ID: 900112336

View in Genome Browser
Species Human (GRCh38)
Location 1:1013693-1013715
Sequence TCAGGAGCACACTTAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 172}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900112336_900112347 18 Left 900112336 1:1013693-1013715 CCAGGTTCTAAGTGTGCTCCTGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 900112347 1:1013734-1013756 ATCCTCAGGGTGGGGCACAGAGG 0: 1
1: 0
2: 4
3: 53
4: 672
900112336_900112339 4 Left 900112336 1:1013693-1013715 CCAGGTTCTAAGTGTGCTCCTGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 900112339 1:1013720-1013742 AGGTCACCCCTGAGATCCTCAGG 0: 1
1: 0
2: 1
3: 14
4: 147
900112336_900112342 9 Left 900112336 1:1013693-1013715 CCAGGTTCTAAGTGTGCTCCTGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 900112342 1:1013725-1013747 ACCCCTGAGATCCTCAGGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 159
900112336_900112348 19 Left 900112336 1:1013693-1013715 CCAGGTTCTAAGTGTGCTCCTGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 900112348 1:1013735-1013757 TCCTCAGGGTGGGGCACAGAGGG 0: 1
1: 0
2: 3
3: 39
4: 331
900112336_900112340 5 Left 900112336 1:1013693-1013715 CCAGGTTCTAAGTGTGCTCCTGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 900112340 1:1013721-1013743 GGTCACCCCTGAGATCCTCAGGG 0: 1
1: 0
2: 0
3: 18
4: 123
900112336_900112341 8 Left 900112336 1:1013693-1013715 CCAGGTTCTAAGTGTGCTCCTGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 900112341 1:1013724-1013746 CACCCCTGAGATCCTCAGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 197
900112336_900112350 20 Left 900112336 1:1013693-1013715 CCAGGTTCTAAGTGTGCTCCTGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 900112350 1:1013736-1013758 CCTCAGGGTGGGGCACAGAGGGG 0: 1
1: 1
2: 7
3: 45
4: 479
900112336_900112344 10 Left 900112336 1:1013693-1013715 CCAGGTTCTAAGTGTGCTCCTGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 900112344 1:1013726-1013748 CCCCTGAGATCCTCAGGGTGGGG 0: 1
1: 0
2: 3
3: 25
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900112336 Original CRISPR TCAGGAGCACACTTAGAACC TGG (reversed) Intronic
900112336 1:1013693-1013715 TCAGGAGCACACTTAGAACCTGG - Intronic
902086127 1:13864033-13864055 GAAGGACCAGACTTAGAACCTGG + Intergenic
903479846 1:23645170-23645192 TCAGGAGCTCCCTGAGAACCGGG + Intergenic
904872209 1:33625796-33625818 ACAGGACCATGCTTAGAACCTGG + Intronic
904903376 1:33875420-33875442 TCTGGAGAACACTTAGAAATAGG - Intronic
908674272 1:66584843-66584865 TCAGGAAAACACTAAGCACCAGG - Intronic
913499436 1:119457691-119457713 CCAGGAGCACAGTTATCACCAGG - Intergenic
913507340 1:119529411-119529433 CCAGGAGCACAGTTATCACCAGG - Intergenic
913514524 1:119592240-119592262 CCAGGAGCACAGTTATCACCAGG - Intergenic
916296483 1:163226012-163226034 GCAGGAGAATACTTTGAACCCGG - Intronic
918175421 1:182040214-182040236 GCAGGAGCATAGTTTGAACCTGG + Intergenic
918427154 1:184422253-184422275 TCAGGAACACACCTAGGACAAGG - Intronic
920931680 1:210394611-210394633 TCAGAGGCACAGTGAGAACCCGG - Intronic
922108118 1:222530234-222530256 TCAGGAGGCCACAGAGAACCTGG - Intronic
924403873 1:243720981-243721003 TCAGAAGCAGCCTCAGAACCTGG + Intronic
1067983344 10:51113253-51113275 TCAGTAGCACAGGTAGAAACAGG + Intronic
1074381851 10:112987580-112987602 TCATCATCACACTTAGAAACTGG - Intronic
1074588994 10:114794792-114794814 TCAGGAGTACAAGTAAAACCAGG + Intergenic
1075394633 10:122118106-122118128 GCAGGAGAACAGTTTGAACCCGG - Intronic
1082438739 11:52778999-52779021 ACAGGAGCATTCTTAGAAACTGG + Intergenic
1084799107 11:71529836-71529858 GCAGGAGAACCCTTTGAACCTGG + Intronic
1085462721 11:76704210-76704232 TCAGGAGCAGACTGAGGAACTGG - Intergenic
1090433773 11:126668841-126668863 TTAGCAGCACACTCAGAGCCAGG - Intronic
1091469363 12:713451-713473 TCAGGAGGACACTGAGCACAAGG - Intergenic
1092531326 12:9348065-9348087 TGAAAAGCACACTTAGAAGCTGG + Intergenic
1092993492 12:13926107-13926129 TCTGGGGCACACTTAGACCAAGG + Intronic
1094094028 12:26683590-26683612 ACAGAAGCACACATAGAACAAGG + Intronic
1095040131 12:37432323-37432345 GCAGGAGAACACTTTGATCCTGG - Intergenic
1097214734 12:57401889-57401911 GCAGGAGATCACTTAGACCCGGG + Intronic
1103187380 12:118970915-118970937 TCAGGAGCCTACATAGAATCTGG + Intergenic
1104798998 12:131540606-131540628 TCAAGAACTCACTAAGAACCAGG + Intergenic
1105417672 13:20227424-20227446 GCAGGAGGACACTCTGAACCAGG - Intronic
1106140845 13:27010104-27010126 TAAGGAGCATGCTTAGAATCTGG - Intergenic
1106567199 13:30896542-30896564 TCAGGCACACACTTCGAACTTGG - Intergenic
1108344873 13:49535646-49535668 ACAGGAGGACCCTTAGAACAAGG - Intronic
1108417409 13:50212292-50212314 GCAGTTGCACAATTAGAACCTGG - Intronic
1115205508 14:30899519-30899541 TGAGGAGGACTTTTAGAACCAGG - Intronic
1117956615 14:61128175-61128197 TCAGCAGCAGACTTAGATCCTGG - Intergenic
1120262090 14:82198769-82198791 TCCAGACCACACTTAGTACCTGG + Intergenic
1120884125 14:89438855-89438877 GCAGGAGAATCCTTAGAACCTGG - Intronic
1124189386 15:27560553-27560575 CCAGGAGAGCACTTAAAACCAGG - Intergenic
1125172476 15:36781435-36781457 TCAGGGTCACACTTGGAGCCTGG + Intronic
1125227633 15:37413052-37413074 TCAGGGGCACATTGAGAAGCAGG - Intergenic
1125645084 15:41265615-41265637 ACAGGAGAATACTTTGAACCTGG + Intronic
1125932671 15:43611584-43611606 TTAGGAACCCACTTAGGACCTGG - Intronic
1125945769 15:43711046-43711068 TTAGGAACCCACTTAGGACCTGG - Intergenic
1125977645 15:43969483-43969505 TCAGAAGCACACATAGAACTGGG - Intronic
1127893108 15:63272234-63272256 GCAGGAGAACAGTTTGAACCTGG - Intergenic
1129833234 15:78683985-78684007 GCAGGAGAACAGTTTGAACCTGG + Intronic
1132397230 15:101482779-101482801 TCAGGAGCAGACTCAGAATCAGG - Intronic
1134524968 16:14936247-14936269 GCAGGAGAACAGTTTGAACCCGG - Intronic
1134547926 16:15124676-15124698 GCAGGAGAACAGTTTGAACCCGG + Intronic
1134606464 16:15575170-15575192 TCTGGAAGACACTTAGAACAAGG + Intronic
1134712558 16:16334734-16334756 GCAGGAGAACAGTTTGAACCCGG - Intergenic
1134720423 16:16378045-16378067 GCAGGAGAACAGTTTGAACCCGG - Intergenic
1134947004 16:18333840-18333862 GCAGGAGAACAGTTTGAACCCGG + Intronic
1134954269 16:18373959-18373981 GCAGGAGAACAGTTTGAACCCGG + Intergenic
1139526117 16:67517999-67518021 TCAGGAGCTCCCTGAGAAACGGG + Intergenic
1152220224 17:79060041-79060063 GCAGGAGAACCCTTTGAACCTGG + Intergenic
1152767647 17:82149753-82149775 CCAGGCGCACACCCAGAACCTGG + Intronic
1152767667 17:82149825-82149847 CCAGGCGCACACCCAGAACCTGG + Intronic
1152767676 17:82149861-82149883 CCAGGAGCACACCCAGAACCTGG + Intronic
1152767703 17:82149987-82150009 CCAGGCGCACACCCAGAACCAGG + Intronic
1152767707 17:82150005-82150027 CCAGGCGCACACCCAGAACCTGG + Intronic
1152767721 17:82150059-82150081 CCAGGCACACACTCAGAACCTGG + Intronic
1152767732 17:82150113-82150135 CCAGGCGCACACCCAGAACCAGG + Intronic
1152767753 17:82150203-82150225 CCAGGCGCACACCCAGAACCAGG + Intronic
1152767757 17:82150221-82150243 CCAGGCGCACACCCAGAACCAGG + Intronic
1152767768 17:82150275-82150297 CCAGGCGCACACCCAGAACCTGG + Intronic
1152767783 17:82150347-82150369 CCAGGCGCACACCCAGAACCTGG + Intronic
1152767791 17:82150383-82150405 CCAGGCGCACACCCAGAACCAGG + Intronic
1152767807 17:82150455-82150477 CCAGGCGCACACCCAGAACCTGG + Intronic
1152767820 17:82150509-82150531 CCAGGCGCACACTCAGAACCTGG + Intronic
1152767844 17:82150635-82150657 CCAGGAGCACACCCAGAACCAGG + Intronic
1152767856 17:82150689-82150711 CCAGGCACACACTCAGAACCAGG + Intronic
1152767858 17:82150707-82150729 CCAGGCGCACACCTAGAACCTGG + Intronic
1152767870 17:82150761-82150783 CCAGGCGCACACTCAGAACCTGG + Intronic
1152767888 17:82150851-82150873 CCAGGCGCACACCCAGAACCTGG + Intronic
1152767906 17:82150923-82150945 CCAGGCGCACACCCAGAACCAGG + Intronic
1152767938 17:82151067-82151089 CCAGGCGCACACTCAGAACCTGG + Intronic
1152767957 17:82151157-82151179 CCAGGCGCACACCCAGAACCAGG + Intronic
1152767961 17:82151175-82151197 CCAGGCGCACACCCAGAACCAGG + Intronic
1152767998 17:82151337-82151359 CCAGGTGCACACCCAGAACCTGG + Intronic
1153346888 18:4035977-4035999 CCAAGAGGACACTTAGTACCGGG + Intronic
1156071435 18:33215866-33215888 CCAGGAGTTCACTTAGAGCCAGG + Intronic
1159123502 18:64196814-64196836 TTAGGAGCACATTTTGGACCAGG + Intergenic
1160063481 18:75552696-75552718 ACAGAAGCACACTTAAAACAAGG + Intergenic
1161722008 19:5908244-5908266 TGAGGAGGACAGTTTGAACCTGG + Intronic
1162563123 19:11429303-11429325 GCAGGAGAACAGTTTGAACCCGG - Intronic
1164147634 19:22521813-22521835 AAAGGAGCACACTCAGGACCCGG + Intronic
1164158974 19:22614286-22614308 AAAGGAGCACACTCAGGACCCGG - Intergenic
1164883799 19:31760188-31760210 TCAAGAGCACACCAAGGACCAGG - Intergenic
1165029744 19:32989201-32989223 GCAGGAGAACAGTTTGAACCTGG - Intronic
925959084 2:8998261-8998283 TCATGAGAACACTGAAAACCCGG - Intronic
928122550 2:28593552-28593574 GCAGGAGCAGACATGGAACCAGG - Intronic
928310612 2:30206657-30206679 TCAGGAGCCCACATAGTGCCTGG - Intergenic
929435452 2:41925404-41925426 TGAGAAGCACAGTTTGAACCTGG + Intergenic
929901150 2:46004926-46004948 TCTGCAGTACACTTGGAACCAGG - Intronic
930578900 2:53185935-53185957 TCAGGAGAACCATTTGAACCTGG - Intergenic
932479104 2:72028007-72028029 TCAGGAGCTCCCTCAGAGCCAGG + Intergenic
932510881 2:72288834-72288856 TCAGCAACACAGTTAGAAACTGG - Intronic
934870389 2:97859918-97859940 TCAAAGGCACACTTGGAACCTGG + Intronic
935184342 2:100718053-100718075 TCAGAAGCACACGAAAAACCCGG - Intergenic
935374525 2:102381068-102381090 TCAGGAGCAGAAGTAGAACTTGG + Intronic
936892138 2:117384080-117384102 GCAGGAGAACACCTTGAACCCGG - Intergenic
937298724 2:120825551-120825573 CCAGGAGCACACTCACAGCCAGG - Intronic
938967508 2:136401586-136401608 TCAGAAGCACACTTAGGAAGGGG + Intergenic
940860421 2:158765197-158765219 TCATGAGGACACCTAGCACCAGG + Intergenic
942532277 2:176923803-176923825 TCAGGGGAACACTGAGAACCAGG - Intergenic
1170392923 20:15894807-15894829 AGAGGAGAACACTTAGAACCAGG + Intronic
1172020885 20:31913285-31913307 CCAGTAGCACCCTCAGAACCTGG - Intronic
1173125229 20:40330319-40330341 TAAGGATCACTCTTATAACCCGG - Intergenic
1173300593 20:41799004-41799026 TCAGGAGTTCACATTGAACCTGG - Intergenic
1173341045 20:42153411-42153433 TCAGGAGCAGATTGAGGACCAGG + Intronic
1173767773 20:45629840-45629862 GCAGCAGCACACAGAGAACCAGG - Exonic
1173773801 20:45685944-45685966 GCAGCAGCACACAGAGAACCAGG + Intronic
1175829399 20:61953738-61953760 TGAGGAGGACACTTGGAACCAGG - Intronic
1177953513 21:27568383-27568405 TCAGGAGCATAGCTTGAACCCGG + Intergenic
1178930996 21:36819110-36819132 ACAGAAGCACACCTAGAAACTGG + Intronic
1181789472 22:25253055-25253077 TTATGAGTACACTTAGCACCTGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
955193784 3:56786090-56786112 ACATGTCCACACTTAGAACCAGG + Intronic
956726834 3:72163305-72163327 TCAGGAGAATAGTTTGAACCCGG + Intergenic
958126117 3:89357012-89357034 GCAGGAGAATACTTTGAACCTGG + Intronic
960758209 3:121043056-121043078 ACAGGGGCAAACTTAGGACCTGG - Intronic
965492103 3:169350254-169350276 TCAGGAAGAGACTTGGAACCTGG + Intronic
965716122 3:171605030-171605052 TCAGCAGCATCCTTAGCACCTGG - Intronic
967321717 3:188201235-188201257 TCAGGCACACAGTTAGAACAGGG + Intronic
967368863 3:188720004-188720026 GCAGGAGCACAGCTTGAACCTGG - Intronic
967498514 3:190169587-190169609 TCAGCAGCACCCTCAGAACTTGG - Intergenic
969052869 4:4385675-4385697 TCAAAGGCACACTTAGACCCTGG + Intronic
970288488 4:14545504-14545526 TCAGGAGCCTCCTTAGAAGCTGG + Intergenic
971549926 4:27940240-27940262 TCAGGAGAATCCTTTGAACCCGG + Intergenic
972006743 4:34119079-34119101 TCAGGAATACACTTAGAAGCAGG - Intergenic
973053945 4:45630691-45630713 TCAAGAGCACACACAGTACCTGG + Intergenic
975351425 4:73351412-73351434 GCAGGAGAATACTTTGAACCTGG + Intergenic
978688714 4:111481956-111481978 TCATTAGCAAACATAGAACCAGG - Intergenic
982248947 4:153384849-153384871 TGAGGAACACATTAAGAACCTGG - Intronic
983216485 4:165007346-165007368 TCAGGAGCTCATTTACAGCCTGG + Intergenic
983662382 4:170142511-170142533 TCAGGACCACTCTCAGAAACAGG - Intergenic
990552463 5:56897560-56897582 GCAGGAGCATCCTTTGAACCTGG - Intergenic
991075442 5:62531422-62531444 GCAGGAGAACAGTTTGAACCTGG - Intronic
992634913 5:78718111-78718133 GCAGGTGCACAGTTGGAACCTGG + Intronic
993085991 5:83364518-83364540 TCAGGAGAGCACTTGCAACCAGG + Intergenic
993329056 5:86573684-86573706 ACAGTAGAACATTTAGAACCTGG - Intergenic
997283206 5:132661374-132661396 TCAGGAGCAGACGGAGACCCAGG + Intergenic
1000404177 5:160868996-160869018 GCAGAAGCAAAATTAGAACCAGG - Intergenic
1001107040 5:168863215-168863237 CCAGGAGCATACTTTGAACTTGG + Intronic
1001998848 5:176184132-176184154 ACAGCAGCAGAATTAGAACCTGG + Intergenic
1002796784 6:478033-478055 GCAGGAGGAGACTTAGATCCAGG + Intergenic
1003673548 6:8181819-8181841 TCAGGGGCACAAATAGGACCAGG + Intergenic
1003757505 6:9138108-9138130 GCAGGAGCAAACTTAGAACAAGG + Intergenic
1004682025 6:17905245-17905267 TTAGGAGAATACTTAGAACAGGG - Intronic
1007568384 6:42870987-42871009 TCAGGAAAATACTAAGAACCAGG - Intergenic
1007825442 6:44596319-44596341 TCCAGAGCACACCTAGAACCAGG - Intergenic
1010500242 6:76590384-76590406 TCAGGAGCACACTGAAAGCAGGG + Intergenic
1013405693 6:109840927-109840949 TCAGGAGCACACTTAGAATGGGG + Intergenic
1013744744 6:113332523-113332545 TCAGCACCAAACTTTGAACCTGG + Intergenic
1014876447 6:126666947-126666969 TCCAGAGCACACCTAGTACCTGG + Intergenic
1015266035 6:131293420-131293442 TAAGGACCACACGGAGAACCTGG + Intergenic
1017447722 6:154523384-154523406 TCAGAAGCAAAGTTAGTACCAGG + Intergenic
1017697495 6:157031882-157031904 GCAGGAGAACAGCTAGAACCAGG - Intronic
1018990869 6:168672736-168672758 GCAGGAGAACCCTTTGAACCTGG - Intronic
1024534622 7:50419938-50419960 TCAGGAGAACCCTCAGAAGCTGG + Intergenic
1027487844 7:78784306-78784328 TCAGAAGCAGCCTCAGAACCAGG + Intronic
1027889608 7:83953949-83953971 TCAGCAGCACAGTTAAAAACAGG - Intergenic
1028138963 7:87251240-87251262 TCAGAAACTCACTAAGAACCAGG + Intergenic
1030259221 7:107544446-107544468 GCTGGAGCAGACTTAGATCCAGG - Intronic
1033451115 7:141463116-141463138 TCAGGAGTCCACTTAGAAGAAGG - Intronic
1033947316 7:146736435-146736457 TCAGGAAAACACTTAGCACAAGG - Intronic
1034133827 7:148746460-148746482 TCAGGATCAGACTTAGAAAATGG + Intronic
1038449078 8:27627432-27627454 TAAGGATCACACAGAGAACCTGG + Intergenic
1040164329 8:44316452-44316474 ACAGGAGCATTCTCAGAACCTGG + Intergenic
1040683005 8:49836714-49836736 TCAGGAGGAAATTTAGAACAAGG - Intergenic
1044803125 8:95977388-95977410 TCAGGAGCAGACTTCAAAACTGG + Intergenic
1046911257 8:119630200-119630222 GCAGGAGAACCCTTTGAACCCGG - Intronic
1047069640 8:121329109-121329131 GCAGGAGAATCCTTAGAACCTGG - Intergenic
1051214998 9:14787900-14787922 TAAGGAACACATTTACAACCAGG + Intronic
1053653649 9:40194194-40194216 TCAGGAGGAAATTCAGAACCTGG - Intergenic
1053904048 9:42823485-42823507 TCAGGAGGAAATTCAGAACCTGG - Intergenic
1054530937 9:66182028-66182050 TCAGGAGGAAATTCAGAACCTGG + Intergenic
1058468226 9:105250102-105250124 GCAGGAGCATAGTTTGAACCCGG - Intronic
1060394463 9:123305781-123305803 TCAGGAGCATCATTTGAACCTGG - Intergenic
1061012811 9:127965470-127965492 CCAGGAGCACAGCTGGAACCTGG - Intronic
1186280099 X:7983445-7983467 ACGGGAGCACACTTAAAAGCAGG - Intergenic
1186734013 X:12441608-12441630 TAAGGAGCAAACTGAGAAGCTGG + Intronic
1187384852 X:18839250-18839272 CCAGGAGCTCACACAGAACCAGG - Intergenic
1189175784 X:38955873-38955895 TTTGGATCACACTTAGAATCAGG - Intergenic
1193335902 X:80288738-80288760 TCAGGAGCACTCTCACAACCTGG - Intergenic
1195725087 X:107906677-107906699 TCAGGAGAATCCTTTGAACCTGG - Intronic
1199426616 X:147709247-147709269 TAAGGGGCAGACTTAGAACTTGG - Intergenic