ID: 900106236

View in Genome Browser
Species Human (GRCh38)
Location 1:982283-982305
Sequence GGCTGAGGTGGGGTCAGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 5, 2: 30, 3: 47, 4: 508}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106230_900106236 -8 Left 900106230 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 3
3: 44
4: 426
Right 900106236 1:982283-982305 GGCTGAGGTGGGGTCAGACACGG 0: 1
1: 5
2: 30
3: 47
4: 508
900106222_900106236 21 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106236 1:982283-982305 GGCTGAGGTGGGGTCAGACACGG 0: 1
1: 5
2: 30
3: 47
4: 508
900106220_900106236 22 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106236 1:982283-982305 GGCTGAGGTGGGGTCAGACACGG 0: 1
1: 5
2: 30
3: 47
4: 508
900106223_900106236 18 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106236 1:982283-982305 GGCTGAGGTGGGGTCAGACACGG 0: 1
1: 5
2: 30
3: 47
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106236 Original CRISPR GGCTGAGGTGGGGTCAGACA CGG Intergenic
900013328 1:133763-133785 GGTTGAGGTGGGGTCAGGCAGGG - Intergenic
900043392 1:489750-489772 GGTTGAGGTGGGGTCAGGCAGGG - Intergenic
900064830 1:724747-724769 GGTTGAGGTGGGGTCAGGCAGGG - Intergenic
900106236 1:982283-982305 GGCTGAGGTGGGGTCAGACACGG + Intergenic
900312101 1:2038616-2038638 GTTAGAGGTGGGGTGAGACAGGG + Intergenic
900387869 1:2418864-2418886 GGCTGAGGTGGGCAGAGACCTGG - Intergenic
900472024 1:2859720-2859742 GGCTAAGGTGGAGTCGGCCAGGG - Intergenic
900542879 1:3212805-3212827 GGCAGAGCTGGGGTCAGGGAGGG - Intronic
900695930 1:4010442-4010464 GGCTGTGGTGGGGCCAGGCAGGG + Intergenic
901138627 1:7013641-7013663 GGCAGAGGTGGAGTCAGGGATGG + Intronic
901453925 1:9352680-9352702 GGGTGAAGTGGGGTGAGACAGGG - Intronic
901639692 1:10686973-10686995 GGCTGAAGGGGTGACAGACAGGG + Intronic
901647089 1:10722681-10722703 GGCTCTGCTGGGGGCAGACATGG - Intronic
901866826 1:12111894-12111916 GGCTGTGTTGGGGACAGACCTGG - Exonic
902396251 1:16133781-16133803 GGGGGAGGTGGGGGCAGCCAGGG - Intronic
902398315 1:16144214-16144236 AGCTGAGGGTGGGGCAGACAGGG + Intronic
902575213 1:17373166-17373188 GGCGTACGTGGGATCAGACAGGG - Exonic
903172478 1:21562822-21562844 GGCTCAGGTGGGGTCAGCGGAGG - Intronic
903240723 1:21981010-21981032 GGCGGAGGTGAGGTCAGTCTGGG - Intronic
903244463 1:22005634-22005656 GGCAGAGGTGAGGTCAGTCGGGG - Intronic
903571826 1:24311509-24311531 GGGTGAGGTGGGGCAGGACAGGG - Intergenic
903647976 1:24906128-24906150 CGCTGAGGTGGGGGCCGACTGGG - Intronic
903766912 1:25740963-25740985 GGATGAGGGGGTGTGAGACAGGG + Intronic
904002792 1:27348279-27348301 GGGTGAAGTGGGGCCAGGCACGG + Intronic
904049823 1:27632517-27632539 GGTGGTGGTGGAGTCAGACAGGG - Intronic
904638599 1:31904060-31904082 GGCAGATGCGGGGTCAAACAAGG + Intergenic
904871102 1:33618846-33618868 GGCCGACCTGGGGTCAGACTGGG - Intronic
905386596 1:37608678-37608700 GGCTGAAGTGGGAACAGAGAAGG + Intergenic
905477734 1:38240638-38240660 AGGTGGGGTGGGGGCAGACAGGG + Intergenic
905493262 1:38361880-38361902 GGCTGAGGAGGAGTCAGTCTGGG + Intergenic
906013627 1:42552967-42552989 GACTGGGGTGGTGTCAGAGAAGG - Intronic
906133464 1:43477017-43477039 GGGACGGGTGGGGTCAGACAGGG - Intergenic
906273360 1:44498633-44498655 GGCAGTTGAGGGGTCAGACATGG - Intronic
906534258 1:46543105-46543127 GGTAGAGCTGGGGTCAGCCAGGG - Intergenic
906729945 1:48072299-48072321 GGATGAGGTGGGGCCGGGCACGG - Intergenic
907319798 1:53595045-53595067 GGCTCAGGTGGGGGCAGACAGGG + Intronic
907329771 1:53663366-53663388 GGCTGAGGAGGGGCCACAGACGG + Intronic
907522485 1:55033317-55033339 GGCTGGTGTGGGGGCAGACCTGG - Intergenic
908769672 1:67584745-67584767 AGCTGGGGTGGGGCCAGAGAAGG - Intergenic
909058495 1:70851013-70851035 GGGTGAGGTGTGGTTAGAGATGG + Intergenic
911273461 1:95831668-95831690 GTCAGAGGTGGGGTTAGCCAGGG + Intergenic
911759662 1:101600879-101600901 GGCTAAGGTGGGGAGATACAAGG + Intergenic
913532555 1:119743082-119743104 GGCTGGGGTGGGGTCTGCCCTGG + Intronic
913989712 1:143599642-143599664 GGCTGAGGTGGTCACAGGCATGG + Intergenic
914322966 1:146583071-146583093 GGCTGAGCTGGGCTGAGGCAGGG + Intergenic
914323103 1:146584367-146584389 GGCTGAGCTGGGCTGAGGCAGGG - Intergenic
914451987 1:147800659-147800681 GGCGGAGATGAGGGCAGACAGGG - Intergenic
915144573 1:153788488-153788510 GGTTGATGAGGGGCCAGACATGG + Intergenic
915349978 1:155218170-155218192 AGCAGAGGTGAGGTCTGACAAGG + Intergenic
915623014 1:157097772-157097794 GGCTGAGGGGGCATGAGACAAGG - Intronic
915749765 1:158195681-158195703 GGCTGGGGCTGGGTCAGAGACGG - Intergenic
916392207 1:164342826-164342848 GGCTGTGGTAGGCTCAGTCAAGG - Intergenic
916948806 1:169758376-169758398 GGCTGAGGTGGGGGATCACAAGG + Intronic
917441447 1:175072500-175072522 GGGTGGGGAGGGGGCAGACAGGG - Intronic
917640685 1:176980529-176980551 GGCTGAGGTTGGGCCAGGCAGGG + Intronic
919128762 1:193428201-193428223 GGCTTAGGAAGGGTCAGACCAGG + Intergenic
919366550 1:196669051-196669073 GGCTGAGGTGGTCTCAGATGGGG + Intronic
919667870 1:200310085-200310107 GACTGAGATGGGGCCAGGCACGG + Intergenic
920051911 1:203169301-203169323 GGTGGAGGTGTGGTCAGCCAGGG + Exonic
920217121 1:204368732-204368754 GTCAGAGGTGGGGACAGTCAGGG + Intronic
921069532 1:211647770-211647792 GACTGAGGCAGGTTCAGACACGG - Intergenic
921161909 1:212478870-212478892 GGCTGAGCCTGGGTCAAACATGG + Intergenic
921276319 1:213524305-213524327 GCCTGGGCTGGGGTAAGACAGGG - Intergenic
922099735 1:222470766-222470788 GGGTGAGGTGGGGTCAGGCAGGG - Intergenic
922261770 1:223950258-223950280 GATTGAGGTGGGGTCAGGCAGGG - Intergenic
922671255 1:227510044-227510066 GTCTGAGTGGGGGTCAGGCATGG + Intergenic
922735310 1:227975484-227975506 GGGTGAGGTGGGGTCAGGCAGGG + Intergenic
924342935 1:243052433-243052455 GGTTGAGGTGGGGTCAGGCAGGG - Intergenic
1063474770 10:6318531-6318553 GGCAGAGGTGGGGCCAGCCTCGG - Intergenic
1063951187 10:11224891-11224913 GGCTGAGCTGGGGAGAGCCAAGG + Intronic
1064264621 10:13815389-13815411 GGCTGAGGTGGTGGCAGATGGGG + Intronic
1064453949 10:15469407-15469429 GGGTAGTGTGGGGTCAGACAAGG - Intergenic
1064641252 10:17417848-17417870 GGCTTAGGAGGGGTAAGACTTGG + Intronic
1065464948 10:26009632-26009654 AGCTGTGTTGAGGTCAGACAAGG - Intronic
1066599786 10:37092696-37092718 GGCTGAGGTGGTCTCAGATGGGG + Intergenic
1066733548 10:38453119-38453141 GGGTGAGGTGGGGTCAGGCAGGG + Intergenic
1067047531 10:42992893-42992915 GGCCAAGGTGGTCTCAGACAAGG + Intergenic
1067053524 10:43038581-43038603 GGCATAGCTGGGGTCACACATGG - Intergenic
1067093950 10:43286198-43286220 GGCGAGGGTGGGGTCACACAAGG - Intergenic
1069532076 10:69227048-69227070 GCCTGAGGAGGGGTCAGATAGGG + Intronic
1069888170 10:71636916-71636938 GGTTGAGGTGGAGTCAGAAACGG + Intronic
1070791143 10:79190175-79190197 GGTTGGGGTGGGGTAGGACAGGG - Intronic
1071752571 10:88497078-88497100 ATCAGAGGTAGGGTCAGACATGG + Intronic
1072421293 10:95291984-95292006 GGAGGAGTTGGGGTCAGAGAGGG - Intergenic
1073408769 10:103322291-103322313 GGCTGAGGTGGGTTGAGCCTGGG - Intronic
1073591518 10:104762149-104762171 GGAGGAGGTGGGGCCAGAGATGG - Intronic
1073637047 10:105209811-105209833 AGGTGGGGTGGGGTCAGACTCGG + Intronic
1074044026 10:109820345-109820367 GGCTGAGGTGGGAAGAGCCAAGG - Intergenic
1074369290 10:112886637-112886659 GGCTGAGGAGGGGGCAGAGGAGG - Intergenic
1076527983 10:131124362-131124384 GGCTGGGGTGGGGCCAGCCTTGG - Intronic
1076903214 10:133350074-133350096 GCCTGAGGGGGGGCCAGAGAGGG - Exonic
1076969665 11:125967-125989 GGTTGAGGTGGGGTCAGGCAGGG - Intergenic
1076984357 11:224218-224240 GGCTGACGTGATGGCAGACAGGG - Exonic
1077368778 11:2172006-2172028 GGCTGAGGATGATTCAGACAGGG - Intergenic
1077474198 11:2778659-2778681 GGCAGTGGTGGGCTCAGCCATGG - Intronic
1077556347 11:3227899-3227921 GGCTGAGCTGGGGGCCGTCAGGG - Exonic
1077722750 11:4644342-4644364 GGCTGGGCTGGGGTTAGACTGGG + Intronic
1077972296 11:7207250-7207272 GCCAGACGTGGGGTCAGGCAAGG + Intergenic
1078090448 11:8261756-8261778 GTCTGGGGTTGGGCCAGACAGGG - Intronic
1079801948 11:24879995-24880017 TGCTGAGCTGGGCTCAGAGACGG - Intronic
1080204981 11:29717851-29717873 GGCTGAGGTGGTCTCAGATGTGG - Intergenic
1080971118 11:37278554-37278576 GGCTGTGGTGGGCTCAGCCACGG - Intergenic
1081041832 11:38223214-38223236 GGTGGAGGTGGGGACAGAGATGG + Intergenic
1081990709 11:47336015-47336037 GGCAGAGGAGAGGTCAGAGAGGG + Intronic
1083224538 11:61276616-61276638 GTCTGTGGGGGGGTCTGACAGGG + Exonic
1083754550 11:64783976-64783998 GGCTGAAGTGGGATCACTCAAGG + Intergenic
1083967098 11:66049608-66049630 GGCAGAGATGGGACCAGACAAGG - Intergenic
1084037364 11:66520573-66520595 GGCTGATGTGGGGTCAGGCGTGG - Intronic
1084067479 11:66713540-66713562 GGCTGCGGAGGGGGAAGACATGG - Intronic
1084957183 11:72697648-72697670 GGCTGTGGAGGGGTTAGTCAAGG + Exonic
1085041191 11:73327278-73327300 GACTGAGCTGGGCTGAGACAGGG - Intronic
1085308228 11:75500464-75500486 TGGTGAGGTGGGGCCAGAAAGGG - Intronic
1086836923 11:91636841-91636863 GGCTGGGGAGGCTTCAGACATGG + Intergenic
1086895258 11:92304732-92304754 GGAGGAGGTGAGGTGAGACAGGG + Intergenic
1088710090 11:112499891-112499913 GGCTGACCAGGGGTCAGCCAGGG - Intergenic
1089066995 11:115669746-115669768 AGCTGAGGTGGGTTCAGGAATGG + Intergenic
1089456809 11:118630459-118630481 AGCTGAGGTGGGGACAAAGAGGG + Intronic
1089809530 11:121120451-121120473 GGGTGATGTGGGGACAGGCAGGG + Intronic
1090083451 11:123630214-123630236 GGCTGGGGTAGGGACAGGCAGGG + Exonic
1090237482 11:125160147-125160169 GGCTGTGGTGGGGGGAGCCAGGG - Intergenic
1091556831 12:1580345-1580367 GGCTTAAATGGGGTCAGAAAAGG + Intronic
1092124277 12:6064796-6064818 GGCTGGGGTGGGGGCAAAGAGGG - Intronic
1092171345 12:6375615-6375637 GGCTGAGGAGGAGTCAGAGCCGG + Intronic
1092245166 12:6860083-6860105 GGTTGAGCTGGGGACACACAGGG + Intronic
1093141933 12:15518791-15518813 GGCTGAGGTGGTCTCAGATGGGG - Intronic
1093514668 12:19972222-19972244 GGTTGAGGGGTGGTCAGAAAGGG - Intergenic
1095042195 12:37455553-37455575 GGCTGGGGTGGGGACAGAGTAGG - Intergenic
1096072501 12:48783104-48783126 GGCTGAGGTGGCGCCCGACGCGG - Exonic
1096259638 12:50082599-50082621 GGATGGGGTGGAGACAGACAGGG - Exonic
1096575126 12:52548121-52548143 GGCTGAGGTGGGGCCAGGGAGGG - Intronic
1096725013 12:53554493-53554515 GGCTGAGGTGGGGGGAGCCCAGG + Intronic
1097169065 12:57102400-57102422 GGCTGAGGTGGGGACCAACCGGG - Exonic
1097431065 12:59507695-59507717 TGCTGAGAAGGGGTCAGACTAGG + Intergenic
1098207080 12:68122291-68122313 GGCTGAGGTGGGGTGGGTAATGG + Intergenic
1098629920 12:72711742-72711764 GGCTAAGGTGGGGAGATACAAGG + Intergenic
1098836861 12:75434124-75434146 GGCTGAGGTGGTCTCAGATGGGG - Intergenic
1098890986 12:76010612-76010634 GCTGGAGGTGGGTTCAGACATGG + Intergenic
1100329974 12:93572841-93572863 GCCCGAGCTGGGGTCAGAGAAGG - Exonic
1102036015 12:109770942-109770964 GGCTGAGATGGGGTTGGCCATGG - Intergenic
1102919317 12:116779913-116779935 GACTGAGCAGGGCTCAGACAAGG + Intronic
1103940571 12:124499299-124499321 GGCTGCGGTGGGGTCAGAAAGGG + Intronic
1105376376 13:19848823-19848845 GGCTGAGGTGGGGCTGGGCATGG - Intronic
1105729724 13:23200841-23200863 CCCTGAGGTGGGGTCACACTTGG + Intronic
1106731391 13:32544914-32544936 GGCTGAGGTGGCACCAGGCACGG + Intergenic
1106986369 13:35356753-35356775 GGCTGTGGTGGAGTGAGCCATGG - Intronic
1107660935 13:42638445-42638467 GGGTGAGGTTGGGCCAGACAAGG + Intergenic
1107679369 13:42832482-42832504 GCCTGCAGTGGGGTTAGACATGG - Intergenic
1109418324 13:62074276-62074298 GGCTGAGATGGGTACAGAGAGGG - Intergenic
1111331464 13:86764725-86764747 GGCTGAGGATGGGTCAGGCTTGG + Intergenic
1111441474 13:88286769-88286791 GGCTGAGGTGGTCTCAGATAGGG - Intergenic
1111943813 13:94642386-94642408 GGCGGAGGAGGAGTCAGAAAAGG + Intergenic
1112147044 13:96711197-96711219 GGCTGAGGTGTGGCCAACCAAGG - Intronic
1113283190 13:108813063-108813085 GACTGAGGAGGGGTTGGACACGG + Intronic
1113476015 13:110581987-110582009 TGCTGGGGTGGTGTCAGAGAAGG - Intergenic
1113755289 13:112807230-112807252 GGCAGAGATGGGGACACACAGGG + Intronic
1113837480 13:113337911-113337933 GGCTGAGATGTGGACCGACAAGG - Intronic
1113963365 13:114138389-114138411 GGTGGAGGTGGGTTTAGACACGG + Intergenic
1113963392 13:114138506-114138528 GGTGGAGGTGGGTTTAGACACGG + Intergenic
1113963473 13:114138860-114138882 GGCGGAGGTGGGTGTAGACACGG + Intergenic
1113963478 13:114138881-114138903 GGCGGAGGTGGGTGTAGACACGG + Intergenic
1113963491 13:114138941-114138963 GGCGGAGGTGGGTGTAGACACGG + Intergenic
1113963504 13:114139001-114139023 GGTGGAGGTGGGTTTAGACACGG + Intergenic
1113963600 13:114139421-114139443 GGCGGAGGTGGGTGTAGACACGG + Intergenic
1113963642 13:114139622-114139644 GGCAGAGGTGGGTGTAGACACGG + Intergenic
1116863295 14:50011414-50011436 AGCTGAGATGGGGTCACGCAGGG - Intergenic
1117558597 14:56911857-56911879 GGGTTAGGTGGAGACAGACAAGG - Intergenic
1117792723 14:59358157-59358179 GAATGAGGTGGAGTCAGGCATGG - Intronic
1118228969 14:63929992-63930014 CAATGAGATGGGGTCAGACATGG + Intronic
1118332770 14:64826673-64826695 GGGTCAGGTGGGTTCAGAGAAGG - Intronic
1118748587 14:68791089-68791111 GTCTGAGGTTGGGGGAGACAGGG + Intronic
1120860995 14:89254838-89254860 GGCAAAGGTGTGGTCAGAGAAGG - Intronic
1120944169 14:89978135-89978157 AGGTGAGGTGGGGGGAGACATGG - Intronic
1121284433 14:92724317-92724339 GGCACAGTTGGGGTCAGCCATGG - Intronic
1121317056 14:92968527-92968549 GTCTGAGGTGAAGTCAGAGAAGG + Intronic
1121419625 14:93803824-93803846 GGCAGAGCTGGAGTAAGACATGG - Intergenic
1122140616 14:99660835-99660857 GGCTGGGGTGGGGTGGGGCAGGG - Intronic
1122356233 14:101124528-101124550 GGCTGTGGTGGGGACATAAAGGG - Intergenic
1122652086 14:103231623-103231645 GGCTCAGGTGGGAGCAGACAGGG + Intergenic
1122921575 14:104882507-104882529 GGAGGAGGTGGGGCCAGGCAGGG + Intronic
1202940719 14_KI270725v1_random:143278-143300 GGCTGGGGTGGGGACAGAGTAGG - Intergenic
1123988453 15:25665563-25665585 GGATTGGGTGGGGTCAGAGATGG + Intergenic
1124141630 15:27082117-27082139 GGTGGAGGTAGGTTCAGACATGG + Intronic
1125056623 15:35365978-35366000 GGCAAAGGTGGGGAGAGACAGGG + Intronic
1125373867 15:39007005-39007027 GGGTGGGGTGGGGTCAGGGAGGG + Intergenic
1125526658 15:40380584-40380606 GGCTGAGGTGGGATCACTTAAGG - Intergenic
1125688531 15:41578342-41578364 GTCTGGGCTGGGGTCAGACGGGG - Exonic
1126872028 15:52999994-53000016 GGCTGACTTGGGCTCAGTCATGG - Intergenic
1127485863 15:59417042-59417064 GGCTGGGGTAGGGGGAGACATGG + Intronic
1127641918 15:60924015-60924037 GGCAGAGGTGGGTCCAGAAAGGG + Intronic
1127818631 15:62635583-62635605 GAGTGGGGTGGGATCAGACATGG + Intronic
1128033286 15:64500452-64500474 GTCTGAGGTGGGCAAAGACAAGG - Intronic
1128226274 15:66003612-66003634 GGCAGAGGTGGGGTGAGGGAGGG - Intronic
1128450912 15:67805403-67805425 CGCTGAGGTTGGGACAGCCAGGG + Intronic
1129069608 15:72939730-72939752 GGCTGAGCTGGGTACAGACAGGG + Intergenic
1129117795 15:73374964-73374986 GGATGAAGTGGGTTCAGACAGGG + Intergenic
1129201972 15:74008263-74008285 GGGTGAGTTGGGGTCAGATGTGG + Intronic
1129530147 15:76258898-76258920 GTCTGGGCTGAGGTCAGACAGGG + Intronic
1129652787 15:77503496-77503518 GGCTCAAGTGGGGTCAGCTAGGG - Intergenic
1129718632 15:77865891-77865913 GGGTGAGGTGGGGCAAGGCAGGG - Intergenic
1129871808 15:78945726-78945748 GTCTGAGGTGGGGACAGGCAGGG - Intronic
1129871856 15:78945885-78945907 GTGTGAGGTGGGGACAGGCAGGG - Intronic
1129871896 15:78946009-78946031 GTGTGAGGTGGGGACAGGCAGGG - Intronic
1129871964 15:78946231-78946253 GTATGAGGTGGGGACAGGCAGGG - Intronic
1129871976 15:78946263-78946285 GTCTGAGGTGGAGACACACAGGG - Intronic
1129879766 15:78998913-78998935 GGCTGAGCTGGGGTGAGTGAGGG + Intronic
1130070288 15:80641266-80641288 GTCTGAGGTGGGGCCAGATGAGG + Intergenic
1130229377 15:82085118-82085140 AGGTGAGGTGGGCTCAGACGAGG + Intergenic
1130407431 15:83614321-83614343 GGCAGGGGTGGGGTCTGTCACGG + Intronic
1130460294 15:84154975-84154997 GGGTGAGGTGGGGCAAGGCAGGG + Intergenic
1130978144 15:88792879-88792901 GGCTGAGGTGGGGAAAGCCGTGG - Intergenic
1131268972 15:90935204-90935226 GTCGGAGGTGGGGTCAGAGAGGG - Intronic
1132767366 16:1541312-1541334 GGCTGAGCAGGGGTCAGACATGG - Intronic
1132781559 16:1629249-1629271 GGCCTAGGTGGGGACAGAGAAGG - Intronic
1134207517 16:12250074-12250096 GACTGTGGTGGGGACAGGCAGGG + Intronic
1134666408 16:16022141-16022163 GGCTGGGGTCAGGTCAGGCAGGG + Intronic
1135736214 16:24933774-24933796 CTCTGAGGTGGTCTCAGACAAGG - Intronic
1136509734 16:30729434-30729456 GCCTGACGTGGGGCCAGCCAAGG - Exonic
1136642300 16:31577205-31577227 GGCTGAGGTGGTCTCAGATAGGG + Intergenic
1137949985 16:52774498-52774520 GGTTGAGGTGGGGTGAGAGATGG - Intergenic
1138106902 16:54291852-54291874 GACTGAAGTGGGCTCAGCCAGGG - Intergenic
1138417237 16:56878377-56878399 GGGCGTGGTGGGGTCAGACCAGG + Intronic
1138645968 16:58425263-58425285 GGCTTAGGAGGGCTGAGACAGGG + Intergenic
1140010456 16:71126483-71126505 GGCTGAGCTGGGCTGAGGCAGGG + Intronic
1140010594 16:71127779-71127801 GGCTGAGCTGGGCTGAGGCAGGG - Intronic
1141441146 16:84030432-84030454 GGCTGACGTTGGCCCAGACATGG - Intronic
1141760049 16:86022367-86022389 GCCTCTGGTGGGGACAGACAAGG - Intergenic
1142051271 16:87959772-87959794 GGCTGAGGGGGAGTCAGAGAGGG + Intronic
1142099621 16:88264462-88264484 GGCTGGGGTGGGGGCAGAGCAGG - Intergenic
1142423330 16:89986965-89986987 GGCTGCAGTGGGGTGAGAGAAGG + Intergenic
1142451012 16:90173155-90173177 GGTTGAGGTGGGGTCAGGCAGGG + Intergenic
1142456551 17:60540-60562 GGTTGAGGTGGGGTCAGGCAGGG - Intergenic
1142504498 17:354207-354229 GGCTGAGGCTTGGCCAGACATGG + Intronic
1142847764 17:2690464-2690486 GGGTGGGGTGGGGTGAGACGTGG + Exonic
1142952460 17:3494768-3494790 GGGAGAGGAGTGGTCAGACAAGG + Intronic
1143094016 17:4467105-4467127 GGCTGGAATGGGGTCAGCCAGGG + Intronic
1143220339 17:5256116-5256138 GGCAGAGGTTGGGTCAGGGAAGG + Intergenic
1143471511 17:7178610-7178632 GGCTGAGGTGGGGGCTCACCAGG + Intronic
1143622999 17:8091654-8091676 GCTTGGGGTGGGGTCAGGCACGG - Intergenic
1143758919 17:9087223-9087245 AGGTGGGGTGGGGTCTGACAAGG + Intronic
1143780765 17:9228163-9228185 GCCTGAGGTGGGCACACACACGG + Intronic
1143886307 17:10067547-10067569 GGCTGAGGTAAGCTCAGAAATGG - Intronic
1143987885 17:10930797-10930819 GGCAGTGGTGGGACCAGACATGG + Intergenic
1145206680 17:20988156-20988178 GGGTGAGGTGGGGTCTGGCAGGG - Intergenic
1145311840 17:21705163-21705185 GGGCGAGGTGGGGTGGGACAGGG - Intergenic
1145778733 17:27547663-27547685 GGCTGAAGTGCAGTCAGACAAGG + Intronic
1146266631 17:31457484-31457506 GACTGGGGTGGGGTGAGAGAGGG - Intronic
1146530440 17:33603620-33603642 TGCTGGGGTTGGGTCAGAAAAGG + Intronic
1147339646 17:39745892-39745914 GGCTGTGGTGGGGAAGGACATGG - Exonic
1147575170 17:41594789-41594811 GGCTGGGGAGTGATCAGACAGGG + Intergenic
1147836241 17:43333977-43333999 AGCTGAGGTGGAGACAGAGAGGG + Intergenic
1148492451 17:48032135-48032157 GGGTGAGGAGGGGACAGTCAGGG - Exonic
1148640623 17:49184505-49184527 GGCTGAGGTGGTCTCAGATGGGG + Intergenic
1149543204 17:57484107-57484129 GCCTGAGGTGGGGTTAAACAAGG - Intronic
1149551661 17:57545069-57545091 GGGGGAGGTGGGGGCAGAGAAGG + Intronic
1149783549 17:59417144-59417166 GGGTGAGGTGGGGCTAGAAAGGG - Intergenic
1150283535 17:63943252-63943274 GGTTGTGGTGGAGTCAGCCAGGG + Intronic
1151097118 17:71511115-71511137 GGCTGACCTGGGTTCAGCCATGG + Intergenic
1151517353 17:74605124-74605146 GGCTGTGATGGGGTTAAACAGGG - Intergenic
1152686761 17:81697563-81697585 GGCTGAGACGGGGTCTGCCAGGG + Intronic
1153215425 18:2816194-2816216 GGGTGAGGTAGGGCCAGGCACGG + Intergenic
1153363355 18:4224576-4224598 GCCTGTGGTGGTGGCAGACACGG + Intronic
1153968747 18:10205336-10205358 GGCAGAGGTGGGGACAGAGCCGG - Intergenic
1155438049 18:25833618-25833640 GGCTGGGGTGGGGTGAGGCGGGG - Intergenic
1155679863 18:28475710-28475732 CGCTGAGGTGGTGTCAGAAATGG + Intergenic
1155806167 18:30174571-30174593 GGATGTGGTGGGGCCAGATAAGG - Intergenic
1156923939 18:42555334-42555356 GGCTAAGGTGGGGAGATACAAGG + Intergenic
1156958294 18:42993745-42993767 GGCTAAGGTGGGGAGATACAAGG - Intronic
1157214881 18:45774512-45774534 GTCTCAGGTGGGGCCAGATAGGG + Intergenic
1157234806 18:45954288-45954310 GGCTGAGGCAGGGTCAGAGTGGG + Intronic
1157862051 18:51150606-51150628 GGCTGAGGAAGGGTGAGAGATGG + Intergenic
1159987760 18:74864413-74864435 AGCTGAGGTGGTGTCAGACTTGG + Intronic
1160403479 18:78628666-78628688 GCCTGAGATGGGGTCACACCAGG - Intergenic
1160646469 19:195893-195915 GGTTGAGGTGGGGTCAGGCAGGG - Intergenic
1160681662 19:414207-414229 GGCCGAGGTGAGGTCAGAAGCGG - Intergenic
1160736564 19:665341-665363 GGCTGGGGAGGGGTCAGCGAGGG - Intergenic
1160917953 19:1506718-1506740 AGGTGAGGTGGGGACAGCCAGGG - Exonic
1161018652 19:1997255-1997277 CTCTGAGCTGGTGTCAGACAGGG + Intronic
1161100709 19:2419924-2419946 GGCTGAGGTAGGATCAGTCGAGG + Intronic
1161538775 19:4836830-4836852 GGATGAGGTGGGGCCAGATGTGG + Intergenic
1161783829 19:6311063-6311085 GGCCCAGGTGAGGTCAGGCAAGG + Intronic
1161881696 19:6958949-6958971 TGCTGGGATGAGGTCAGACATGG + Intergenic
1161978104 19:7617261-7617283 GATGGAGGTGGGGTCAGAGATGG - Intronic
1161981309 19:7631813-7631835 GGATGAAGAGGGGTCAGCCAGGG + Exonic
1162054433 19:8054199-8054221 GGGTCAGGTGGGGGCAGACAGGG - Intronic
1162321354 19:9972886-9972908 GGGGGAAGTGGGGGCAGACATGG - Intronic
1162386001 19:10361086-10361108 GGAAGAGGTGGGGTTAGGCAGGG + Intronic
1163284567 19:16338426-16338448 GGCAGAGGTAGGGGCAGCCAGGG - Intergenic
1163752232 19:19084688-19084710 GGGTAAGGTGGGTTCAGCCAGGG - Intronic
1163860963 19:19742628-19742650 GGGTGGGGTGGGGAGAGACACGG + Intergenic
1164274527 19:23704934-23704956 GGCTGAGGTGGCCTCAGATGGGG + Intergenic
1166093580 19:40525872-40525894 GGGTGAGGTGTGGTCACAGAGGG + Intronic
1166268587 19:41700192-41700214 GGCTGAGATGGGGCTAGGCAGGG + Intronic
1166315103 19:41985206-41985228 GGCTGAGGTGGGGTGGCTCAGGG + Intronic
1166365138 19:42274352-42274374 GGCAGAGGTGGGGGCAGGCCAGG - Intronic
1166535448 19:43571216-43571238 GGCTGGGGTGGAGTCAGCCAGGG - Intronic
1166748011 19:45151133-45151155 GGCAGAGATGGGGACATACAGGG - Exonic
1166795031 19:45420700-45420722 GGCTGAGCTGGAGACAGACCCGG - Intronic
1166916016 19:46196566-46196588 GGCTCAGCTGGGGTCGGGCAGGG - Intergenic
1166925023 19:46261222-46261244 GGCTCAGCTGGGGTCAGGGAGGG + Intergenic
1167259458 19:48450339-48450361 GGCTGGGGTGTGGTCAGAGAAGG + Exonic
925426123 2:3750170-3750192 GGCTGGGGAGGGGGAAGACATGG - Intronic
926201164 2:10799005-10799027 GACTGAGGTGGGGGGAGGCAGGG + Intronic
927515230 2:23668409-23668431 TGCTGGGGTGGGGGCAGTCATGG - Intronic
927712111 2:25332441-25332463 AGCTTAGGTGGGGTCTGGCAGGG - Intronic
928112976 2:28525476-28525498 GGCAGAGGAAGGGTTAGACAAGG - Intronic
929004734 2:37383841-37383863 GGCTAAGGTGGGGAGATACAAGG + Intergenic
929027631 2:37620008-37620030 GGCAGGGGTGGGGTGACACAGGG - Intergenic
930958500 2:57231756-57231778 GGCTAAGGTGGGGAGATACAAGG - Intergenic
931784444 2:65606907-65606929 TGGTGAGGTGGGGCCAGGCATGG + Intergenic
931856105 2:66303242-66303264 GGGTGGGGTGGGGGCACACAAGG - Intergenic
932081831 2:68722733-68722755 GCCTGAGCTAGGGTGAGACATGG - Intronic
933671324 2:85010234-85010256 GGCTGAGGTGGGATCAGTTTAGG + Intronic
934048648 2:88191697-88191719 GGGTGAGGTGGGGGCAGGAAGGG - Intergenic
934752723 2:96804128-96804150 GGCTGAGGTGGGGGAAGTCTAGG - Intronic
934904138 2:98184581-98184603 GGGTGGAGTGGGGTCAGAAAAGG - Intronic
934942913 2:98515422-98515444 GGCTGTGGTGGGGTAGGACGGGG + Intronic
936037310 2:109123273-109123295 GGCTGAGTTGGGATGACACAAGG - Intergenic
936095334 2:109526779-109526801 GGCTGAGGTGGTCCCAGGCAAGG - Intergenic
936599669 2:113883442-113883464 GGGCGGGGTGGGGGCAGACAGGG + Intergenic
938849925 2:135250094-135250116 GGCTGAGGTGGTCTCAGATGGGG + Intronic
938889652 2:135691511-135691533 GGCTGAGGTGGGATGAGCCCAGG + Intronic
940484013 2:154274943-154274965 GGCTGAGGTGGTCTCAGAGATGG + Intronic
940862431 2:158784556-158784578 GGCAGAAGTGGGGTCGGTCAGGG + Intergenic
941642839 2:168007727-168007749 GGCTGGGGTGGGGTGAGCAAGGG + Intronic
944137876 2:196419508-196419530 GCCTGAGATGGGTTCAGAGATGG - Intronic
947605072 2:231480927-231480949 GGCTGGGGTGGGATCCCACAGGG + Intronic
948375983 2:237520377-237520399 ATCTGAGGTGGAGTCAGGCAGGG + Intronic
1168750351 20:277496-277518 GGCTGAGGTGAGCTCACACAGGG + Intronic
1169141693 20:3230383-3230405 GGCTGGGGTGGGCTCAGGCAAGG - Intronic
1169201438 20:3712208-3712230 GGCTGAGGTAGGGTCAGAGCAGG + Intergenic
1169276332 20:4235860-4235882 GGCTCAGGCGGGGGCAGAGATGG + Intronic
1170127808 20:12985438-12985460 GGCAGAGCTGGGGTTAGAAATGG - Intergenic
1171117401 20:22536926-22536948 GGGTGAGGTGGGAGAAGACAGGG - Intergenic
1171536629 20:25898625-25898647 GGCTGGGGTGGGGACAGAGCAGG - Intergenic
1171804477 20:29662532-29662554 GGCTGGGGTGGGGACAGAGTAGG + Intergenic
1171839569 20:30193890-30193912 GGCTGGGGTGGGGACAGAGTAGG - Intergenic
1172600631 20:36180259-36180281 GGCTGAGGTGCTGTCACAGAGGG - Intronic
1172811389 20:37650584-37650606 GGCAGAGGTGGGGTCAGTGGTGG + Intergenic
1173930181 20:46811471-46811493 GGCTCTGGTGGGGGGAGACAGGG - Intergenic
1174093201 20:48066634-48066656 GAGTGAGGTGGGGTCAGAAGGGG + Intergenic
1174295083 20:49540080-49540102 GGCTGAGAAGGAGTCAGCCATGG + Intronic
1174379636 20:50148359-50148381 GACTGAGGTGGGGACAGGGAGGG + Intronic
1175248843 20:57597053-57597075 GCCTGAGGTGGGGTCAGGCGGGG - Intergenic
1175790517 20:61737487-61737509 GGCTGCAGTGGGGTCACACAAGG - Intronic
1175807414 20:61837639-61837661 GGCTGTGGTGAGGACACACAAGG + Intronic
1175932464 20:62499072-62499094 GTCTGGGGAGGGGTCAGCCAAGG - Intergenic
1176059739 20:63167425-63167447 GGCTGAGATGGGGGCTGAGATGG - Intergenic
1176059743 20:63167437-63167459 GGCTGCGGTGGGGGCTGAGATGG - Intergenic
1176059757 20:63167484-63167506 GGCTGAGGTGGGGGCTGAGGAGG - Intergenic
1176059767 20:63167508-63167530 GGCTGAGGTGGGGGCGGAGGTGG - Intergenic
1176279038 20:64290323-64290345 GGTTGAGGTGGGGTCAGGCAGGG + Intergenic
1177839189 21:26217638-26217660 GGCTGAGGTGGTCTCAGATGGGG + Intergenic
1177959915 21:27650835-27650857 GGCTGAGGTGGCCTCAATCATGG + Intergenic
1178244032 21:30935302-30935324 TGCTGCAGTGGGGCCAGACAGGG + Intergenic
1178925489 21:36771441-36771463 GCCTGAGGAGGACTCAGACAGGG + Intronic
1179231410 21:39506971-39506993 GGCAGAGGAGGGGCGAGACATGG + Intronic
1179455048 21:41493417-41493439 GGGAGAGGTGGGGACAGACAGGG + Intronic
1179647473 21:42784600-42784622 GGGTGAGGTGGGGTGAGGTAGGG - Intergenic
1179647481 21:42784621-42784643 GGGTGAGGTGGGGTGAGGTAGGG - Intergenic
1179647489 21:42784642-42784664 GGGTGAGGTGGGGTGAGGTAGGG - Intergenic
1179647529 21:42784736-42784758 GGGTGAGGTGGGGTGAGGCAGGG - Intergenic
1180037144 21:45255854-45255876 GGGTGAGGTGGCCTCAGGCACGG - Intergenic
1180163718 21:46009432-46009454 GCCTGAGCTGGGGACATACAGGG + Intergenic
1181009597 22:20032632-20032654 GGCAGGGGTGGGGACAGGCAGGG + Intronic
1181028844 22:20140483-20140505 GGCTTAGGTGGGATCAGCCCAGG - Intronic
1181182363 22:21077317-21077339 GGCAGAGGTGGGGCCACACCAGG - Intergenic
1181979174 22:26753767-26753789 GACTAAGGTGGGGGCAGGCAGGG - Intergenic
1183422357 22:37719251-37719273 GGGTGAGGAGGGGACAGAGAAGG + Intronic
1183434504 22:37785800-37785822 GGCTGAGGTGAGGCCAGGCGCGG + Intergenic
1183700658 22:39449184-39449206 GACTGAGGTGGGGGAACACAGGG - Intergenic
1183834838 22:40443761-40443783 GGCTGGGGTGGTGTCAGAAAGGG + Intronic
1184373385 22:44096960-44096982 GGGTGCCGGGGGGTCAGACATGG - Intronic
1184595634 22:45512410-45512432 GGCTGGGGTGGGGGCAAAAAGGG - Intronic
1184713344 22:46266194-46266216 GGCTGAGGTGGTCTCAGATGGGG - Intergenic
1185171730 22:49298233-49298255 GGCTGCGGCGGGGGCAGTCAAGG + Intergenic
949900641 3:8812257-8812279 GGATGAGATGGGGTCTGATATGG + Intronic
950014505 3:9746198-9746220 GTCTGAAGTGGGGACAGAGAGGG - Intronic
950612902 3:14137501-14137523 GGCTGGGCTGGGGGAAGACAGGG - Intronic
951180765 3:19655596-19655618 GGCTGAGGTGGTCTCAGATGGGG - Intergenic
952379595 3:32794542-32794564 GGCTGAGTAGGAGTCAGAGAAGG + Intergenic
952967575 3:38630773-38630795 GGGTGAGGAGGGGTCAGCTAAGG - Intronic
953061862 3:39434404-39434426 GGGTGAGGTGGGGGCAGTGAGGG - Intergenic
953972126 3:47355882-47355904 GGCTGAGGCGCCGGCAGACAGGG + Intergenic
954081415 3:48214262-48214284 GGGGAAGGAGGGGTCAGACATGG + Intergenic
954300238 3:49697332-49697354 AGGAGAGGTGGGGTCAGGCAGGG - Intronic
954447753 3:50555686-50555708 GGCTGAGGGGAGGTGAGAGAAGG + Intergenic
955277107 3:57556910-57556932 GGCTGAGTTTGGGGCACACAGGG - Exonic
955412181 3:58662840-58662862 TGCAGAGATGGGGTCAGACACGG + Intronic
956347716 3:68299090-68299112 GGCTGAGGTGGTCTCAGATGGGG + Intronic
956877673 3:73479715-73479737 GCCTGGGCTGGGGTCAGGCAGGG - Intronic
959164487 3:102759324-102759346 GGCTCAGCTGGGCTCAGATATGG + Intergenic
959521669 3:107328685-107328707 GGCTGCAGTGGGCTCAGACATGG + Intergenic
960057054 3:113283449-113283471 GGCTGTGGTGGGGCCAGAGTTGG - Exonic
960925720 3:122793724-122793746 AGCTGGGGTGGGGTCAGAGTAGG + Exonic
961180928 3:124876787-124876809 TGCTGAAGTGAGGTCAGGCAAGG - Intronic
962170882 3:133099765-133099787 GGCTGAGGTGGTCTCAGATGAGG - Intronic
963736353 3:149021573-149021595 GGCAGAGATGGGGTTTGACATGG - Intronic
964274543 3:154995663-154995685 GGCTGAGGTGGTCTCAGATGTGG - Intergenic
964895614 3:161591363-161591385 GGCTGAGGTGGTCTCAGATGGGG - Intergenic
965090074 3:164150419-164150441 GGCTGAGGTGGTCTCTGATAGGG - Intergenic
966302605 3:178496105-178496127 GGCTGAGGTAGTCTCAGATAAGG + Intronic
967217872 3:187225570-187225592 GGCTGGGGCGGGGGCTGACAGGG - Intronic
967633794 3:191777682-191777704 GGCTGAGGTGGTCTCAGATGGGG + Intergenic
968371212 3:198223633-198223655 GGTTGAGGTGGGGTCAGGCAGGG + Intergenic
968488874 4:879210-879232 GGCAGAGGTGGGTTCAGAACAGG - Intronic
968969206 4:3784697-3784719 GGGTGAGGTGGGGTGAGTCTGGG + Intergenic
969380914 4:6797295-6797317 GGCTAAAGTGGGGTCAGAGCTGG + Intronic
969621468 4:8280946-8280968 GGCAGAGGTGGGGGCACCCAGGG + Intronic
969866940 4:10082384-10082406 GCCAGAGGAGGGGTCAGACCTGG + Intronic
970268160 4:14312571-14312593 GGTTGAGGTGGGGTCTGTGAAGG + Intergenic
971152349 4:24046824-24046846 GGCAGATATGGGGACAGACACGG - Intergenic
974797022 4:66766293-66766315 GGCTGAGGTGGTCTCAGATAGGG + Intergenic
974982042 4:68968590-68968612 GGCTGAGGTGGGTTCAGATGGGG + Intergenic
976277460 4:83291789-83291811 GGCTGAGGTGGGTTGAGCCCAGG + Intergenic
977536670 4:98261766-98261788 GGCTGGGGTGGGGTCGGCCGCGG + Intronic
978754959 4:112292045-112292067 GGCTGAGGTGGGAGAAGCCAAGG - Intronic
979259897 4:118636106-118636128 GGGTGAGGTGGGGTCAGGCAGGG + Intergenic
979328487 4:119404519-119404541 GGGTGAGGTGGGGTCAGGCAGGG - Intergenic
980576337 4:134687678-134687700 GGCTAAGGTGGGGTCACAGTGGG + Intergenic
982162208 4:152581542-152581564 GTCAGAGGTGGGGTTGGACAAGG - Intergenic
983657594 4:170098801-170098823 GGCTGAGGTGGTTTCAGATGGGG - Intergenic
983660365 4:170125598-170125620 GGCTGAGGTGGTCTCAGATGAGG + Intergenic
984165245 4:176297693-176297715 GGCTAAGGTGGGGAGATACAAGG + Intergenic
985665346 5:1179246-1179268 GGCTCAGCTGGGGGCAGACCAGG + Intergenic
985695010 5:1335268-1335290 GGCTGACCTGGGGCCACACAGGG - Intronic
985717602 5:1471456-1471478 GGCACAGGTGGGGGCTGACAGGG + Intronic
985729778 5:1540696-1540718 GGCTGAGGAGGCCTCACACACGG - Intergenic
986338228 5:6770245-6770267 GCCTGAGGTGAGGCCACACAGGG + Intergenic
986433529 5:7705331-7705353 GGCCGAGATGGAGACAGACAGGG + Intronic
987280855 5:16412238-16412260 GGCTGAGGTAGGGACAGAATGGG + Intergenic
989564044 5:42883770-42883792 GTGGGAAGTGGGGTCAGACATGG + Intronic
992946610 5:81817507-81817529 TGTTGAGGTGGTGTCAGAAAAGG + Intergenic
993121342 5:83778420-83778442 GGCTTAGGTTGGGTCACAAAAGG - Intergenic
996884659 5:128341222-128341244 GGAAGAGGTGGGGTCAGAACTGG + Intronic
997262708 5:132476741-132476763 GGGTGGGGTGGGGTGGGACAGGG - Intergenic
997437044 5:133883140-133883162 GGCTGAGAAGGGGTCAGTCCAGG + Intergenic
997452795 5:133996906-133996928 GGCCGAGGTGGGAGCAGGCAGGG - Intronic
998104827 5:139461840-139461862 GGGTGAGGTGGGGGCAGAGCAGG + Intronic
998399062 5:141838545-141838567 GGCAGAGCTGGGGGCAGGCAGGG - Intergenic
999371338 5:151057058-151057080 GGCTGAGCTGGGGTCACAGGGGG - Intronic
999516010 5:152302174-152302196 GATTGAGATGGGGTCAGAAAAGG - Intergenic
999641604 5:153678565-153678587 AGCTGAGGTGGGGGTAGAAAGGG - Intronic
999672655 5:153971387-153971409 GGTTGAGGTGGTGACAGAAAGGG - Intergenic
999918193 5:156286847-156286869 TGCTGAGATAGGGTCAGTCAGGG + Intronic
1000004698 5:157172621-157172643 GGCTGAGCTGCGGTCAGCCTGGG + Intronic
1000388549 5:160699524-160699546 AACTGAGGTGGGGGCAGGCATGG + Intronic
1000860816 5:166453767-166453789 GGCTGAGCTGGGGTCAGGGTGGG + Intergenic
1000947044 5:167435792-167435814 GGCTGAGGTGGTCTCAGATGGGG + Intronic
1001312818 5:170623519-170623541 GGCTGGGGTGGTTTAAGACAGGG - Intronic
1001437573 5:171712192-171712214 GGCTGAGGGTGGGCCAGGCAGGG - Intergenic
1001586149 5:172834797-172834819 AGCTGAGGTGGGGTCCACCAAGG - Intronic
1001941610 5:175743646-175743668 GACTGTGGTTGGGTCATACAGGG + Intergenic
1002100239 5:176853998-176854020 GGCTGCAGTGGGGTCAAATAAGG + Intronic
1002301173 5:178257866-178257888 TGCTCAGGTGGGGTCAGAGGAGG + Intronic
1002331948 5:178449284-178449306 GGCAGACGTGGGGGAAGACAGGG - Intronic
1002730451 5:181329179-181329201 GGTTGAGGTGGGGTCAGGCAGGG + Intergenic
1002754082 6:144925-144947 GGTTGAGGTGGGGTCAGGCAGGG - Intergenic
1003078785 6:3004431-3004453 AGCTGAGTTGGGGGCAGGCATGG - Intronic
1003571428 6:7258763-7258785 AGGGGAGGTGGGGTCAGAGAGGG + Intergenic
1005580008 6:27224799-27224821 AGCTGAGGTGGTTTCAGAGAAGG + Intergenic
1005751467 6:28886732-28886754 GGCTCAAGTGGGGCCAGGCACGG + Intergenic
1006116243 6:31777485-31777507 GTCTGTGGTGGGGGCAGAGAGGG - Intergenic
1006674881 6:35755406-35755428 TTCTGAGGTGAGGTCAGAAAAGG - Intergenic
1007546051 6:42695585-42695607 GGATGGGGTGGGGGTAGACAGGG - Intergenic
1007816012 6:44526086-44526108 GGCTGGGCTGGGGTGGGACAGGG - Intergenic
1009817118 6:68750706-68750728 GGGTGAGGTGGGGACAGTGAGGG + Intronic
1015536331 6:134270907-134270929 GGGTGGGGTGGGGTGGGACAGGG - Intronic
1015941856 6:138460806-138460828 GGCTGAGGTGCGCTCACAGAGGG - Intronic
1016237673 6:141887694-141887716 GGCTGGGGTGGTGGCAGACATGG - Intergenic
1016758234 6:147710442-147710464 GGGTGAGATGGGGCCAGACAGGG - Intronic
1017231276 6:152076658-152076680 GGCTGAGGTGGTCTCAGATGGGG + Intronic
1017774813 6:157672657-157672679 GGCAGAGGTGGGGAGGGACAGGG - Intronic
1018105577 6:160483210-160483232 GGTGGAGGTGGGGACAGACATGG + Intergenic
1018105927 6:160486361-160486383 GTCAGAGGTGGGGACAGACATGG + Intergenic
1018106446 6:160491908-160491930 GGCGGAGGTGGGGACAGACATGG + Intergenic
1018107297 6:160501323-160501345 GGCAGAGGTGGGGACAGACATGG + Intergenic
1018118473 6:160612094-160612116 GGCAGAGGAGGGGAAAGACATGG + Intronic
1018119071 6:160617646-160617668 GGCAGAGTTTGGGACAGACATGG + Intronic
1018120275 6:160628736-160628758 GGCAGAGTTTGGGACAGACATGG + Intronic
1018120875 6:160634285-160634307 GGCAGAGGAGGGGAAAGACATGG + Intronic
1018121473 6:160639829-160639851 GGCAGAGTTTGGGACAGACATGG + Intronic
1018122075 6:160645376-160645398 GGCAGAGTTTGGGACAGACATGG + Intronic
1019215476 6:170440198-170440220 CGCACAGCTGGGGTCAGACACGG + Intergenic
1019594794 7:1853552-1853574 GGCTGGAGCGGGGTCAGGCATGG - Intronic
1020038122 7:4977999-4978021 TACAGAGGTGGGATCAGACAAGG - Intergenic
1020157411 7:5737587-5737609 TACAGAGGTGGGATCAGACAAGG + Intronic
1022562481 7:31364130-31364152 GGCTGAGGTGGGATGATAGATGG + Intergenic
1023401616 7:39795730-39795752 GGGTGAGGTGGGGTCAGGCAGGG + Intergenic
1023885164 7:44349085-44349107 GGCTGAGGTGGGCTGGGGCAGGG - Intergenic
1023889298 7:44381189-44381211 GGCTGAGATGGCCTGAGACAGGG + Exonic
1023950719 7:44842213-44842235 GGCTGAGGAGTAGTCAGACTTGG - Intronic
1023983171 7:45081276-45081298 GGCAGAGGGGGGCTCAGACCTGG + Intronic
1024075596 7:45816352-45816374 GGGTGAGGTGGGGTCAGACAGGG + Intergenic
1024648002 7:51384945-51384967 GGGTGAGGTGGGGTCAGGCAGGG - Intergenic
1025023516 7:55497886-55497908 TGCTGAGGTGGGCACAGTCAGGG + Intronic
1025051857 7:55739441-55739463 GGGTGAGGTGGGGTCAGACAGGG - Intergenic
1025128815 7:56365109-56365131 GGGTGAGGTGGGGTCAGACAGGG - Intergenic
1025177196 7:56807990-56808012 GGGTGAGGTGGGGTCAGACAGGG - Intergenic
1025288103 7:57685333-57685355 GGCTGGGGTGGGGACAGAGTAGG - Intergenic
1025694596 7:63768396-63768418 GGGTGAGGTGGGGTCAGACAGGG + Intergenic
1026877518 7:73887964-73887986 GGCTCAGATGGTGTCAGACTAGG + Intergenic
1027686448 7:81284691-81284713 TGCTGAGGTGAAGTCAGAGAAGG - Intergenic
1028413741 7:90558308-90558330 GGCTGAGGTGAGGCAAGTCAAGG + Intronic
1028815689 7:95141131-95141153 GGGTGAGGTGAAGTCAGATAAGG + Intronic
1029252968 7:99250213-99250235 GACTTGGGTGGGGTCACACAGGG + Intergenic
1029532228 7:101133001-101133023 AGCTGAGGTGAGGCCAGGCACGG + Intronic
1030287033 7:107837430-107837452 GGGAGAGGTGGGATCAGGCAAGG - Intergenic
1031296717 7:120011746-120011768 GGCTAAGGTGGGGAGATACAAGG - Intergenic
1032019937 7:128401722-128401744 GGCTGAGGTGGGGGTAGGCATGG + Intronic
1032052121 7:128656099-128656121 GGTTGAGGTGGGGTCAGGCAGGG + Intergenic
1032728371 7:134613369-134613391 AGTTGAGGTGGGAACAGACAGGG + Intergenic
1032800447 7:135313395-135313417 GGCTGCGGTGGAGTCAGGGAGGG - Intergenic
1034474890 7:151276408-151276430 GGAGGAGGTGGTGCCAGACAGGG + Intronic
1034536495 7:151728899-151728921 GACTGGGATGGGGTCAGAAAAGG + Intronic
1035127534 7:156619218-156619240 GGCTGAGCGGGGGTGAGCCAAGG + Intergenic
1035230584 7:157463611-157463633 GGGTGAGGTGGGGACAGATGGGG - Intergenic
1035230637 7:157463772-157463794 GGGTGAGGTGGGGACAGATGGGG - Intergenic
1035720061 8:1784949-1784971 GCCTGGGGTGGGGTCGGCCAGGG + Exonic
1038250896 8:25903369-25903391 TGCTGAGGACGGGTTAGACAGGG + Intronic
1038431426 8:27503295-27503317 AGCTGAGATGGGCTAAGACAGGG + Intronic
1040547425 8:48409671-48409693 GACTGAGATGGGGTCAGGGAGGG - Intergenic
1040684604 8:49856775-49856797 GGGTGAGGTGGAGCCAGGCAAGG + Intergenic
1041279341 8:56195688-56195710 GGCTGAGGTGGCCTCAGGCAAGG - Intronic
1041284131 8:56243312-56243334 GGCTTAGGTGGGGCCACAGAAGG - Intergenic
1041717459 8:60944982-60945004 GGCTGGGGTGGGATTAGACTGGG + Intergenic
1044172930 8:89079069-89079091 GGCTGAGTGGGGGGGAGACAGGG + Intergenic
1044466222 8:92509631-92509653 TGCTGAGGTGGGATTGGACAGGG - Intergenic
1044546070 8:93460825-93460847 GGCTGCTGTGTGGTCAGTCATGG - Intergenic
1048075102 8:131061546-131061568 GGGTCTGCTGGGGTCAGACAAGG - Intergenic
1048269183 8:133014734-133014756 GGCTGAGGAGGGGGCAGAAGAGG - Intronic
1048608966 8:136001227-136001249 TGGCGGGGTGGGGTCAGACATGG - Intergenic
1048729277 8:137419418-137419440 GGCTGAGGTGGTCTCAGATGGGG - Intergenic
1048936734 8:139363878-139363900 GGCTGGTGTGGAGTCAGAGAGGG - Intergenic
1049088355 8:140495045-140495067 GACTGAGATGGGGTCTGACCCGG - Intergenic
1049334954 8:142079257-142079279 GGCTGGTGTGGAGTCAGAGATGG + Intergenic
1049417051 8:142500041-142500063 TGCTGAGGGAGGCTCAGACATGG - Intronic
1049417912 8:142503948-142503970 TGCTGAGGGAGGCTCAGACATGG + Intronic
1049438478 8:142598522-142598544 GGCTGGAGTGGGGTCTGAGAGGG + Intergenic
1049488250 8:142877498-142877520 GGGTGAGGTGGTGCCAGACTTGG - Intronic
1049493139 8:142915521-142915543 GGGTGAGGTGGTGCCAGACTTGG - Intronic
1049543572 8:143219356-143219378 GGCTGATGTGGGCTCAGGAAAGG - Intergenic
1049706924 8:144047356-144047378 GGCAGAGGTGGGAGGAGACAAGG + Intergenic
1051606487 9:18922494-18922516 TGCTGGGGTTGGGGCAGACAGGG - Intergenic
1051818178 9:21134015-21134037 GGATGAGGTGGGGCCAGGTAAGG - Intergenic
1052177494 9:25481701-25481723 TGCTGATGAGGGGTCAGGCATGG - Intergenic
1056612439 9:88133709-88133731 GGCTGGGCTGGGGGCAGAGAGGG - Intergenic
1057394057 9:94663807-94663829 GGCTGAGGTGGGGTGGGACAGGG - Intergenic
1057792326 9:98132410-98132432 GGCAGAGCTGGGGTGAGAAAGGG - Intronic
1057812481 9:98268655-98268677 GGCTAAGGTGGGGAGATACAAGG + Intergenic
1057966847 9:99512571-99512593 GGCTAAAGTGAGGTCAAACAAGG - Intergenic
1058896528 9:109405280-109405302 GGAGGAGGTGGGGTCAGAGCTGG + Intronic
1059409567 9:114123673-114123695 GGCTGAGGAGAGGGCAGACGTGG - Intergenic
1059912400 9:119059794-119059816 CGTTGAGGTGGTGTCAGAGAAGG + Intergenic
1060239525 9:121890880-121890902 GTCTGAGATGGGGCCAGAGAGGG - Intronic
1061906774 9:133703108-133703130 GGCTGTGATGGGGTCAGGCCTGG + Intronic
1062225468 9:135447195-135447217 GGCTGGGGTGGGGGGAGACGGGG + Intergenic
1062306163 9:135907981-135908003 GGCTGAGGTGGGACGAGCCAGGG - Intergenic
1062718106 9:138021305-138021327 GGGTGGGGTGGGGGCAGGCAGGG - Intronic
1062741779 9:138179216-138179238 GTCTGAGGGGGGGTCAGGCTTGG + Intergenic
1062754861 9:138281689-138281711 GGTTGAGGTGGGGTCAGGCAGGG + Intergenic
1203578769 Un_KI270745v1:25858-25880 GGTTGAGGTGGGGTCAGGCAGGG + Intergenic
1203612450 Un_KI270749v1:21678-21700 GGCTGGGGTGGGGACAGAGTAGG + Intergenic
1186906257 X:14114341-14114363 GGCTGGGGTGGGGTGGGGCACGG - Intergenic
1188007048 X:25022745-25022767 GGCTGAGGTTGGGACAGCGACGG + Intergenic
1189143807 X:38635429-38635451 GGCAGAGGTGGTGTCATAAAGGG + Intronic
1189292711 X:39897250-39897272 GGCTGGGCTAGGGTCAGACCAGG - Intergenic
1190625837 X:52337691-52337713 GGCTGAGGCTGAGTCAGCCAGGG - Intergenic
1190691794 X:52918769-52918791 GGCTGAGGTCAAGTCAGCCAGGG - Intergenic
1190694189 X:52937023-52937045 GGCTGAGGTCAAGTCAGCCAGGG + Intronic
1190751955 X:53369855-53369877 TGCTGGGGTGGTGTCAGAGAAGG + Intergenic
1190936186 X:55000948-55000970 GACTGAGCTGGGGTCAAAGATGG - Intronic
1190952914 X:55163253-55163275 GGCTGAGGCTGAGTCAGCCAGGG + Intronic
1192215246 X:69153499-69153521 GCCTGCGGAGGGGTCAGACTGGG + Intergenic
1193346774 X:80412709-80412731 GGCTGAGGTGGTCTCAGATGGGG - Intronic
1193930481 X:87545827-87545849 GGCTGAGGTGGTCTCAGATGTGG + Intronic
1194427429 X:93756823-93756845 GGTGGAGGTGGGGGCAGAGATGG + Intergenic
1195532175 X:105969477-105969499 GGCTGATGTGCGGTCAGGCACGG - Intergenic
1195849104 X:109264076-109264098 GCCTGAGGTGGTGGCAGCCATGG - Intergenic
1196227112 X:113179639-113179661 GGCTAAGGTGGGGAGATACAAGG + Intergenic
1196525369 X:116723802-116723824 GGCTCAGGTGGGGAGATACAAGG + Intergenic
1197471078 X:126865962-126865984 GGCTAAGGTGGGGAGATACAAGG - Intergenic
1197499825 X:127229457-127229479 GGCTAAGGTGGGGAGATACAAGG - Intergenic
1198983648 X:142426414-142426436 GGCTAAGGTGGGGAGATACAAGG + Intergenic
1200152865 X:153959812-153959834 GGCTGCGGTGGGCACAGAAATGG + Exonic
1200161687 X:154012965-154012987 GGCTGGGGTGGGGACTTACAGGG + Intronic
1201005077 Y:9504592-9504614 TGCTGAGGTGGGGTTCGCCATGG - Intergenic
1201706208 Y:16939971-16939993 GGATGAGGTGAGGTCAGATGTGG + Intergenic
1202378958 Y:24260198-24260220 GGGTGAGGTGGGGCAAGGCAGGG - Intergenic
1202381389 Y:24278476-24278498 GGGTGAGGTGGGGTCAGGCAGGG + Intergenic
1202489396 Y:25391650-25391672 GGGTGAGGTGGGGTCAGGCAGGG - Intergenic
1202491824 Y:25409923-25409945 GGGTGAGGTGGGGCAAGGCAGGG + Intergenic