ID: 900106239

View in Genome Browser
Species Human (GRCh38)
Location 1:982291-982313
Sequence TGGGGTCAGACACGGGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106223_900106239 26 Left 900106223 1:982242-982264 CCAGCTACAGTACATGAGGACGA 0: 1
1: 0
2: 1
3: 3
4: 35
Right 900106239 1:982291-982313 TGGGGTCAGACACGGGCCGGAGG 0: 1
1: 1
2: 0
3: 13
4: 139
900106220_900106239 30 Left 900106220 1:982238-982260 CCCTCCAGCTACAGTACATGAGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 900106239 1:982291-982313 TGGGGTCAGACACGGGCCGGAGG 0: 1
1: 1
2: 0
3: 13
4: 139
900106222_900106239 29 Left 900106222 1:982239-982261 CCTCCAGCTACAGTACATGAGGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 900106239 1:982291-982313 TGGGGTCAGACACGGGCCGGAGG 0: 1
1: 1
2: 0
3: 13
4: 139
900106230_900106239 0 Left 900106230 1:982268-982290 CCTGGCACGGGGCCGGGCTGAGG 0: 1
1: 0
2: 3
3: 44
4: 426
Right 900106239 1:982291-982313 TGGGGTCAGACACGGGCCGGAGG 0: 1
1: 1
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106239 Original CRISPR TGGGGTCAGACACGGGCCGG AGG Intergenic
900000174 1:10488-10510 TCAGGTCAGACCCGGGCGGGCGG - Intergenic
900019879 1:181018-181040 TCAGGTCAGACCCGGGCGGGCGG - Intergenic
900106239 1:982291-982313 TGGGGTCAGACACGGGCCGGAGG + Intergenic
900477548 1:2882961-2882983 TGGGGTCACACACGGGTGGGTGG + Intergenic
900995431 1:6121027-6121049 TGGGTTCAGAGAAGGGCAGGTGG - Intronic
903044346 1:20554052-20554074 ACGGGGGAGACACGGGCCGGGGG - Exonic
903115591 1:21176474-21176496 TGGGGGCAGACCCGGGGAGGCGG + Intronic
905385873 1:37603662-37603684 TGGGGGCACACACTGGCAGGTGG + Intergenic
906133460 1:43477009-43477031 TGGGGTCAGACAGGGGTGGGAGG - Intergenic
906705887 1:47895088-47895110 TGGGGTGAGGCAGGGGCCGCAGG - Intronic
908159934 1:61396696-61396718 TGTGGTCAGAAACGTGCCTGGGG + Intronic
915100517 1:153495735-153495757 TGGGGTGAGGCACGGGCCACTGG - Intergenic
915934968 1:160085009-160085031 TGAGGTGAGACAGGGGTCGGAGG + Intronic
920562594 1:206949332-206949354 TGGGCTCAGCCACACGCCGGTGG + Intergenic
923555085 1:234993999-234994021 TGGGGACAGACCCTGGCAGGAGG - Intergenic
1062802003 10:387711-387733 TGTGGACAGACACGGCCGGGGGG + Intronic
1066733501 10:38452971-38452993 TCGGGTCAGCCACGTGCCTGTGG + Intergenic
1067077314 10:43195598-43195620 TGGGGTCAGGGAGGGGCAGGGGG - Exonic
1070368098 10:75755808-75755830 TGGGGTCAGCGACGTGCCTGGGG + Intronic
1070831796 10:79422339-79422361 AAGGGTCAGACATGGGCTGGGGG + Intronic
1074853791 10:117458469-117458491 TGGGGGTAGACACGGGTCGGGGG - Intergenic
1076107465 10:127834866-127834888 TGTGGTCAGACACAGGCCTATGG - Intergenic
1076963560 10:133786668-133786690 TCAGGTCAGACCCGGGCGGGCGG + Intergenic
1077481233 11:2815647-2815669 TGGGGTCAGCCTGGGGCTGGGGG - Intronic
1078434831 11:11315791-11315813 TGAGGTCAGATAAGGGCTGGGGG - Intronic
1083652509 11:64211497-64211519 TGGGCACAGACACGGGACAGGGG - Intronic
1083681861 11:64355066-64355088 GGGGGTCAGACAAGGGGAGGGGG - Intronic
1084039128 11:66531361-66531383 TGGGGTCAGACCTGGGCCCTGGG - Intronic
1089073102 11:115716399-115716421 TGGGGACAGACCCTGGCCCGAGG + Intergenic
1091373257 12:10605-10627 TCAGGTCAGACCCGGGCGGGCGG - Intergenic
1095752809 12:45729704-45729726 GGGGCTCAGTCATGGGCCGGCGG - Exonic
1096241682 12:49963122-49963144 TGGGGCCAGGCACGGGCAGGAGG + Intronic
1097427965 12:59470844-59470866 TGGGGCCTGACAGGGGACGGGGG - Intergenic
1102236724 12:111298450-111298472 TGGGCTCAGGCAGGGGCTGGGGG + Intronic
1102300318 12:111766770-111766792 AGGGGGCAGCCACGGGCCGGGGG + Intronic
1102433358 12:112900810-112900832 TGGGGTCAGCCAGGGGTCAGGGG - Intergenic
1102953562 12:117045624-117045646 TGGGGGCAGGCCCAGGCCGGTGG + Intronic
1103601742 12:122058847-122058869 TAGGGTCAGGCAGGGGCCAGGGG + Intronic
1105278919 13:18951980-18952002 TGGGGTCAGACAGAGGCCCCTGG + Intergenic
1110219671 13:73059551-73059573 TGGAGGCAGCCGCGGGCCGGTGG - Exonic
1114524240 14:23358581-23358603 TGGGGTCAGAGCTGGGCCTGGGG - Intronic
1118087886 14:62440380-62440402 TTGGGTCTGACACGGGCCATAGG + Intergenic
1118439627 14:65800751-65800773 TGTGATCAGAGACGGGCGGGAGG - Intergenic
1118745502 14:68770238-68770260 TGAGGTCAGCCACGGCCCCGAGG - Intergenic
1122938511 14:104970819-104970841 TGTGGACAGACACAGGCCTGAGG + Intronic
1124600910 15:31132206-31132228 TGGGGTCACAGAGGGGCCAGGGG - Intronic
1128470262 15:67945928-67945950 TGGGGGCACACACGGGGTGGGGG + Intergenic
1129117797 15:73374972-73374994 TGGGTTCAGACAGGGGCCTCTGG + Intergenic
1131318340 15:91361885-91361907 TGGGGCCAGTCACGGGGTGGAGG + Intergenic
1132453320 15:101980371-101980393 TCAGGTCAGACCCGGGCGGGCGG + Intergenic
1132453607 16:10429-10451 TCAGGTCAGACCCGGGCGGGCGG - Intergenic
1133606256 16:7391171-7391193 TGGGGCCAGTCACGTGCAGGGGG - Intronic
1134614747 16:15642747-15642769 AGGGGTCAGACAGGGGCGGGCGG + Intronic
1136221997 16:28835051-28835073 TGGGGGCAAACACCGGCTGGCGG - Exonic
1138242218 16:55436265-55436287 GGGGGACAGACATGGGCCAGAGG + Intronic
1138627743 16:58265996-58266018 TGGGGTCAGACGTGGGGCCGGGG - Intronic
1138958403 16:61999964-61999986 TGGGGTCTGCCAGGGGTCGGGGG - Intronic
1139508772 16:67414395-67414417 TGGGTTCAGACACGGGTGAGGGG - Intronic
1139700109 16:68703062-68703084 TGGGGACAGAGATGGGCCAGCGG + Intronic
1141812043 16:86382434-86382456 TGGGGACAGGCACCCGCCGGGGG + Intergenic
1141933310 16:87218792-87218814 TGGGGTCAGACTCTTGCTGGGGG - Intronic
1142583295 17:954993-955015 TGGGGTCAGGCCCGGGACGCGGG - Intronic
1144613997 17:16751885-16751907 TGGGGGCAGACACTGGAGGGAGG - Intronic
1144898715 17:18563786-18563808 TGGGGGCAGACACTGGAGGGAGG + Intergenic
1145133660 17:20381937-20381959 TGGGGGCAGACACTGGAGGGAGG - Intergenic
1146179379 17:30687546-30687568 TGGGGGCAGGCGCGGGGCGGGGG - Intergenic
1147888622 17:43701467-43701489 TGGGGCCAGACACAGGGCTGTGG + Intergenic
1148240372 17:45996335-45996357 TGGGGTCAGAAAAGGCCCTGGGG - Intronic
1150434666 17:65144504-65144526 CGGGGTCAGACAGGGTCCCGCGG + Intronic
1152521251 17:80858191-80858213 GGGGGTCAGACACAGGCAGGGGG - Intronic
1152799402 17:82323878-82323900 TGGGGACAGAGAAGGGTCGGGGG + Intronic
1155603072 18:27571592-27571614 TGGGTTCAGACAGGGGCCCATGG + Intergenic
1157564168 18:48668509-48668531 TGGGGACAGCCGGGGGCCGGGGG + Intronic
1160520834 18:79507137-79507159 TGGGGTGGGACGCGGGCCAGGGG - Intronic
1160653389 19:246378-246400 TCAGGTCAGACCCGGGCGGGCGG - Intergenic
1160962503 19:1729810-1729832 CGGGGTCAGACCCGGGCTGGCGG - Intergenic
1161364109 19:3868584-3868606 AGGGGACAGACCCGGGCGGGGGG - Intronic
1163361794 19:16851507-16851529 CGGGTGCAGACACGGGGCGGAGG - Exonic
1163767419 19:19171185-19171207 TGGGGTCAGGCTTGGGCCAGAGG + Intronic
1164394635 19:27851933-27851955 TGACCTCAGACACGGGCCAGTGG - Intergenic
1165483983 19:36084322-36084344 TGGGGTAGGACAGGGGCCAGGGG - Intronic
1166326964 19:42056892-42056914 TGGGGGCAGAGATGGGCCAGAGG + Intronic
1167817503 19:51896723-51896745 TGGGACCAGAGACGGGCCTGAGG + Intronic
1167978862 19:53255552-53255574 TGGGGTCAGACCCTGGGCGGTGG + Intergenic
926615932 2:14996521-14996543 TGGGCTGAGACATGGGCAGGTGG - Intergenic
929687431 2:44046762-44046784 TGGGGTCAGAGATGAGCCAGGGG + Intergenic
932303912 2:70687967-70687989 TGGGCTCTGACAGGGGCCTGTGG - Intronic
936569438 2:113602364-113602386 TCAGGTCAGACCCGGGCGGGCGG + Intergenic
936569809 2:113603576-113603598 TCAGGTCAGACCCGGGCGGGCGG - Intergenic
942497915 2:176559011-176559033 TGTGGTCAGGCAGGGGCCTGTGG + Intergenic
948992038 2:241560222-241560244 TGGGGTCACACACGGTCCACTGG + Intronic
949088992 2:242182909-242182931 TCAGGTCAGACCCGGGCGGGCGG + Intergenic
1170578570 20:17681843-17681865 CGGGGTCGGACTCGGGGCGGGGG - Intronic
1172116679 20:32577169-32577191 TGGGCTCAGACCCCTGCCGGAGG + Intronic
1172957477 20:38771300-38771322 CGGGGTCAGAGAGGGGCCAGTGG - Intronic
1173279799 20:41618163-41618185 TGGGGTCCGAGCGGGGCCGGCGG - Intronic
1173497221 20:43528489-43528511 TGGTGCCAGACACGGGGCTGAGG - Intronic
1173849006 20:46206103-46206125 TGGCCTCAGACATGGGCCAGTGG - Intronic
1175639281 20:60614005-60614027 TGGGGTCAGAGACAGGCAAGAGG - Intergenic
1175914167 20:62418100-62418122 TCTGGTCAGACACTGGCGGGCGG - Intronic
1176085506 20:63293855-63293877 TGGGGTCACACACTGGGAGGGGG + Intronic
1179710087 21:43208220-43208242 TGGGGTCAGAGAAGGGGCTGGGG + Intergenic
1183339836 22:37274074-37274096 TGGGGTCAGCAAGGGGCTGGGGG - Intergenic
1183350667 22:37332990-37333012 TGGGGTCAGACAAGGGGATGGGG + Intergenic
1183690020 22:39383130-39383152 TGGGGTCAGTCAGGGTTCGGGGG + Exonic
1185324987 22:50221181-50221203 TGGCGTCAGACACGTGCCCGTGG + Exonic
949240513 3:1865671-1865693 TGGGGTCTGTCAGGGGCTGGGGG + Intergenic
951267350 3:20584529-20584551 TGGGGTGGGACAAGGGCCAGGGG + Intergenic
953024515 3:39137155-39137177 GGGTATCAGACACAGGCCGGTGG - Intronic
955412184 3:58662848-58662870 TGGGGTCAGACACGGGCTGGTGG + Intronic
955958848 3:64318485-64318507 TGGGGTCAGAAACGGACCATAGG - Intronic
965782520 3:172302188-172302210 TGGGGGCGGGCATGGGCCGGGGG - Intronic
969317956 4:6393571-6393593 TGGGTGCAGACACGGGTTGGAGG - Intronic
972382987 4:38536392-38536414 TGGGGGCAGAGACTGGTCGGAGG + Intergenic
973590611 4:52437052-52437074 TGGGGTAAGACTGGGGCTGGAGG + Intergenic
976294431 4:83455648-83455670 TGGGGAGAGACACCCGCCGGCGG + Exonic
982072681 4:151709268-151709290 AGGTGTCAGCCACGGGCCGCCGG - Intronic
982351185 4:154416944-154416966 CGGGGACAGACAGAGGCCGGGGG - Intronic
983682913 4:170373862-170373884 TGGGGTCAGACACAGAGCAGGGG - Intergenic
985466813 4:190204111-190204133 TCAGGTCAGACCCGGGCGGGCGG + Intergenic
985784843 5:1888034-1888056 TGGGGTCAGACTAGGGCTGGAGG + Intergenic
987144914 5:14982635-14982657 TGGGGTCATACTTGGGCCAGTGG - Intergenic
987183086 5:15386558-15386580 TGGGGGCAGACAAGGCCCAGTGG + Intergenic
999242142 5:150133852-150133874 TGGGGCCAGGCAGGGGTCGGAGG - Intronic
1002911150 6:1491731-1491753 TGTGCTCAGACAGAGGCCGGTGG - Intergenic
1002913942 6:1513877-1513899 TGTAGTCATACAGGGGCCGGAGG - Intergenic
1009439780 6:63663508-63663530 TGGGGTCAGACAGGAGGCTGAGG - Intronic
1012525978 6:100178102-100178124 TTGGGTCAGACAAGGGAAGGAGG + Intergenic
1015590614 6:134819356-134819378 TTGGGTCAGAGAAGGGCTGGTGG - Intergenic
1018172588 6:161153804-161153826 TGGGGTCACACACAGCCCTGGGG + Intronic
1018172610 6:161153894-161153916 TGGGGTCACACACAGCCCTGGGG + Intronic
1018172614 6:161153912-161153934 TGGGGTCACACACGGCCCCATGG + Intronic
1018486921 6:164250007-164250029 TGGGTTCAGACAAGGGGCTGTGG - Intergenic
1018849597 6:167577445-167577467 TGGGCTCAGACACAGGGCGGTGG - Intergenic
1022499001 7:30871009-30871031 TGGGGGCACACACGGCCCTGGGG - Intronic
1030403918 7:109086633-109086655 TGGGGCCTGTCACGGGCTGGGGG + Intergenic
1032125238 7:129188774-129188796 GGAGGCCAGACGCGGGCCGGGGG - Intergenic
1035270362 7:157716105-157716127 TGGGTTCAGCCACAGGCTGGGGG + Intronic
1035512912 8:206112-206134 TCAGGTCAGACCCGGGCGGGCGG - Intergenic
1039424887 8:37477599-37477621 AGGGGTCAGACAAGGGTTGGGGG - Intergenic
1047762080 8:127961835-127961857 AGGAGTCAGACTCGGGCAGGGGG - Intergenic
1049883015 9:10846-10868 TCAGGTCAGACCCGGGCGGGCGG - Intergenic
1057152587 9:92808481-92808503 TGGGGGGAGACACGGCCTGGGGG + Intergenic
1057274008 9:93666579-93666601 TGGGGTCAGACAGAGGCCCCTGG - Intronic
1060722310 9:125987256-125987278 TGGAGTCAGACTCAGGCCTGGGG + Intergenic
1061005489 9:127926746-127926768 TGGGGGCAGCCAATGGCCGGGGG + Intronic
1061272178 9:129549938-129549960 TGGGCTCTGACACGGGCAGGAGG - Intergenic
1062187913 9:135228436-135228458 TGGGGTCAGCCAGGGGAGGGAGG + Intergenic
1062267930 9:135695887-135695909 TGGGGTGAGCCAGGGGCCCGAGG - Intronic
1062543334 9:137051147-137051169 TGGGGTCAACCAGGGGCCGAGGG + Intronic
1192309868 X:70001947-70001969 TGGGGTCAGACCTGGGCATGAGG - Intronic
1200002794 X:153070917-153070939 TGGGTTCAGCCACGCACCGGAGG + Intergenic
1200004929 X:153079092-153079114 TGGGTTCAGCCACGCACCGGAGG - Intergenic
1200402818 X:156029490-156029512 TCAGGTCAGACCCGGGCGGGCGG + Intergenic