ID: 900109126

View in Genome Browser
Species Human (GRCh38)
Location 1:998263-998285
Sequence AACCTCCCTTACCGGGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900109111_900109126 6 Left 900109111 1:998234-998256 CCCCCAGTCCTCACCCACTGGGG No data
Right 900109126 1:998263-998285 AACCTCCCTTACCGGGGCAGGGG No data
900109115_900109126 3 Left 900109115 1:998237-998259 CCAGTCCTCACCCACTGGGGAGG No data
Right 900109126 1:998263-998285 AACCTCCCTTACCGGGGCAGGGG No data
900109119_900109126 -7 Left 900109119 1:998247-998269 CCCACTGGGGAGGCGGAACCTCC No data
Right 900109126 1:998263-998285 AACCTCCCTTACCGGGGCAGGGG No data
900109114_900109126 4 Left 900109114 1:998236-998258 CCCAGTCCTCACCCACTGGGGAG No data
Right 900109126 1:998263-998285 AACCTCCCTTACCGGGGCAGGGG No data
900109120_900109126 -8 Left 900109120 1:998248-998270 CCACTGGGGAGGCGGAACCTCCC No data
Right 900109126 1:998263-998285 AACCTCCCTTACCGGGGCAGGGG No data
900109118_900109126 -2 Left 900109118 1:998242-998264 CCTCACCCACTGGGGAGGCGGAA No data
Right 900109126 1:998263-998285 AACCTCCCTTACCGGGGCAGGGG No data
900109113_900109126 5 Left 900109113 1:998235-998257 CCCCAGTCCTCACCCACTGGGGA No data
Right 900109126 1:998263-998285 AACCTCCCTTACCGGGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900109126 Original CRISPR AACCTCCCTTACCGGGGCAG GGG Intergenic