X:150568831-150568853 CGCGGGGCAGGGCTGAGGCCAGG + Intronic
1199974638 X:152886043-152886065 CTCGGGGCGGGGCTGTGGGGTGG - Intergenic
1200402726 X:156028989-156029011 CACGGCGCCGGGCTGGGGGCGGG - Intergenic