ID: 900110683

View in Genome Browser
Species Human (GRCh38)
Location 1:1004250-1004272
Sequence GTGTGTGAGGGGGGTGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900110683_900110691 17 Left 900110683 1:1004250-1004272 CCCTCAACACCCCCCTCACACAC No data
Right 900110691 1:1004290-1004312 GACCTGTAGCCACCCCCTGCAGG No data
900110683_900110693 20 Left 900110683 1:1004250-1004272 CCCTCAACACCCCCCTCACACAC No data
Right 900110693 1:1004293-1004315 CTGTAGCCACCCCCTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900110683 Original CRISPR GTGTGTGAGGGGGGTGTTGA GGG (reversed) Intergenic
No off target data available for this crispr