ID: 900112293

View in Genome Browser
Species Human (GRCh38)
Location 1:1013495-1013517
Sequence GTTCGCTGCCTCTCAGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900112293_900112296 10 Left 900112293 1:1013495-1013517 CCGGCGGCTGAGAGGCAGCGAAC 0: 1
1: 0
2: 1
3: 14
4: 96
Right 900112296 1:1013528-1013550 CAGTACAGGAGCTTGTGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 119
900112293_900112294 -4 Left 900112293 1:1013495-1013517 CCGGCGGCTGAGAGGCAGCGAAC 0: 1
1: 0
2: 1
3: 14
4: 96
Right 900112294 1:1013514-1013536 GAACTCATCTTTGCCAGTACAGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900112293 Original CRISPR GTTCGCTGCCTCTCAGCCGC CGG (reversed) Exonic
900112293 1:1013495-1013517 GTTCGCTGCCTCTCAGCCGCCGG - Exonic
902622747 1:17659949-17659971 TTTCCCTGTCTCTCAGCTGCAGG - Intronic
903832248 1:26182367-26182389 GTGCCCTCCTTCTCAGCCGCTGG - Exonic
904684586 1:32251129-32251151 GACCCCTGCCTCTCAGCCCCTGG - Intergenic
905854002 1:41295281-41295303 GTTCCCTGACTCTCACCCTCGGG - Intergenic
914125462 1:144813781-144813803 GCTGGCCGCCTCTCCGCCGCCGG + Intergenic
914393063 1:147239264-147239286 GTTAGCCATCTCTCAGCCGCTGG + Intronic
921421864 1:214957863-214957885 GTTCACTGCCTCTCAGCTGTGGG + Intergenic
921872028 1:220151716-220151738 GGTCCTTGCCTCTCAGCTGCTGG - Exonic
922451796 1:225743563-225743585 TTCCTCTGCCTCTCAGCCTCCGG - Intergenic
1077848501 11:6051171-6051193 GTTCCCTGCATCTCAACCACAGG - Intergenic
1079244765 11:18744005-18744027 GTTCGCTGCCTCACAGTTCCTGG - Exonic
1082133593 11:48520956-48520978 GCTCTCTGCCTCTGAGCCTCAGG + Intergenic
1082139082 11:48585741-48585763 GATCTCTGCCTCTGAGCCTCAGG + Intergenic
1082142170 11:48622045-48622067 GCTCTCTGCCTCTGAGCCTCAGG + Intergenic
1082566615 11:54687348-54687370 GCTCTCTGCCTCTGAGCCTCGGG + Intergenic
1082569333 11:54718868-54718890 GCTCTCTGCCTCTGAGCCTCAGG + Intergenic
1082612192 11:55313881-55313903 GCTCTCTGCCTCTGAGCCTCAGG + Intergenic
1082617881 11:55383843-55383865 GCTCTCTGCCTCTGAGCCTCAGG + Intergenic
1082621298 11:55425609-55425631 GCTCTCTGCCTCTGAGCCTCAGG + Intergenic
1082622106 11:55436254-55436276 GTTCTCTGCCTCTGAGCCTCAGG + Intergenic
1082624867 11:55471425-55471447 GATCTCTGCCTCTGAGCCTCAGG + Intergenic
1083658198 11:64240390-64240412 TTTAGCTGCCTCTCAACTGCAGG + Intergenic
1084501806 11:69539628-69539650 GCCCACAGCCTCTCAGCCGCAGG + Intergenic
1085077630 11:73605800-73605822 GTTCCATGCCTCTCAGCTTCTGG - Intergenic
1085528006 11:77175283-77175305 GAGCCCTGCCTCTCAGCCTCGGG + Intronic
1089382649 11:118047102-118047124 GGTGGCTGACTCTCAGCAGCCGG - Intergenic
1090305247 11:125685780-125685802 GTTAGCCGCCTCTCGGGCGCTGG + Intergenic
1098683082 12:73382565-73382587 TTTTGCTGCCTGTCAGCTGCAGG + Intergenic
1099737030 12:86581464-86581486 GTTCGTTAACTCTCAGCTGCAGG - Intronic
1100483629 12:95003732-95003754 GGAAGCTGCCACTCAGCCGCAGG + Exonic
1101441067 12:104704548-104704570 TTTCTCTGCCTCTCAGCTGGAGG + Intronic
1102347227 12:112167974-112167996 GTTCCCTCCCTCTCACCTGCTGG + Intronic
1103810515 12:123609987-123610009 TTTCTCTGCCACTCAGACGCAGG + Exonic
1106013768 13:25848963-25848985 GTGCGCTTCCTCTGAGCCACTGG + Intronic
1114622766 14:24107150-24107172 GTTCCCTGCCTCTTAGCTGGAGG - Intronic
1116641312 14:47467000-47467022 GTTCACTGCCTCTGAGCTGGTGG - Intronic
1117501575 14:56357619-56357641 GTTGGGTGCCTCTCAGCCGTGGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119853110 14:77880158-77880180 CTTCCCTACCTGTCAGCCGCTGG + Intronic
1122351391 14:101095355-101095377 GTTAGCTGTCTCTTGGCCGCCGG + Intergenic
1202882157 14_KI270722v1_random:70740-70762 GTTAGCAGTCTCTCAGTCGCTGG - Intergenic
1124222272 15:27861207-27861229 GTTAGCTGGCTCTCAGCCTCAGG + Intronic
1131638494 15:94263366-94263388 GTTAGCTTCCTTTCAGCCTCTGG + Intronic
1133309394 16:4834173-4834195 GTTCGCTGCCTGACATCTGCAGG - Intronic
1134190776 16:12119673-12119695 GTGCGCTGCCTCCCAGGAGCCGG + Intronic
1135994721 16:27239262-27239284 GATCGCTGCTTCCCAGCCTCAGG + Intronic
1143196340 17:5078800-5078822 GTTTGGTGCCTGTCAGCCGTGGG + Intronic
1144688131 17:17240245-17240267 GCTTGCTGCCTTTCAGCAGCTGG - Intergenic
1145248423 17:21284601-21284623 GTCCTCTGCCTATCAGACGCCGG - Intergenic
1150774656 17:68069772-68069794 GCTAGCTGTCTCTCAGTCGCCGG - Intergenic
1158165072 18:54531171-54531193 GTTAGCTGCCTCTCGGTCGCCGG - Intergenic
1158591973 18:58785452-58785474 GTTGGCAGCATCTCAGCCGCAGG - Intergenic
1161059430 19:2207688-2207710 TCTCGCTGCGCCTCAGCCGCAGG + Intronic
1162161116 19:8717870-8717892 GTTCCTTCCCTCTCAGCCTCTGG - Intergenic
1164220189 19:23186341-23186363 GTTAGCTGTCTCTTGGCCGCTGG - Intergenic
1166809430 19:45506879-45506901 GGTCGCTGACTCACAGCCGCAGG - Intronic
1167653830 19:50750047-50750069 GCTAGCTGTCTCTCAGTCGCTGG + Intergenic
1167706208 19:51082684-51082706 TGTCTCTGCCTCTCAGCCCCCGG - Intronic
1202693081 1_KI270712v1_random:105007-105029 GCTGGCCGCCTCTCCGCCGCCGG - Intergenic
934237563 2:90245362-90245384 GCTGGCCGCCTCTCCGCCGCTGG + Intergenic
934237568 2:90245380-90245402 GCTGGCCGCCTCTCCGCCGCTGG + Intergenic
934460003 2:94208726-94208748 GCTGGCCGCCTCTCCGCCGCTGG + Intergenic
934652022 2:96098240-96098262 GTTCCCTGCCTCCCAGCCCAGGG + Intergenic
941084721 2:161104098-161104120 GTTACCTGCCTCTCAGCCCTGGG + Intergenic
942278584 2:174340511-174340533 GTGCGCTGCCTCTGCCCCGCGGG + Intergenic
944351663 2:198734589-198734611 GTTCCCTGCATCTCATCCCCAGG - Intergenic
944580268 2:201126104-201126126 GTTAGCTGTCTCTTGGCCGCCGG - Intronic
1170368357 20:15621012-15621034 GTTCACTGCCTCTCTCCCCCAGG - Intronic
1171778372 20:29393232-29393254 GTTAGCTGCCTCTCGGTCGCCGG - Intergenic
1171820141 20:29828508-29828530 TTTAGCTGCCTCTCGGTCGCTGG - Intergenic
1171822431 20:29865639-29865661 GTTAGCTGCCTCTCGGTCGCTGG - Intergenic
1179728712 21:43355281-43355303 ATGGGCTGCCACTCAGCCGCGGG + Intergenic
1180324139 22:11353196-11353218 GTTAGCTGCCTCACGGTCGCTGG - Intergenic
1182028350 22:27137927-27137949 GCTGGCTGCTTCTCAGCAGCTGG + Intergenic
1183643977 22:39111741-39111763 ATTAGCTGCCTCTCGGTCGCCGG + Intergenic
1183969803 22:41468474-41468496 GTTTCCCGCCTCTCAGGCGCGGG - Intronic
954579098 3:51693390-51693412 ATTCCCTGCCTTTCAGCCGGTGG + Intronic
955462191 3:59195386-59195408 GTTCTCTACCTCCCAGCCTCTGG - Intergenic
962171418 3:133105248-133105270 GTTAGCTGGCTGTCAGCGGCAGG + Intronic
967194001 3:187010985-187011007 GTTAGCTGTCTCTTGGCCGCCGG + Intronic
969645998 4:8429247-8429269 GTTAGCTGTCTCTTGGCCGCTGG - Intronic
971310411 4:25521337-25521359 GTTAGCTGCCTCTCGGTCGCCGG + Intergenic
972574001 4:40335240-40335262 GTTCCCGGCTTCTCAGCCACTGG + Intergenic
975468152 4:74733252-74733274 GTTCTCTGCCTCTCTGCCTGAGG + Intergenic
978432774 4:108650863-108650885 TTCCGCTGACTCTCAGCCCCGGG + Intronic
981100578 4:140825567-140825589 GTTAGCTGCACCTCAGCTGCAGG + Intergenic
987108662 5:14664728-14664750 GGCCGCAGCCTCTCAGCCGCCGG - Exonic
1003345167 6:5260519-5260541 GGTCCTTGCCTCGCAGCCGCCGG + Intronic
1007275580 6:40671192-40671214 GTGCGCCTCCTCTCAGCAGCCGG + Intergenic
1013526835 6:110982134-110982156 GTGCGCTGGGTCTCAGCCCCGGG + Intronic
1016566274 6:145458393-145458415 GTTCTCTGCCTGTGAGCCCCTGG - Intergenic
1017286511 6:152682571-152682593 GTTAGCCGTCTCTCAGTCGCCGG + Intergenic
1019699729 7:2468831-2468853 GTTCTCCTCCTCTCAGCCCCTGG + Intergenic
1024543720 7:50500063-50500085 GGTTGCTGCCTCTCAGCCCTAGG + Intronic
1029640687 7:101817204-101817226 GTACGCTGCCTCCCCGCCGCCGG + Intronic
1033238734 7:139659423-139659445 GTTCCCTGGCCCTGAGCCGCGGG + Intronic
1037281587 8:17247376-17247398 GGTCGCTGCCTCTCCACCGGAGG + Intronic
1040108109 8:43551391-43551413 GTTAGCTGCCTCTCGGTCGCCGG - Intergenic
1041810420 8:61902484-61902506 GATCGATTCCTCTCAGCCACAGG - Intergenic
1043504967 8:80893704-80893726 ATTCACAGCATCTCAGCCGCAGG + Intergenic
1047334251 8:123920839-123920861 TTTCCCTTCCTCTCAGCCCCTGG + Intronic
1056215298 9:84400691-84400713 CTTGGCTCCCTCTCAGCTGCTGG - Intergenic
1057128891 9:92639902-92639924 GCTGGCTGCCTCTCAGCAGTGGG - Intronic
1060731307 9:126038734-126038756 TCTCTCTGACTCTCAGCCGCTGG - Intergenic
1061219633 9:129242732-129242754 CCTCCCTGCCTCTCAGCCCCTGG - Intergenic
1062156501 9:135051786-135051808 CTTTGCTTCCTCTCAGCAGCCGG - Intergenic
1062170184 9:135130585-135130607 GTTCTCTGCCTCACAGGAGCCGG + Intergenic
1203375491 Un_KI270442v1:372264-372286 GTTAGCTGCCTCTCAGTCGCTGG - Intergenic
1189806629 X:44741787-44741809 GTTCACTGCCACTCAGCCTGAGG + Intergenic
1190703130 X:53003011-53003033 GTTCCCTGCCAATCAGCCTCTGG + Intergenic
1201066538 Y:10101339-10101361 GTTAGCTGCCTCTCCGTCGCTGG + Intergenic