ID: 900106382

View in Genome Browser
Species Human (GRCh38)
Location 1:982992-983014
Sequence CAGAGCACGGCGTGGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 151}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900106382_900106388 -4 Left 900106382 1:982992-983014 CCTCGGGCCCACGCCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 900106388 1:983011-983033 TCTGGAGACAGCTGCCATGAGGG 0: 1
1: 0
2: 1
3: 23
4: 259
900106382_900106394 18 Left 900106382 1:982992-983014 CCTCGGGCCCACGCCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 900106394 1:983033-983055 GCCGCGGGCGACTGCCCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 140
900106382_900106389 2 Left 900106382 1:982992-983014 CCTCGGGCCCACGCCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 900106389 1:983017-983039 GACAGCTGCCATGAGGGCCGCGG 0: 1
1: 0
2: 2
3: 17
4: 165
900106382_900106387 -5 Left 900106382 1:982992-983014 CCTCGGGCCCACGCCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 900106387 1:983010-983032 CTCTGGAGACAGCTGCCATGAGG 0: 1
1: 0
2: 1
3: 29
4: 273
900106382_900106396 19 Left 900106382 1:982992-983014 CCTCGGGCCCACGCCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 900106396 1:983034-983056 CCGCGGGCGACTGCCCGGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 140
900106382_900106392 14 Left 900106382 1:982992-983014 CCTCGGGCCCACGCCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 900106392 1:983029-983051 GAGGGCCGCGGGCGACTGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 149
900106382_900106390 3 Left 900106382 1:982992-983014 CCTCGGGCCCACGCCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 900106390 1:983018-983040 ACAGCTGCCATGAGGGCCGCGGG 0: 1
1: 0
2: 0
3: 36
4: 375
900106382_900106393 15 Left 900106382 1:982992-983014 CCTCGGGCCCACGCCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 900106393 1:983030-983052 AGGGCCGCGGGCGACTGCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 164
900106382_900106397 24 Left 900106382 1:982992-983014 CCTCGGGCCCACGCCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 900106397 1:983039-983061 GGCGACTGCCCGGGCGGGTGAGG 0: 1
1: 0
2: 0
3: 25
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900106382 Original CRISPR CAGAGCACGGCGTGGGCCCG AGG (reversed) Intergenic
900091895 1:924311-924333 TAGCGGACGGCGTGGGCGCGCGG + Intergenic
900106382 1:982992-983014 CAGAGCACGGCGTGGGCCCGAGG - Intergenic
900339592 1:2181670-2181692 CAGAGAACGGGCTGGGCCAGGGG + Intronic
900349514 1:2228083-2228105 CAGAGCGCGGCGGCGGCGCGGGG - Intergenic
900690847 1:3979424-3979446 CAGAGCACCGAGAGGGCCTGGGG - Intergenic
901807943 1:11749652-11749674 GAGAGGAGTGCGTGGGCCCGGGG + Intronic
902870730 1:19312245-19312267 CAGCGCGCGGCGTGGGGGCGGGG + Intergenic
904472882 1:30746722-30746744 CAGAGCTCGGCTGGGGCCTGGGG - Intronic
904768996 1:32870694-32870716 CGGAGCGCGGCGCGGGCGCGGGG + Exonic
904869633 1:33608348-33608370 CAGTGCACGGGGTGGGCCCAGGG + Intronic
905342784 1:37290693-37290715 CAGAGCCCGGGGTGGGCAGGGGG - Intergenic
907307988 1:53524218-53524240 GTGAGCGCGGAGTGGGCCCGCGG - Intronic
907540879 1:55214901-55214923 CCGGGCCCGGCGGGGGCCCGCGG - Exonic
915147407 1:153803205-153803227 CAGAGCTCAGCTTGGGCACGAGG - Intergenic
915224962 1:154405438-154405460 CCGAGCGCGGCGCGGGGCCGAGG + Exonic
917748572 1:178034616-178034638 CAGAGCACTGCCTGAGCCCAGGG + Intergenic
921060368 1:211579417-211579439 CGGAGCCGGGCGTGGGCCGGGGG + Intergenic
922727085 1:227927591-227927613 CAGAGCACGGCTAGGGCGGGAGG + Intronic
924926821 1:248691856-248691878 CACAGCGCGCTGTGGGCCCGCGG - Intergenic
1067022805 10:42816511-42816533 CAGAGCACACTGTGGGCCTGTGG + Intronic
1067223054 10:44357592-44357614 CAGAGCCCCGGGTGGGACCGGGG - Intergenic
1070799048 10:79234301-79234323 CAGGGAAGGGCGTGGGCACGAGG - Intronic
1071291886 10:84194684-84194706 CGGAGCATGCCCTGGGCCCGCGG - Exonic
1073207866 10:101778272-101778294 CAGAGCAGGGAGTAGGCCCCAGG + Intronic
1074182900 10:111078805-111078827 CCGAGCGCAGCGCGGGCCCGGGG + Exonic
1075461404 10:122618875-122618897 CAGAGCACTGCCTGTGCCCCAGG + Intronic
1076464061 10:130666398-130666420 CAGAGGGCGGGGTGGACCCGTGG + Intergenic
1076720225 10:132389204-132389226 CAGAACCCGGCGTGGGCCTTGGG + Intergenic
1076906268 10:133363091-133363113 CAGAGCTGGGCCTGGGCGCGGGG + Intronic
1077119167 11:898909-898931 CTGAGCACGGCCAGGACCCGTGG - Intronic
1077421088 11:2450341-2450363 GAGAGCATGGTGTCGGCCCGGGG + Intronic
1077517189 11:3009033-3009055 CAGAGGTCGGTGTGGGCCTGAGG - Intronic
1083308022 11:61770816-61770838 CAGAGCCAGGACTGGGCCCGGGG + Intronic
1083944202 11:65915136-65915158 CAGAGCACAGTGTGGGCATGGGG + Intergenic
1084008847 11:66336715-66336737 CAGAGCATGGCTGGGGCCTGTGG - Intronic
1084148969 11:67279281-67279303 CAGAGCAGGGCTTGGGCCTCTGG - Intronic
1085128029 11:74015161-74015183 CAGGGCACGGCCTGGGTCTGAGG + Intronic
1085196845 11:74677802-74677824 CAGAGCCCAGCGTGAGCCCAGGG - Intergenic
1086917499 11:92547676-92547698 CAGAGCAGAGTGTGGGCCTGGGG - Intronic
1089398882 11:118153089-118153111 GGGGGCACGGCGTGGTCCCGGGG - Intergenic
1091351573 11:134901752-134901774 CAGAGCACGGAGCAGGCCAGCGG - Intergenic
1092247675 12:6872663-6872685 CAGAGCACTGATGGGGCCCGGGG - Exonic
1097053157 12:56235597-56235619 CAGAGAAGGACCTGGGCCCGGGG + Exonic
1097655955 12:62363680-62363702 GAGAGCACGGGGTGGGGACGCGG - Intronic
1100407058 12:94280878-94280900 CAGAGCAAGGAGGGGGCCTGGGG + Intronic
1100867046 12:98868212-98868234 CAGAACACACCCTGGGCCCGAGG + Intronic
1103659242 12:122500571-122500593 CAGCGCCAGGCGTGGGGCCGGGG - Exonic
1104925575 12:132312518-132312540 CAGAGGACAGCGTGGGCATGGGG - Intronic
1113681937 13:112250569-112250591 CAGAGCAAGGCATGGACCCAGGG + Intergenic
1120920800 14:89753880-89753902 CTGAGCACGGGGTGGGGGCGGGG - Intergenic
1122436696 14:101705945-101705967 CGGGGCACGGCGTGGGCCCAGGG - Intergenic
1122685740 14:103505201-103505223 AAGAGCACTGCTTGGGCCTGAGG + Intergenic
1122697528 14:103563187-103563209 CAGAACAGGGAGTGGCCCCGAGG - Intronic
1122795973 14:104206413-104206435 CAGAGCACCACGTGGGGCCTGGG + Intergenic
1123110274 14:105863937-105863959 CTGAGCCCGGGGAGGGCCCGGGG + Intergenic
1125918499 15:43510424-43510446 CAGAGCACTCCCAGGGCCCGGGG + Intronic
1126112089 15:45181267-45181289 CAGCCCAGGGCGTGGGGCCGGGG - Intronic
1126503892 15:49380347-49380369 CAGAGCACCACGTGGGCTCTTGG - Intronic
1127588046 15:60397156-60397178 GAGAGAAGGGCGTGGCCCCGGGG - Intronic
1128466619 15:67918185-67918207 CCGAGCAAGGCCTGGGCCAGGGG - Intergenic
1130330582 15:82919051-82919073 CAGAGCAGGGCCTGGGCCACAGG + Intronic
1132843978 16:1991568-1991590 CTCTGCACCGCGTGGGCCCGTGG - Intronic
1133284569 16:4684536-4684558 CAGAGGACGGCGGGGGCGCCAGG + Intronic
1134079096 16:11312793-11312815 CAGAGAAAGGTGTGGGCACGTGG - Intronic
1136368553 16:29821322-29821344 CAGAGCACTGGGTCGGCCCTCGG + Intronic
1136419325 16:30122481-30122503 CAGAGCACACGGTGGGGCCGGGG + Intronic
1136451693 16:30357460-30357482 CAGAGGATGGCGTTGGCCTGGGG - Exonic
1139365399 16:66429398-66429420 CAGAGCAGGGCATAGGCCCAGGG + Intronic
1139956382 16:70695058-70695080 CAGAGCAGGGCTGGGGCACGTGG - Intronic
1140224241 16:73065983-73066005 CAGGGCAGGGCGTGGCCCCACGG + Intergenic
1141659082 16:85431967-85431989 CACAGCACGGCATGGGCGCCTGG + Intergenic
1141666162 16:85466411-85466433 CAGAGCCTGGCCTGGGCCCACGG - Intergenic
1142131495 16:88433478-88433500 CAGAGAACGGGGTGAGCCCAGGG + Exonic
1142289516 16:89187060-89187082 CAGAGCACCTTGTGTGCCCGGGG - Intronic
1143419251 17:6776204-6776226 CAGAGCAAGGCGCAGACCCGGGG + Exonic
1146255850 17:31391374-31391396 CAGAGGAAGGGGTGGGCTCGGGG + Intergenic
1146936117 17:36813633-36813655 GAGAGCACAGCGTGGGGCTGGGG - Intergenic
1147331801 17:39703737-39703759 CAGACCAGGGCCTGGGCCCAGGG - Intronic
1148183151 17:45620829-45620851 CAGAGCGCGGGGTGGGCTCAGGG - Intergenic
1148265699 17:46224862-46224884 CAGAGCGCGGGGTGGGCTCAGGG + Intronic
1152014535 17:77741803-77741825 CAGAGCGAGGGGTGGGCCCAGGG - Intergenic
1152017548 17:77761534-77761556 CAGAGCCCTGCATGGGCCTGGGG + Intergenic
1152482035 17:80560705-80560727 CAGAGCACCGGGTGGGCATGAGG - Intronic
1156475870 18:37405035-37405057 CAGAGCAGAGAGTGGCCCCGTGG - Intronic
1159971990 18:74666335-74666357 CAGAGAAGTGGGTGGGCCCGAGG + Intronic
1160086293 18:75780319-75780341 CAGTGCAGGGCGTGGTCCTGGGG - Intergenic
1160543416 18:79637946-79637968 CGAGGCACGGCCTGGGCCCGGGG + Intergenic
1160995936 19:1881891-1881913 CAGGGGGCGGCATGGGCCCGGGG + Intronic
1163848195 19:19649364-19649386 CAGAGCAGGGCGGAGGCCAGAGG - Intronic
1164485823 19:28654967-28654989 TAGAGCACTGCATGGGCTCGGGG - Intergenic
1165129515 19:33622965-33622987 CAGAGCTCGGCTCGGTCCCGCGG - Intronic
1166119494 19:40677186-40677208 CAGAGCACAGAGTGGGCACAGGG - Intronic
1167001108 19:46746250-46746272 CCGGGCCCGCCGTGGGCCCGGGG + Exonic
925157538 2:1658900-1658922 CAGGGCAAGGCATGGGCCGGAGG - Intronic
925177699 2:1796872-1796894 CAGGGCACGGCCTGGGCAAGCGG - Intronic
927215850 2:20667441-20667463 CGGCGCGCGGCGCGGGCCCGGGG - Exonic
935371837 2:102355835-102355857 CCGCGGACGGCGTGGGCCCCAGG - Intronic
937298820 2:120826059-120826081 CAGAGCAGAGCGTTGGGCCGTGG + Intronic
944780900 2:203015413-203015435 CAGGGCAGGGCGTGGGGGCGGGG - Intronic
946411872 2:219519432-219519454 CAGAGGAGGGTGTGGGCCAGAGG - Intronic
948339507 2:237238149-237238171 CAGAGCACGTCCTGGGCCACCGG - Intergenic
948505147 2:238423272-238423294 CAGAGGACAGTGTGGGCCCTGGG - Intergenic
948747351 2:240106280-240106302 CAGAGCACTGCCTGGGCTCCAGG + Intergenic
1175920023 20:62446330-62446352 GAGGGCAGGGCGGGGGCCCGGGG + Intergenic
1179809068 21:43858875-43858897 CAGAGTAGGGTGTGGGCCCCGGG + Intergenic
1180066696 21:45415943-45415965 CAGAACACTGCGTGGGCCCTCGG + Intronic
1181602539 22:23960953-23960975 CAGAGCAGGGCGGGGGCCTGGGG + Intronic
1181605975 22:23980354-23980376 CAGAGCAGGGCGGGGGCCTGGGG - Intronic
1182141443 22:27962846-27962868 CAGAGCAGGGTGTGGGCCCCAGG + Intergenic
1182429539 22:30291701-30291723 CAGAGCAGGGCGTGCTCCCTAGG - Intronic
950480554 3:13241114-13241136 CAGAGCCTGCAGTGGGCCCGTGG - Intergenic
953998392 3:47537616-47537638 AAGAGCACAGCGTGGAGCCGGGG + Intergenic
954794372 3:53154104-53154126 CAGAGAAAGGCTTTGGCCCGAGG + Intergenic
961457273 3:127030467-127030489 CAGAACAGGGCGAGGGCCCTGGG - Intronic
962350272 3:134651201-134651223 CAGGTCAAGGCTTGGGCCCGGGG - Intronic
966975902 3:185082962-185082984 AAAAGCTCGGCGTGGGTCCGAGG + Exonic
968466525 4:754324-754346 AAGAGCACAGCGCGTGCCCGAGG - Intronic
968607124 4:1540811-1540833 CAGGGCCCGGGGTGGGGCCGGGG - Intergenic
969228938 4:5816467-5816489 CAGAGGACAGCCTGGGCCCCAGG + Intronic
976068350 4:81215085-81215107 CGGTGCGCAGCGTGGGCCCGGGG + Exonic
979619559 4:122783581-122783603 CACAGCAAGGCGAGGGCCCTGGG - Intergenic
983388926 4:167103278-167103300 CAGAGCACCAAGTGGGCCCTTGG + Intronic
985652618 5:1113897-1113919 CAGAGCTCAGGGTGGGCACGAGG + Intergenic
985849025 5:2374952-2374974 CAGAGCACAGCAGGGGCCCACGG + Intergenic
988702782 5:33691966-33691988 CAGAGAAGGGCCTGGGCCAGTGG - Intronic
997248281 5:132369932-132369954 CAGAGCGCGGCCTGGGGTCGGGG - Exonic
1001716388 5:173819721-173819743 AAGAGCATGGCATGGGCCCTGGG + Intergenic
1002180349 5:177428033-177428055 CAGAGCACTTGGTGGGCACGGGG - Intronic
1002902242 6:1418740-1418762 CAGAGCACGAGGCGAGCCCGGGG - Intergenic
1003425438 6:5995530-5995552 CAGAGCCCTGCCTGGGCCCGAGG - Intergenic
1005124414 6:22429981-22430003 CAGAGCTCTGCGTGGGCTCACGG - Intergenic
1011476390 6:87752877-87752899 CAGAGCATGGCCAGAGCCCGGGG - Intergenic
1017406781 6:154127877-154127899 CAGAGCACTGGGTGAGCCTGGGG - Intronic
1019421946 7:954693-954715 CAGAGCGCAGCGTGCGCCCCGGG - Intronic
1023943791 7:44787302-44787324 CAGAGCCCAGCATGGGCCTGAGG - Intergenic
1025188785 7:56881305-56881327 CAGAGCAGGGAGTGGGACAGAGG + Intergenic
1025683150 7:63695615-63695637 CAGAGCAGGGAGTGGGACAGAGG - Intergenic
1027232669 7:76281752-76281774 CAGAGCCGGGCTCGGGCCCGGGG - Exonic
1034374132 7:150628215-150628237 AGGAGCACGGCGTGGGGCCCTGG + Exonic
1035225702 7:157430991-157431013 CAGAGCCCGGGGTGGGCTTGTGG + Intergenic
1035856772 8:2984363-2984385 CAGAGCAAGACGTGGTCTCGGGG - Intronic
1043643036 8:82481432-82481454 CAGAGCACGATGAGGGCCCCAGG + Intergenic
1048985050 8:139730722-139730744 CACAGCACGGCTGGGGCCCCAGG + Exonic
1049247766 8:141571841-141571863 CAGAGCAGAGCGTGGGCTCCAGG - Intergenic
1049329634 8:142043314-142043336 CAGAGCAAGGCAGGTGCCCGAGG + Intergenic
1049419535 8:142510734-142510756 CAGAGCGCGGCATGGGCGCCCGG + Intronic
1050357061 9:4793243-4793265 CGGCGCGCGGCGTGGGCGCGGGG + Intronic
1050654363 9:7809980-7810002 CAGAGCCTGGCATGGGCCCAGGG + Intronic
1053286532 9:36852851-36852873 CAGAGCAGGGCCTGGGACCCTGG + Intronic
1059644335 9:116249660-116249682 CAGAGCACCGGGTGGGGCTGAGG + Intronic
1060480366 9:124013721-124013743 AGGAGCCCGGCCTGGGCCCGTGG + Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061139119 9:128753647-128753669 CAGGGCAAGGCCTGGGGCCGGGG - Intronic
1061805599 9:133136029-133136051 CAGACCACAGAGAGGGCCCGGGG + Intronic
1062444422 9:136587711-136587733 CACAGCCGGGAGTGGGCCCGAGG - Intergenic
1062531508 9:137003028-137003050 CAGAGCTCAGCCTGGGCCTGCGG + Intergenic
1062544019 9:137053765-137053787 CAGAGCACGGTGGGGGTCCCGGG + Intronic
1187569870 X:20489934-20489956 CAGAACATGGGGTGGGCCAGTGG + Intergenic
1199990876 X:152987303-152987325 CAGAGCACAGTGGGGGCCCCAGG + Intergenic