ID: 900106238

View in Genome Browser
Species Human (GRCh38)
Location 1:982288-982310
Sequence AGGTGGGGTCAGACACGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106223_900106238 23 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106238 1:982288-982310 AGGTGGGGTCAGACACGGGCCGG 0: 1
1: 1
2: 2
3: 20
4: 212
900106222_900106238 26 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106238 1:982288-982310 AGGTGGGGTCAGACACGGGCCGG 0: 1
1: 1
2: 2
3: 20
4: 212
900106230_900106238 -3 Left 900106230 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 3
3: 44
4: 426
Right 900106238 1:982288-982310 AGGTGGGGTCAGACACGGGCCGG 0: 1
1: 1
2: 2
3: 20
4: 212
900106220_900106238 27 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106238 1:982288-982310 AGGTGGGGTCAGACACGGGCCGG 0: 1
1: 1
2: 2
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106238 Original CRISPR AGGTGGGGTCAGACACGGGC CGG Intergenic
900013326 1:133758-133780 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
900043390 1:489745-489767 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
900064828 1:724742-724764 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
900106238 1:982288-982310 AGGTGGGGTCAGACACGGGCCGG + Intergenic
900142760 1:1145462-1145484 AGGTGGGGTCAGTCATGAGATGG - Intergenic
900477546 1:2882958-2882980 ACCTGGGGTCACACACGGGTGGG + Intergenic
900563938 1:3323230-3323252 AGGTGGGGGCAGCCACGAGGTGG + Intronic
900853752 1:5164346-5164368 AAGTGAGGTCAGACACTGCCAGG - Intergenic
900897701 1:5495395-5495417 AGGTGGGCACAGACACGTCCAGG + Intergenic
902237269 1:15065488-15065510 CAGTGGGGTCAGGGACGGGCTGG - Intronic
904935468 1:34126822-34126844 AGATGGGGAGAGAGACGGGCAGG + Intronic
905884473 1:41484428-41484450 AGCTGGGGGCAGACAGGGGCGGG - Intronic
905971583 1:42145944-42145966 AGGTGGGGGCCGACTCGGGGAGG - Intergenic
906133461 1:43477012-43477034 GGGTGGGGTCAGACAGGGGTGGG - Intergenic
906198353 1:43943872-43943894 AGGTTAGGTCAGACAGGGGCAGG - Intergenic
908356134 1:63326291-63326313 AGGTGGGATCCGAGACGGGGAGG - Intergenic
911092084 1:94025542-94025564 AGGTGAGCTCAGAGAGGGGCAGG - Intronic
916115471 1:161481663-161481685 AGATGGGGTGAGACAAAGGCAGG - Intergenic
920051913 1:203169306-203169328 AGGTGTGGTCAGCCAGGGGCTGG + Exonic
922099733 1:222470761-222470783 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
922261768 1:223950253-223950275 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
922735312 1:227975489-227975511 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
924342933 1:243052428-243052450 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1066733550 10:38453124-38453146 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1067041459 10:42955357-42955379 TGGTGGGGACAGACATGAGCAGG + Intergenic
1067369819 10:45672791-45672813 AGGTGGTGTCACAAAGGGGCGGG - Intergenic
1069815618 10:71191869-71191891 AGGTGGGGTCTGAGAAGGGGCGG + Intergenic
1069907996 10:71743358-71743380 AGGTGGGGTCACACCAGGTCTGG + Intronic
1070195270 10:74151076-74151098 AGGCGGGGTCAGGAATGGGCGGG + Intergenic
1070397011 10:76020144-76020166 AGGTGGGGTCTGACCCAGACTGG + Intronic
1075844631 10:125535462-125535484 AGGTGGGATGAGACAGGGTCCGG - Intergenic
1076969663 11:125962-125984 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1077169258 11:1159054-1159076 AGGTGGGGGCAGGCCTGGGCTGG + Intronic
1078084262 11:8224427-8224449 AGGAGGGGTCACACACAGACGGG + Exonic
1079601405 11:22316279-22316301 AGGTGGGGGGAGAGACAGGCAGG - Intergenic
1079601419 11:22316330-22316352 AGGCGGGGGGAGAGACGGGCAGG - Intergenic
1081619903 11:44613277-44613299 AGGTGGAGCCAGGCAGGGGCTGG + Intronic
1082833711 11:57637969-57637991 AGGAGGGGTTGGAGACGGGCAGG + Intergenic
1083272315 11:61578745-61578767 GGGTGGGGTCAGACATAGGCTGG - Intronic
1083757824 11:64801036-64801058 AGGTGGGGTCACAGATGGGATGG + Intronic
1083889424 11:65588574-65588596 AGGTGGGAGTGGACACGGGCAGG + Intronic
1084118400 11:67055256-67055278 AGGTGGGGCCAGACTGGGGGTGG - Intergenic
1084164277 11:67367692-67367714 AGGTGGGGACAGACACCTGAGGG - Intronic
1094813789 12:34165231-34165253 AGGTAAGCTCAGCCACGGGCAGG + Intergenic
1100610225 12:96185824-96185846 AGGTGGGGTCTCACACGACCTGG + Intergenic
1103905978 12:124327367-124327389 GGGTGGGGACAGACGGGGGCGGG + Intronic
1103967929 12:124652109-124652131 GGGTGGGGGCAGGCACGGGCTGG - Intergenic
1104748258 12:131223182-131223204 AGGAGGGGTCAGAGAGGAGCAGG - Intergenic
1105700994 13:22935634-22935656 AGGTGGGGACAGACACCTTCAGG - Intergenic
1105853823 13:24358683-24358705 AGGTGGGGACAGACACCTTCAGG - Intergenic
1105974666 13:25462926-25462948 AGGTGGAGTCAGACCCGGCTTGG - Intronic
1106003535 13:25747562-25747584 AGGAGGGGTTAGACACGTGGAGG + Intronic
1107818588 13:44266371-44266393 AGGTGGGCTCACACACAGTCAGG + Intergenic
1110852681 13:80262942-80262964 AGGTGGGGTAAGACCCAAGCTGG - Intergenic
1113517352 13:110914256-110914278 AGCTGGGGTCAGAGGCGCGCGGG - Intronic
1113898605 13:113783159-113783181 AGGTGTGGTAAGAAAAGGGCAGG + Intronic
1117285105 14:54279227-54279249 AGGCGGGGACAGACAGGGACTGG + Intergenic
1118439628 14:65800754-65800776 AGCTGTGATCAGAGACGGGCGGG - Intergenic
1118758773 14:68864827-68864849 AGGGTGGGACAGGCACGGGCGGG + Intergenic
1118906611 14:70028026-70028048 AGGTGGGGACAGAAGCTGGCTGG + Intronic
1120220838 14:81731011-81731033 AGGTGTGAGCAGACATGGGCAGG - Intergenic
1120835709 14:89036893-89036915 AGGTGGGGGCAGGCAGGGGAGGG - Intergenic
1121233218 14:92373451-92373473 GGAGGGGGTCAGACACTGGCTGG - Intronic
1122488269 14:102095966-102095988 AGGTGGGGTCAGCCAGGCCCTGG - Intronic
1122969970 14:105148526-105148548 AGGTGAGGACAGAGAGGGGCGGG + Intronic
1124127189 15:26946698-26946720 AGGTGGGGTCAAGCACTGCCTGG - Intronic
1125505692 15:40266335-40266357 TGGTGGGCTCAGCCACAGGCAGG + Exonic
1128935459 15:71742597-71742619 TGGTGAGGTCAGGCACTGGCTGG - Intronic
1129151220 15:73689030-73689052 ATTTCGGGTCAGACACTGGCAGG - Intronic
1129330872 15:74826540-74826562 AGGTGGGGGCGGGCCCGGGCGGG + Exonic
1131268970 15:90935199-90935221 AGGTGGGGTCAGAGAGGGGCAGG - Intronic
1131676634 15:94676772-94676794 AGGTGGGGTCAGGGATGGGCAGG - Intergenic
1133606259 16:7391174-7391196 AGGTGGGGCCAGTCACGTGCAGG - Intronic
1134614745 16:15642744-15642766 ACCAGGGGTCAGACAGGGGCGGG + Intronic
1135435727 16:22425551-22425573 AGGCGGGGTCACCCTCGGGCTGG + Intronic
1135602641 16:23796204-23796226 AAGTGGTGTCAGAGAAGGGCAGG - Intergenic
1136040487 16:27574976-27574998 AGGTGGGCTCAGAGGCGGGGAGG - Intronic
1138342521 16:56299503-56299525 AGGTGGGGGCTGCCTCGGGCTGG - Intronic
1141103688 16:81215960-81215982 AGATGGGGACAGAAACCGGCAGG + Intergenic
1141694015 16:85611621-85611643 AGGTGGGGGCGCACGCGGGCCGG - Intronic
1141944014 16:87297536-87297558 AGGTGGGGCCAGGCACTGCCAGG + Intronic
1142044934 16:87919355-87919377 AGGCGGGGTCACCCTCGGGCTGG + Intronic
1142155667 16:88531902-88531924 CGGTGGGGTCCGTCACGGCCAGG + Intronic
1142222383 16:88861832-88861854 AGGGGGGGTCAGCCTAGGGCAGG + Exonic
1142260783 16:89041641-89041663 TGGTGGGGCCAGACAGCGGCAGG - Intergenic
1142451014 16:90173160-90173182 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1142456549 17:60535-60557 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1143573703 17:7777338-7777360 AGGTGGGGTCAGCACCGGGTTGG + Intronic
1144038099 17:11385356-11385378 AGGTGTGGTCAGAAAGGTGCAGG + Intronic
1144727949 17:17511232-17511254 AGGTGGGGGCAGGTGCGGGCAGG - Intronic
1146574018 17:33976385-33976407 ATGTGGGGTCAGGCCTGGGCAGG - Intronic
1146605254 17:34252313-34252335 TGGTGGGGTCAGACCCCGGGAGG + Intergenic
1147146789 17:38490188-38490210 AGGTGCTGTCAGACACGAGGTGG + Intronic
1148397669 17:47323551-47323573 AAGTGGGGTCAGACCATGGCGGG + Intronic
1148650972 17:49249717-49249739 AGGTGGGGCCAGGCAGTGGCAGG + Intergenic
1151566920 17:74903830-74903852 AGGTGGGGTGGGAAACCGGCAGG - Intergenic
1151880923 17:76893921-76893943 AGGTGGGCTCTGAGACAGGCAGG - Intronic
1151952844 17:77364685-77364707 GGCTGGGGGCAGAGACGGGCAGG + Intronic
1152562736 17:81086678-81086700 AGGTGCGATCAGACAGAGGCAGG + Intronic
1153700221 18:7685214-7685236 AGCAGGGTTCAGACAGGGGCAGG - Intronic
1153820270 18:8826003-8826025 GGGTGGGGTCAGAGATGTGCAGG + Exonic
1157310927 18:46552672-46552694 AGCTGGGGTCAGGCACTGGTGGG - Intronic
1157414796 18:47493293-47493315 AGGTGAGCTCAGACACGTGCTGG + Intergenic
1160223829 18:76997328-76997350 AGGTGGCGTCAGGCCCGGGCTGG - Intronic
1160646467 19:195888-195910 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1160799337 19:960528-960550 GAGTGGGGTCAGATTCGGGCTGG + Intronic
1161017342 19:1989805-1989827 CGGTGGGGACAGAGCCGGGCCGG + Intronic
1161058096 19:2200599-2200621 AGGTGGGGTCAGCAGCCGGCTGG + Intronic
1161163254 19:2772205-2772227 AGGCTGGGTCAGACAGGGCCTGG + Intronic
1161726740 19:5933661-5933683 AGGAGGGGAGAGACAAGGGCAGG + Intronic
1162321351 19:9972881-9972903 AAGTGGGGGCAGACATGGGAGGG - Intronic
1162677204 19:12308088-12308110 AGGTGGGGGCAGCAAGGGGCTGG + Intergenic
1163124667 19:15238540-15238562 ATGAGGGGTCAGCCACGGGGAGG - Intronic
1165223485 19:34337318-34337340 AGATGAGTTCAGACACAGGCAGG + Intronic
1166319376 19:42006820-42006842 GGGAGGGGTGAGTCACGGGCTGG + Intronic
1166451509 19:42906395-42906417 AGGTGGAGTCAGGCAGGGCCAGG + Intronic
1166882792 19:45939635-45939657 AGGAGGGGTCAGTTCCGGGCTGG + Exonic
1168720443 19:58551802-58551824 AGGTGGGGTCAGGCAGCGGAGGG + Intronic
925038271 2:708938-708960 AGCGGGGCTCAGCCACGGGCGGG - Intergenic
926118542 2:10228502-10228524 AAGTGGGGTCAGACACTGTGTGG - Intergenic
927103608 2:19806499-19806521 AGGTGGAGGCAGACATGGTCAGG + Intergenic
928425924 2:31177703-31177725 AGCTGTGGGCACACACGGGCAGG - Intronic
931146709 2:59527226-59527248 AGTTGAGGTCAGAGAGGGGCAGG - Intergenic
932703128 2:74004187-74004209 AGGTGGGCTGAGGCAGGGGCAGG - Intronic
937317901 2:120943676-120943698 GGCTGGGGCCAGACACAGGCAGG - Intronic
938288976 2:130139672-130139694 AGGTGGGCTCAGAAGCAGGCTGG + Exonic
938467553 2:131533259-131533281 AGGTGGGCTCAGGCTGGGGCGGG - Exonic
942037869 2:172028379-172028401 AGGTGGGGTCAGACCATTGCAGG + Intronic
943787595 2:191895719-191895741 AGATAGGGTCAGCCACTGGCAGG + Intergenic
946374431 2:219299533-219299555 GGGTGGGGCCAGCAACGGGCTGG + Intronic
948333992 2:237193701-237193723 AGGTAGGTGCAGACACAGGCAGG + Intergenic
948650951 2:239443426-239443448 AGCTGGGGTCAGACACAGGCTGG - Intergenic
1173581082 20:44147036-44147058 AGGTGGGGTGAGACACTAGATGG + Intronic
1175492173 20:59386692-59386714 AGCTGGGCTCAGACACCAGCTGG + Intergenic
1175770851 20:61623200-61623222 AGGTGGGGTGAGCCAGCGGCTGG - Intronic
1175892436 20:62321598-62321620 AGGTGGGGTCAGTGAAGGGGTGG + Intronic
1175914168 20:62418103-62418125 ATGTCTGGTCAGACACTGGCGGG - Intronic
1176109310 20:63404298-63404320 AGGTGGGGTCACACCTCGGCAGG + Intergenic
1176279040 20:64290328-64290350 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1176298715 21:5088429-5088451 AGGTGAGGTCAGCCAGGGGTGGG + Intergenic
1179231412 21:39506976-39506998 AGGAGGGGCGAGACATGGGCAGG + Intronic
1179647526 21:42784731-42784753 AGGTGGGGTGAGGCAGGGGTGGG - Intergenic
1179858311 21:44173520-44173542 AGGTGAGGTCAGCCAGGGGTGGG - Intergenic
1183323683 22:37180211-37180233 TGGCGGGGTCAGGCAGGGGCAGG + Exonic
1183428311 22:37751265-37751287 AGGTGGAGCCAGTCACAGGCTGG - Intronic
1184147206 22:42618748-42618770 GGGTGGGGTCAGGAAAGGGCTGG - Exonic
1184278541 22:43424545-43424567 AGCTGGGGTAAGACAATGGCTGG - Intronic
1184320667 22:43739985-43740007 AGGTGGAGGGAGACACGGCCAGG - Intronic
1184459893 22:44631127-44631149 AGGTGGTGACAGCCAGGGGCTGG - Intergenic
1185242782 22:49755413-49755435 AGGTGAGGTAAGAGACTGGCAGG + Intergenic
1185330727 22:50251081-50251103 AGGTGGGGACAGGCAGTGGCAGG - Exonic
950125201 3:10506253-10506275 AGGTGGGGTCGCACACAGGCAGG - Intronic
953571489 3:44075289-44075311 TGGGGGTGTCAGACAAGGGCTGG + Intergenic
954591857 3:51789743-51789765 AGGTGTGGCCAGACAGGGGATGG + Intergenic
954688321 3:52382592-52382614 AGGTGGGGCCACAGATGGGCAGG + Intronic
954719636 3:52550420-52550442 AAGTGGGATCAGACACTGGCAGG - Exonic
954808085 3:53231801-53231823 AGGAGGGGCCAGACGTGGGCAGG + Intronic
955412183 3:58662845-58662867 AGATGGGGTCAGACACGGGCTGG + Intronic
959406516 3:105967785-105967807 AGGAGGGGTTAGACACATGCCGG - Intergenic
960706888 3:120490626-120490648 AGTTTGGGTCAGACAAGGACTGG + Intergenic
964517843 3:157531949-157531971 AGGTGAGGTCAGTGAGGGGCTGG - Intronic
965404283 3:168250146-168250168 AGGTGGGGACAGACACCTGCGGG + Intergenic
967319393 3:188180276-188180298 AGGTGAGGTCAGACGAGAGCAGG - Intronic
968371214 3:198223638-198223660 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
968762378 4:2449405-2449427 GGGTGGGGTAAGACATGAGCCGG - Intronic
969113730 4:4859205-4859227 AGGGGGGGTCAGACAGTGGAGGG + Intergenic
969317957 4:6393574-6393596 AGCTGGGTGCAGACACGGGTTGG - Intronic
973758566 4:54097644-54097666 AGGTAGGGCCAGATAGGGGCTGG + Intronic
977536672 4:98261771-98261793 GGGTGGGGTCGGCCGCGGGCCGG + Intronic
979259899 4:118636111-118636133 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
979328485 4:119404514-119404536 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
985078904 4:186244961-186244983 AGGTGGGGACACACAAGGGGAGG + Intronic
988490324 5:31700325-31700347 AGGTGGGGTGAGGAAAGGGCTGG + Intronic
992026247 5:72672226-72672248 AGGTGTGGTCAGTCCCAGGCGGG + Intergenic
992270562 5:75058735-75058757 AGGTGGGGGCAAACTTGGGCAGG + Intergenic
999065709 5:148683480-148683502 TGGTGGGGTCAGAGAGAGGCTGG + Intergenic
1002730453 5:181329184-181329206 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1002754080 6:144920-144942 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1003145262 6:3504895-3504917 AGGGGGGGTTGGACACGGGGGGG + Intergenic
1003749543 6:9040755-9040777 AGGTGTGGAGAGGCACGGGCGGG + Intergenic
1005213179 6:23493260-23493282 CGGTAGGGTCAGAGACGGGGAGG - Intergenic
1005812947 6:29530337-29530359 AGGCTGGGTCAGACAAGGTCCGG - Intergenic
1006113809 6:31764517-31764539 AGGAGGGTTTAGACACGGGTAGG - Exonic
1007314837 6:40979007-40979029 AGCTGGGGTCAGGCATTGGCAGG + Intergenic
1010786185 6:80004269-80004291 CGGTGGGGTCAGTAAAGGGCCGG + Intronic
1011083304 6:83512339-83512361 TGCTGGGGTGAGACACGGCCAGG + Intergenic
1015590615 6:134819359-134819381 TGGTTGGGTCAGAGAAGGGCTGG - Intergenic
1018927374 6:168215615-168215637 AGGTGGGGTGCGACAGTGGCAGG - Intergenic
1019656303 7:2197930-2197952 AGATGGGGTCAGTCACAGGCTGG - Intronic
1023243822 7:38178732-38178754 CGGTGGGGTCGGCCCCGGGCTGG + Intronic
1023401618 7:39795735-39795757 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1023981459 7:45073094-45073116 AGGTGGTGGCAGAGATGGGCTGG - Intronic
1024075598 7:45816357-45816379 AGGTGGGGTCAGACAGGGCTGGG + Intergenic
1024648000 7:51384940-51384962 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1025051855 7:55739436-55739458 AGGTGGGGTCAGACAGGGCTGGG - Intergenic
1025128813 7:56365104-56365126 AGGTGGGGTCAGACAGGGCTGGG - Intergenic
1025177194 7:56807985-56808007 AGGTGGGGTCAGACAGGGCTGGG - Intergenic
1025694598 7:63768401-63768423 AGGTGGGGTCAGACAGGGCTGGG + Intergenic
1026867546 7:73832757-73832779 GGGGGGGGTCAGTCAGGGGCAGG + Intergenic
1027163096 7:75816418-75816440 AGGTGAAGGCAGACAGGGGCAGG - Intronic
1027188227 7:75984190-75984212 AGGTGGGGGCAGCCCCAGGCCGG - Intronic
1027853850 7:83483989-83484011 AGGTGGGGTCAGATTGGGGGTGG - Intronic
1029600226 7:101558948-101558970 AGGGGTGGTCAGAGGCGGGCGGG + Exonic
1031061806 7:117060200-117060222 GGGTGGGGCTAGACACTGGCTGG + Intronic
1032052123 7:128656104-128656126 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1034116803 7:148590806-148590828 AGGAGGATTCAGACACAGGCTGG - Exonic
1034474893 7:151276413-151276435 AGGTGGTGCCAGACAGGGGGAGG + Intronic
1035117972 7:156540774-156540796 GGGTGGGGGCAGTCATGGGCAGG + Intergenic
1035661013 8:1348817-1348839 AGGTGGGGACTGATACTGGCTGG - Intergenic
1036133795 8:6140333-6140355 AGGATGGGGCAGACAGGGGCAGG - Intergenic
1036686865 8:10917569-10917591 AGGTGGGATCAGACTTGTGCTGG - Intronic
1037154048 8:15677693-15677715 AGGTGGTGTCAGACAGAGCCAGG + Intronic
1047112981 8:121811535-121811557 ATGTGGGCTCAGAGAAGGGCTGG + Intergenic
1048479271 8:134772863-134772885 AGGTGAGGTCTCACACAGGCTGG - Intergenic
1056152798 9:83804718-83804740 AGGTGGGGTCAGCCCCCCGCCGG + Intronic
1057171666 9:92966590-92966612 AGGTGGGGTGGGCCCCGGGCAGG - Intronic
1060193110 9:121605419-121605441 AGGTGGGGACTGACACTGACAGG - Intronic
1061272179 9:129549941-129549963 GCGTGGGCTCTGACACGGGCAGG - Intergenic
1062035140 9:134379633-134379655 GGGTGGGGTCAGAGAGGGGCTGG - Intronic
1062274497 9:135724285-135724307 AGGTGGGGGCAGCCGTGGGCGGG + Intronic
1062407516 9:136403835-136403857 AGGTGGGATCAGACACTGCGAGG + Intronic
1062754863 9:138281694-138281716 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1203793046 EBV:161707-161729 ACGTGGGGGTAGTCACGGGCGGG + Intergenic
1203578771 Un_KI270745v1:25863-25885 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1185506469 X:634946-634968 AGGTTGGGTGAGGGACGGGCTGG + Intronic
1186782385 X:12926064-12926086 AGGTGGGTTCAGAAATGGCCAGG + Intergenic
1188556237 X:31415482-31415504 AGGTAGGGTCAGGTACAGGCTGG + Intronic
1192229559 X:69255796-69255818 AGGAGGGGCCAGAGAAGGGCTGG + Intergenic
1192438156 X:71155183-71155205 AGAAGGGGTGAGACACAGGCTGG - Intronic
1194212067 X:91082045-91082067 AGCTGGGGTCAGGAACAGGCAGG + Intergenic
1197097717 X:122615003-122615025 GGCTGGGTTCAGACAAGGGCAGG - Intergenic
1199712274 X:150477779-150477801 AGGTGGGGTCAGATCCACGCTGG - Intronic
1200151957 X:153955524-153955546 GGGTGGGCTGGGACACGGGCTGG + Exonic
1200804425 Y:7418337-7418359 AGGTGGGCACAGACACGAGTGGG - Intergenic
1202381391 Y:24278481-24278503 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1202489394 Y:25391645-25391667 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic