ID: 900106237

View in Genome Browser
Species Human (GRCh38)
Location 1:982284-982306
Sequence GCTGAGGTGGGGTCAGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106220_900106237 23 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106237 1:982284-982306 GCTGAGGTGGGGTCAGACACGGG 0: 1
1: 0
2: 2
3: 21
4: 258
900106222_900106237 22 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106237 1:982284-982306 GCTGAGGTGGGGTCAGACACGGG 0: 1
1: 0
2: 2
3: 21
4: 258
900106230_900106237 -7 Left 900106230 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 3
3: 44
4: 426
Right 900106237 1:982284-982306 GCTGAGGTGGGGTCAGACACGGG 0: 1
1: 0
2: 2
3: 21
4: 258
900106223_900106237 19 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106237 1:982284-982306 GCTGAGGTGGGGTCAGACACGGG 0: 1
1: 0
2: 2
3: 21
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106237 Original CRISPR GCTGAGGTGGGGTCAGACAC GGG Intergenic
900106237 1:982284-982306 GCTGAGGTGGGGTCAGACACGGG + Intergenic
900403735 1:2483515-2483537 GCTGAGCTGGGGTGTCACACTGG + Intronic
900825061 1:4919720-4919742 GCTGAGGTGGTCTCAGATACAGG - Intergenic
901068848 1:6507469-6507491 GCACAGGTGGGGTAAGACAGAGG - Intronic
902806051 1:18861999-18862021 GCTGACATGGAGGCAGACACGGG - Intronic
904404589 1:30277636-30277658 GCTGAGGAGGGGACAGGGACAGG + Intergenic
904756683 1:32771943-32771965 CCTGAGGAGGGGGCAGGCACTGG - Exonic
905881028 1:41463867-41463889 GCTGAAGTGGGGACAGTCAGAGG + Intergenic
905971585 1:42145948-42145970 GCAGAGGTGGGGGCCGACTCGGG - Intergenic
906151470 1:43590237-43590259 GCTGAGGTGGAGTAAGATCCAGG - Intronic
906290199 1:44614755-44614777 GGTGAGGTGGGGTGGGACAGTGG - Intronic
906804777 1:48770129-48770151 GCAGAGTTGGGGTCAGAGAATGG - Intronic
907813596 1:57896566-57896588 GCTGGGGTTTGGTCAGAGACTGG - Intronic
908097706 1:60757753-60757775 GCTGACCTGGGGTCAGAACCCGG - Intergenic
910080368 1:83334510-83334532 GCAGATGTGAGGTCAGAGACTGG + Intergenic
919012483 1:191983226-191983248 GATGGGGTGGGGTCAGCCTCAGG + Intergenic
919913233 1:202124725-202124747 GGTGAGGTGGGGACAGACCTTGG - Intronic
922619074 1:226979596-226979618 GCTGCAGTGTGGCCAGACACTGG - Intronic
1063474769 10:6318530-6318552 GCAGAGGTGGGGCCAGCCTCGGG - Intergenic
1065464947 10:26009631-26009653 GCTGTGTTGAGGTCAGACAAGGG - Intronic
1066058508 10:31702626-31702648 GCTGAGGTGGTCTCAGACAGAGG + Intergenic
1068836275 10:61557663-61557685 GTTGAGGTGGGGACAGAAAATGG + Intergenic
1069693703 10:70371734-70371756 GCTGAGGAGGGGTGAGAGACTGG + Intronic
1070934317 10:80281536-80281558 GCTGTGCTGGGCTCAGTCACAGG + Intronic
1071752743 10:88499549-88499571 GCAGGGGTGGGGTGAGGCACAGG + Intronic
1075738417 10:124678486-124678508 CCAGAGGTGGGGCCAGAGACTGG - Intronic
1076107466 10:127834873-127834895 GCAGCGCTGTGGTCAGACACAGG - Intergenic
1076142940 10:128093969-128093991 GCTGAGCTTGGCCCAGACACAGG - Intergenic
1076299537 10:129414634-129414656 GCTGATCTGGGGTAACACACTGG - Intergenic
1076879271 10:133231889-133231911 GAAGAGGTGGGGTCAGCCTCAGG - Intergenic
1076888355 10:133272674-133272696 GGCGAGGTGGGGCCAGGCACAGG + Intronic
1077028320 11:451538-451560 GTAGAGGTGGGGTCAGCCCCAGG + Intronic
1077050333 11:563519-563541 GCTGAGGTGGCTGCAGCCACAGG - Intronic
1079244382 11:18742292-18742314 AGTGAGGTGGGGTCAGCCTCAGG + Exonic
1079838736 11:25367511-25367533 GCTGAGGTGGTCTCAGACGGAGG - Intergenic
1080511968 11:32983724-32983746 CCTGAGGTGGTGTCACACTCAGG + Intronic
1083652512 11:64211504-64211526 TCTGGGGTGGGCACAGACACGGG - Intronic
1084436805 11:69147558-69147580 GCTGATGTCTGGTCACACACGGG + Intergenic
1085289841 11:75390100-75390122 GCTCAGGTGGAGGCAGACAGAGG - Intergenic
1085308227 11:75500463-75500485 GGTGAGGTGGGGCCAGAAAGGGG - Intronic
1085650819 11:78267060-78267082 TCTGAGGTGTGGTAAGACTCTGG + Intronic
1085729166 11:78981962-78981984 CCTGACCTGGGGACAGACACGGG - Intronic
1090461024 11:126891758-126891780 GCAGGGCTGGGGTCAGACTCCGG + Intronic
1092171346 12:6375616-6375638 GCTGAGGAGGAGTCAGAGCCGGG + Intronic
1094494185 12:30979246-30979268 GCGGTGGTGAGGCCAGACACAGG - Intronic
1095926431 12:47584082-47584104 GATGAGATGTGGTCAGACTCTGG + Intergenic
1096666458 12:53169727-53169749 GCTGAGGAGGGGAGAGGCACTGG - Intronic
1097431066 12:59507696-59507718 GCTGAGAAGGGGTCAGACTAGGG + Intergenic
1098138235 12:67425632-67425654 GCTGAGCTGGGGTTTGACCCTGG - Intergenic
1103570012 12:121838811-121838833 CCTGAGGTGGGGTCAGAGTTTGG - Intergenic
1104841839 12:131829311-131829333 GCTGAGCTGGGGACAGCTACTGG - Intronic
1105729726 13:23200842-23200864 CCTGAGGTGGGGTCACACTTGGG + Intronic
1107595141 13:41955830-41955852 GCTGAGCTTGGGTCAACCACAGG + Intronic
1110062834 13:71063933-71063955 ACTGAGGTGGTCTCAGAGACTGG - Intergenic
1113012052 13:105779484-105779506 GCTGGGGTGGGGGCTGACAAAGG - Intergenic
1113283191 13:108813064-108813086 ACTGAGGAGGGGTTGGACACGGG + Intronic
1114480245 14:23029227-23029249 GCTGAGGAGGGGCCAGAGAAAGG - Intronic
1119688533 14:76652586-76652608 GCTTATGTGAGGTCAGACAGAGG - Intergenic
1121746959 14:96304155-96304177 TCTGAGGTAGGGTCAGACTGAGG - Intronic
1121871482 14:97412072-97412094 CCGGAGGTGGGGGCAGAGACTGG - Intergenic
1121894228 14:97630636-97630658 GCTGATTTGGGGTCAGCAACTGG + Intergenic
1122631814 14:103110723-103110745 GCCGTGGTGGGGGCAGCCACAGG - Intergenic
1123125330 14:105941851-105941873 GCTGAGGTCTGGACAGACAAAGG + Intergenic
1124596051 15:31092115-31092137 GGTGGGGTGGGGTGGGACACTGG + Intronic
1125524304 15:40365463-40365485 GCTGGGTTGGGGTGAGGCACAGG + Intronic
1129117796 15:73374965-73374987 GATGAAGTGGGTTCAGACAGGGG + Intergenic
1129151221 15:73689034-73689056 GCAGATTTCGGGTCAGACACTGG - Intronic
1130229378 15:82085119-82085141 GGTGAGGTGGGCTCAGACGAGGG + Intergenic
1131268971 15:90935203-90935225 TCGGAGGTGGGGTCAGAGAGGGG - Intronic
1132210615 15:100019571-100019593 GCGCAGGTGTGGTCATACACCGG - Intronic
1132578403 16:674407-674429 CCTGAGAAGGGGTCAGTCACCGG - Intronic
1132696960 16:1206317-1206339 GCTGCCCTGGGGTGAGACACTGG - Intronic
1132767365 16:1541311-1541333 GCTGAGCAGGGGTCAGACATGGG - Intronic
1133089175 16:3390183-3390205 CCTGGGGTGGGGGCAGAGACAGG + Exonic
1137508927 16:49081218-49081240 GCTAAGATGTGGTGAGACACTGG - Intergenic
1137552141 16:49444954-49444976 GCAGAGGTAGGGGCAGAGACTGG - Intergenic
1138031334 16:53561862-53561884 GCTGAGGTGGGGAGAGAAGCAGG - Intergenic
1138534719 16:57653755-57653777 GCTGGGGTAGGGTCAGACAGAGG - Intronic
1140716159 16:77727499-77727521 GCAGAGGTGGGAACAGACACTGG - Intronic
1141426835 16:83949674-83949696 CCTGAGGTGGGGCTAGACACTGG + Intronic
1142146174 16:88493738-88493760 GCTGGGGTGGGGGCAGTAACAGG - Intronic
1142350664 16:89577827-89577849 GCTGAGGAGGGGGCAGAGCCAGG - Intronic
1142418834 16:89957986-89958008 CCTGAGGCTGGATCAGACACAGG - Intronic
1142851076 17:2705034-2705056 GAGGGGGTGGGGTCAGAAACAGG - Intronic
1143282638 17:5766272-5766294 GCTGAGATGTGGTCAGACTTTGG - Intergenic
1143404916 17:6671062-6671084 GCAGAGGTGTGGGGAGACACAGG - Intergenic
1143457623 17:7078136-7078158 GATGAGGAGGGTCCAGACACCGG + Intronic
1143519922 17:7439302-7439324 GGTGAAGTGAGGACAGACACTGG + Exonic
1143622998 17:8091653-8091675 CTTGGGGTGGGGTCAGGCACGGG - Intergenic
1145117533 17:20225302-20225324 GCTGTGCTGGGCTCAGACAGTGG - Intronic
1145778734 17:27547664-27547686 GCTGAAGTGCAGTCAGACAAGGG + Intronic
1147799484 17:43073157-43073179 TTTGGGGTGGGGTTAGACACGGG - Intronic
1147836242 17:43333978-43334000 GCTGAGGTGGAGACAGAGAGGGG + Intergenic
1147990229 17:44328096-44328118 GCAGAGGTGGGGCCAGAATCTGG - Intergenic
1148178541 17:45586972-45586994 GCTGGGTTGGGGCCTGACACAGG - Intergenic
1148512050 17:48179328-48179350 GCTCAGTGGGGGTCAGACAGTGG - Intronic
1149543202 17:57484106-57484128 CCTGAGGTGGGGTTAAACAAGGG - Intronic
1152111759 17:78360638-78360660 GCGGGGCTGGGGTCAGACCCGGG + Intergenic
1152900233 17:82936961-82936983 GCTGTGTTGGGGACAGACCCTGG + Intronic
1153537444 18:6117219-6117241 GGTGGGGTGAGGTCAGAGACTGG + Intronic
1156648874 18:39200564-39200586 GGAGGGGTGGGGTCAGAGACTGG + Intergenic
1158457493 18:57621395-57621417 GCTGGGACGGGTTCAGACACAGG - Intronic
1159009533 18:63045534-63045556 GCTGGGGTGGGGTGAGGCTCTGG - Intergenic
1159814010 18:73051605-73051627 GCAGAGGTGGGTTGAGACTCAGG + Intergenic
1160681661 19:414206-414228 GCCGAGGTGAGGTCAGAAGCGGG - Intergenic
1160827941 19:1089427-1089449 ACTGAGGTGGGGTCAGAGGCAGG - Intronic
1161630422 19:5352167-5352189 GCTGGGCTGGGGTCTGGCACAGG + Intergenic
1162204222 19:9043731-9043753 TCTGAGGTGGGGTGAGTCATAGG - Intergenic
1162526298 19:11208838-11208860 GGAGAGGTGGCGTCAGACCCTGG + Intronic
1165731936 19:38151556-38151578 TCTGAGGTTGGTTCAGAGACAGG - Intronic
1166331401 19:42079957-42079979 GCTGAGGTCTCCTCAGACACAGG - Exonic
1166535447 19:43571215-43571237 GCTGGGGTGGAGTCAGCCAGGGG - Intronic
1166795030 19:45420699-45420721 GCTGAGCTGGAGACAGACCCGGG - Intronic
1166869970 19:45865037-45865059 TCTAAGGTAGGGTCAGACATAGG + Intronic
1167259459 19:48450340-48450362 GCTGGGGTGTGGTCAGAGAAGGG + Exonic
1167360086 19:49025480-49025502 GCTGAGGAGTGTGCAGACACAGG + Intronic
1167360997 19:49030300-49030322 GCTGAGGAGTGTGCAGACACAGG - Intronic
1167362653 19:49038497-49038519 GCTGAGGAGTGTGCAGACACAGG + Intergenic
1167363480 19:49042691-49042713 GCTGAGGAGTGTGCAGACACAGG - Intergenic
1167365015 19:49050235-49050257 GCTGAGGAGTGTGCAGACACAGG + Intergenic
1167703864 19:51066619-51066641 ACTGAGGTGGGGTCAGAATTTGG + Intergenic
1167738902 19:51312247-51312269 GTTGAGGAGGGGGCAGACACTGG + Intronic
1168125586 19:54280701-54280723 GCTGAGGTGGGGGCAGGCACTGG + Intronic
1168497576 19:56866650-56866672 GCTGAGGAATGGTCAGACACTGG - Intergenic
925631118 2:5894543-5894565 GCTGAGATGGGGCCAGACCTTGG + Intergenic
927163413 2:20292222-20292244 ACTGACGTGGGGCCAGCCACAGG - Intronic
927292644 2:21419945-21419967 GCTGGGGTGGGGTCAGAACAAGG + Intergenic
930025457 2:47026588-47026610 GCTGACATGGAGTCAGTCACAGG + Intronic
931377400 2:61719497-61719519 GCTGGGCTGTGCTCAGACACTGG + Intergenic
932522177 2:72426645-72426667 GGAGAGGTGGGGTCTGACAGAGG - Intronic
933791079 2:85884074-85884096 GCAGAGCTGGGTTCAGACTCAGG - Intronic
937905578 2:127051257-127051279 GCCGGCTTGGGGTCAGACACAGG + Intronic
938366484 2:130738473-130738495 GCTGGAGGGGGGTGAGACACTGG + Intergenic
938622581 2:133071878-133071900 GCAGAGGTGGGATCTGAAACAGG - Intronic
940484014 2:154274944-154274966 GCTGAGGTGGTCTCAGAGATGGG + Intronic
942055592 2:172179500-172179522 GCTGAGGGTGGGGCAGTCACAGG - Intergenic
945175429 2:207038884-207038906 GCAGAGTTGGGATCAAACACAGG - Intergenic
947435248 2:230067794-230067816 GCTGAAATGGGGTGAGAGACCGG - Intronic
948551584 2:238776204-238776226 GGTGCGGTGGGGACAGACAGCGG + Intergenic
948597741 2:239091347-239091369 GCTGCTGTGGGGTAACACACCGG + Intronic
948650952 2:239443430-239443452 TGAGAGCTGGGGTCAGACACAGG - Intergenic
948883469 2:240871737-240871759 GGTGAGGTGGGGACAGGCCCTGG - Intronic
948906869 2:240983823-240983845 GCAAAGCTGGGCTCAGACACTGG - Intronic
1168892697 20:1305278-1305300 GCTGAGGATGGGGCAGACAGTGG + Exonic
1169201439 20:3712209-3712231 GCTGAGGTAGGGTCAGAGCAGGG + Intergenic
1170544086 20:17418563-17418585 TCTGTGGTTGGGTCAGAAACTGG + Intronic
1171202300 20:23251786-23251808 GCAGAGGTGGGGACTGATACTGG + Intergenic
1171409144 20:24934521-24934543 GCTGAGCTGGGGCCAAACTCAGG + Intergenic
1173001683 20:39109827-39109849 GCTGGGGTGGGAACAGACCCTGG - Intergenic
1173725978 20:45298122-45298144 GCTGGGGTTGGGTCAGACGCTGG - Intronic
1175790516 20:61737486-61737508 GCTGCAGTGGGGTCACACAAGGG - Intronic
1175965000 20:62655975-62655997 GCAGAGGCCGAGTCAGACACTGG - Intronic
1176123281 20:63463802-63463824 GATGAGGCGGGGGCAGACAGAGG + Intronic
1178478399 21:32957455-32957477 GGGGAGGTGGGATCAGGCACCGG + Intergenic
1179647528 21:42784735-42784757 GGTGAGGTGGGGTGAGGCAGGGG - Intergenic
1181032806 22:20156440-20156462 GCTGGGGAGGGGGCAGACAAAGG - Intergenic
1181042273 22:20197794-20197816 GCTGGGCAGGGGGCAGACACGGG - Intergenic
1182273663 22:29171521-29171543 GCTGTGGAGGGGTCAGAATCAGG - Intergenic
1182289276 22:29266083-29266105 CCTGGGGTGGGGCCAGACAATGG + Intronic
1182362329 22:29754086-29754108 GCCGAGGAGGGGTCAGGGACAGG + Intronic
1183658894 22:39206989-39207011 GCTGAGTTGGGGGCAGCAACAGG - Intergenic
1183744669 22:39685709-39685731 GCTGGGGTGGGGGCCGACACAGG + Intronic
1183826466 22:40391862-40391884 GCTGGGTTTGGGTGAGACACTGG - Intronic
1184656001 22:45942320-45942342 GCTGGGGTGTGGACAGCCACAGG - Intronic
949929257 3:9065493-9065515 GCTGGGGTGGGGTCAGGGATTGG - Intronic
950039341 3:9909910-9909932 CCTGAGCTGGGGTCAGAAAAAGG + Intronic
950391979 3:12703892-12703914 GCTGAATTGGGGTGAGACTCTGG + Intergenic
950574904 3:13826399-13826421 GCTGAGCTGGAGTCAGATAACGG + Intronic
950710055 3:14807541-14807563 GCAGTGGTGGAGTCAGACCCAGG - Intergenic
950956157 3:17055473-17055495 GTTGAGGTGTGGTGAGACAGCGG - Intronic
953759901 3:45678450-45678472 GCTGAGGGAGGGCCACACACTGG + Exonic
954324888 3:49858147-49858169 GCTGTGGTAGGGTCTGACAAAGG + Exonic
955412182 3:58662841-58662863 GCAGAGATGGGGTCAGACACGGG + Intronic
958559011 3:95719321-95719343 GCTGAGTTTTGGTCAGAGACAGG - Intergenic
959521670 3:107328686-107328708 GCTGCAGTGGGCTCAGACATGGG + Intergenic
960925721 3:122793725-122793747 GCTGGGGTGGGGTCAGAGTAGGG + Exonic
961544291 3:127621439-127621461 GCAGAGGTGGAGACAGATACAGG + Intronic
962928276 3:140014736-140014758 GCAGGGATGGGGTCAGAGACAGG + Intronic
964475736 3:157096165-157096187 ACTGTGGTGGGGCCAGGCACGGG - Intergenic
969113728 4:4859201-4859223 GAAGAGGGGGGGTCAGACAGTGG + Intergenic
969317958 4:6393578-6393600 GCAGAGCTGGGTGCAGACACGGG - Intronic
969412409 4:7037687-7037709 GCTGAGATGGGGCCGCACACAGG + Intergenic
969577692 4:8046220-8046242 GCTGAGGTGGGGGGAGAGGCAGG - Intronic
969685845 4:8673679-8673701 GCAGAGCTGGGGTGAGACCCAGG - Intergenic
969838827 4:9865695-9865717 CATGAGCTTGGGTCAGACACAGG - Intronic
977536671 4:98261767-98261789 GCTGGGGTGGGGTCGGCCGCGGG + Intronic
979895955 4:126157227-126157249 GCTGAGGTGGTCTCAGATAAAGG - Intergenic
983789991 4:171784120-171784142 GCTGAGGTGGTGTCAGATAGAGG - Intergenic
983986573 4:174066962-174066984 GATGGGATGAGGTCAGACACTGG + Intergenic
984934780 4:184880621-184880643 GCTGAGGTGAAGACACACACAGG - Intergenic
985492898 5:189615-189637 GCACAGGTTGGGTCAGACTCAGG - Exonic
985651851 5:1111327-1111349 GCTGGGGAGGGGGCAGCCACCGG - Intronic
987117390 5:14736549-14736571 GCAGAGGTGGGGTTACAGACAGG - Intronic
989185596 5:38622214-38622236 GCTGAGTTGAGGCCAGACTCTGG + Intergenic
990338290 5:54796388-54796410 GCAGAGGTGGGGTAACACACAGG + Intergenic
992407291 5:76471988-76472010 GCAGAGGTGAGGTCAGAGCCAGG - Intronic
992618603 5:78570453-78570475 ACAGAGGTGGGTCCAGACACTGG - Intronic
993903211 5:93597897-93597919 GCTCAGGTGGGCTCAGATAGAGG - Intergenic
993904327 5:93605837-93605859 GGTGAGGTGGGGTGGGACAGAGG - Intergenic
995847499 5:116509747-116509769 GCTGAGGTGGGGTGAGGTGCTGG + Intronic
997415621 5:133726175-133726197 GGTGAGGTGGGCTCAGGCACAGG - Intergenic
998039552 5:138943813-138943835 TCTGAGGAGGGGCCAGGCACAGG - Intergenic
998202199 5:140133966-140133988 GATGAGGTGTGGCCAGACACAGG - Intergenic
998266501 5:140671228-140671250 GCTGGGATGGGGCCTGACACAGG + Exonic
999691198 5:154147328-154147350 TCTCAGGTGGGTCCAGACACTGG - Intronic
1002256913 5:177964673-177964695 GCTGGGGTGGGGCCATGCACGGG + Intergenic
1002899740 6:1400665-1400687 GCTTAGCTGGGTTGAGACACAGG + Intergenic
1003078784 6:3004430-3004452 GCTGAGTTGGGGGCAGGCATGGG - Intronic
1003352038 6:5326933-5326955 GCTGAGGTGGGCTACAACACTGG - Intronic
1004252548 6:14034058-14034080 GCTGAGATGGGGTCAGAGAGAGG + Intergenic
1005449366 6:25958048-25958070 GCTGAGGTGGGGGGAGTCACTGG - Intergenic
1005582362 6:27247377-27247399 GCTGAGGTGGGGAGAGACAGAGG + Intergenic
1006190166 6:32202509-32202531 GCTTAGGGGAGGGCAGACACAGG + Exonic
1007229447 6:40338192-40338214 GCTGAGAAGGGGAAAGACACCGG + Intergenic
1009888057 6:69648608-69648630 GATGAGATGGGGTCAGATTCTGG - Intergenic
1010717015 6:79241650-79241672 GGTGAGGTGTGGTCTGAAACTGG + Intergenic
1011815054 6:91179689-91179711 CCTGAGGTGGGCTCTTACACAGG + Intergenic
1012201188 6:96407947-96407969 GCTGATGTGGGGCCAGAATCTGG + Intergenic
1014573328 6:123038976-123038998 TCTGAGGAGGGGCCATACACTGG - Intronic
1016237672 6:141887693-141887715 GCTGGGGTGGTGGCAGACATGGG - Intergenic
1016407990 6:143751224-143751246 GGTGGGATGGGGTCAGACTCAGG - Intronic
1017814154 6:158004940-158004962 GCAGGGGTGGGGTCACTCACTGG - Intronic
1017818514 6:158032102-158032124 CCTCAGATGGGGTCAGACGCGGG + Intronic
1018942365 6:168318127-168318149 GCTGAGCTGAGGTCACACAGAGG + Intronic
1019770742 7:2882490-2882512 GCAGAGGTGGGCTCAGCCCCAGG + Intergenic
1021046070 7:15924714-15924736 GCTGAACTGGGCTCAGAGACAGG + Intergenic
1022784661 7:33626582-33626604 GCTGAGGTGGTCTCAGATAGAGG + Intergenic
1022808888 7:33849716-33849738 GGGGAGGTGGTGTCAGCCACTGG + Intergenic
1025020303 7:55475164-55475186 GCAGGGGTAGGGACAGACACAGG + Intronic
1027298142 7:76799776-76799798 GCAGATGTGAGGTCAGAGACTGG + Intergenic
1028295230 7:89121109-89121131 GCTGGTGTGGGGTGTGACACAGG - Intronic
1028667404 7:93362696-93362718 GGTGAGGGGTGGTCAGACGCTGG + Intergenic
1029371874 7:100155450-100155472 GCTTAGCTGGGGGGAGACACAGG + Exonic
1029640386 7:101816366-101816388 CCCGGGGTGGGGGCAGACACCGG - Intronic
1030283740 7:107803714-107803736 GCTGTGGTGGGGGCAGAAATTGG - Intergenic
1032306881 7:130742281-130742303 GGTGAGGTGCGGTCAGATCCGGG + Intergenic
1034753455 7:153592295-153592317 GCTGAAGTGGGGAAAGTCACTGG + Intergenic
1034904888 7:154935182-154935204 GCTGAGGTGGTGTCAGATGGAGG - Intronic
1035673981 8:1442142-1442164 GCTGCTGTGGGTTCAGCCACTGG + Intergenic
1035674009 8:1442252-1442274 GCTGCTGTGGGTTCAGCCACTGG + Intergenic
1035674032 8:1442362-1442384 GCTGCTGTGGGTTCAGCCACTGG + Intergenic
1035674045 8:1442415-1442437 GCTGCTGTGGGTTCAGCCACTGG + Intergenic
1035674075 8:1442521-1442543 GCTGCTGTGGGTTCAGCCACTGG + Intergenic
1035674090 8:1442574-1442596 GCTGCTGTGGGTTCAGCCACTGG + Intergenic
1035674105 8:1442627-1442649 GCTGATGTGGGTTCAGCCACTGG + Intergenic
1035674131 8:1442733-1442755 GCTGCTGTGGGTTCAGCCACTGG + Intergenic
1038250897 8:25903370-25903392 GCTGAGGACGGGTTAGACAGGGG + Intronic
1038570707 8:28659705-28659727 GCTGAGTTTGGGGCAGGCACTGG - Intronic
1038992269 8:32880803-32880825 CCTGAGGTAGAGTCAGACCCTGG + Intergenic
1039153264 8:34529079-34529101 GGTGGGGGGGGGTCAGCCACCGG - Intergenic
1039774552 8:40722799-40722821 ACAGAGGTGGAATCAGACACCGG + Intronic
1041279340 8:56195687-56195709 GCTGAGGTGGCCTCAGGCAAGGG - Intronic
1041706661 8:60853386-60853408 GTTGAGGTCGGCGCAGACACTGG + Exonic
1041849787 8:62378112-62378134 GCTGAGGTGGTGTCAGTCGGAGG + Intronic
1042755214 8:72203076-72203098 GCTGCTGTGGGCTCAGACATAGG + Intergenic
1045189447 8:99868438-99868460 GCTGAGCTGGTGTCACAGACTGG + Exonic
1045267485 8:100632086-100632108 GCTAAAGTGGGGTTTGACACTGG + Intronic
1045287388 8:100803871-100803893 ACTGGGGTGGGCTCAGACCCAGG + Intergenic
1047212339 8:122850206-122850228 CCTGAGGGGGGGTGCGACACGGG - Intronic
1049088354 8:140495044-140495066 ACTGAGATGGGGTCTGACCCGGG - Intergenic
1049417913 8:142503949-142503971 GCTGAGGGAGGCTCAGACATGGG + Intronic
1051606486 9:18922493-18922515 GCTGGGGTTGGGGCAGACAGGGG - Intergenic
1056663362 9:88560861-88560883 GCTGCTGTGGGGTCAGATTCTGG - Intronic
1056838759 9:89980600-89980622 TCTGAGGAGGTGTCAGGCACTGG - Intergenic
1056950822 9:91039635-91039657 TCTGAGGAGGGGGCAGACCCCGG + Intergenic
1058976502 9:110129765-110129787 GCAGAGGAGGGGTCACACATTGG - Intronic
1060656241 9:125374505-125374527 GGTGGGGTGGGAGCAGACACAGG - Intergenic
1061757319 9:132824247-132824269 GCTGGGGTGGGGGCTGGCACAGG - Intronic
1061943035 9:133893232-133893254 GCTGTGGAGGGGTCACACAAAGG + Intronic
1061973606 9:134057441-134057463 GGTGAGGTGGGAGCAGACAGTGG + Intronic
1203564035 Un_KI270744v1:78185-78207 GGTGGGGTGGGGTCAGGCCCAGG + Intergenic
1186186060 X:7020841-7020863 TCTGGGCTGGGTTCAGACACTGG - Intergenic
1186906256 X:14114340-14114362 GCTGGGGTGGGGTGGGGCACGGG - Intergenic
1189270446 X:39747832-39747854 GCTGAGGTGGGGTCTGAAATTGG - Intergenic
1190540567 X:51473716-51473738 GCTGTGGAGGGATAAGACACTGG + Intergenic
1195675306 X:107503153-107503175 GCAAAGGGTGGGTCAGACACTGG + Intergenic
1197758800 X:130013910-130013932 GCTGGGGTGGGTGCAGGCACCGG - Exonic
1198039424 X:132835411-132835433 ACTGGGTTGGGGTCAGAGACAGG - Intronic
1199036250 X:143053825-143053847 GCTGAGCTGGGCTTAGAGACAGG - Intergenic
1199380313 X:147164985-147165007 GCTGAGGTGGTCACAGACTCAGG - Intergenic
1200120505 X:153788016-153788038 GCTAAGGTGGGGTGAGCCAGTGG - Intronic
1201005076 Y:9504591-9504613 GCTGAGGTGGGGTTCGCCATGGG - Intergenic